CN104278031A - Promoter A regulated by xanthine as well as recombinant expression vector and application of promoter A - Google Patents

Abstract

The invention relates to the field of molecular biology and in particular relates to a promoter A regulated by xanthine as well as a recombinant expression vector and application of the promoter A. The promoter A regulated by the xanthine disclosed by the invention has a nucleotide sequence shown in SEQ ID NO.1. A DNA fragment used for xanthine induction comprises the promoter A regulated by the xanthine, encoding genes for regulating proteins HucR, encoding genes for transporting proteins YgfU, encoding genes for driving and regulating the proteins HucR, a promoter CP6 for expressing the encoding genes for transporting the proteins YgfU, and red fluorescence protein genes; and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.2. A novel promoter is obtained by transforming -35 and -10 regions of Escherichia coli lac promoters, and the promoter can induce expression of a target protein by matching the regulator protein HucR and the transport protein YgfU by utilizing the xanthine.

Description

A kind of promotor A by xanthine regulation and control and recombinant expression vector and application

Technical field

The present invention relates to biology field, particularly, the present invention relates to a kind of promotor A by xanthine regulation and control and recombinant expression vector and application thereof.

Background technology

In today that synthetic biology is flourish, the controlling element that research and development are opened by dissimilar inductor, sensitive, regulate metabolic fluxes in real time, contribute to effective metabolic pathway reasonable in design, significant to the efficient synthesis of final purpose product.As dynamic adjustments induction system (the Dynamic sensor-regulator system that the people such as Keasling are built by the transcriptional regulatory element of design escherichia coli fatty acid metabolism interim key meta-bolites, DSRS), the throughput of convert fatty acids generation biofuel improves 3 times of (Design of a dynamic sensor-regulator system for production of chemicals and fuels derived from fatty acids the most at last, Nature Biotechnology, 2012).

Colibacillary lactose operon is furtherd investigate as the promoter element of classics.The structure of many promotors is all transform to form in the functional element of lactose maneuvering system.As tac promotor and trc promotor, by-35th district of trp promoter with-10th district of lac promotor are combined and spliced forms, improved promotor has higher expression efficiency than lac promotor.T7 promotor then utilizes gratuitous inducer isopropyl-beta D-thio galactopyranoside (IPTG) to regulate and control the expression of t7 rna polymerase, and then opens T7 promoter systems expression downstream recombinant protein; This technology is developed serial commercialization carrier by companies such as Novagen, as the high-expression vector of heterologous protein.

The genome analysis of the extreme microorganism radioresistant cocci (Deinococcus radiodurans) of the strong radiation hardness characteristic of tool discloses the relevant partial function assembly of this bacterium adverse-resistant characteristic.Wherein, to modulin (the hypothetical uricase regulator that coding region dr1159 encodes, HucR) research display, HucR is by forming the dimeric form of albumen, the promoter region of himself encoding sequence can be incorporated into, also can be incorporated into the promoter region (hucO) of the uriKoxidase encoding sequence contrary with himself encoding sequence direction; After being combined with uric acid or xanthine, HucR protein structure changes, and dissociates from DNA binding site, thus opens the expression of downstream gene; Therefore, HucR regulator control system becomes radioresistant cocci environmentally situation change, Effective Regulation HucR albumen itself and improve the system of stress from outside environment.Wherein, xanthine is the node of the mesostate of the alkaloid metabolism such as purine metabolism, caffeine and microorganism reply stress from outside environment.Therefore, design the detection system effectively sensitive to xanthine content and contribute to metabolic pathway such as design biosynthesizing (especially Microbe synthesis) purine medicaments, alkaloid etc., contribute to the high-throughput screening method building key enzyme in above-mentioned metabolic pathway, contribute to the stress reaction etc. of the stressful environmental to external world of microorganism rapid sensitive.

Summary of the invention

The object of this invention is to provide a kind of promotor A by xanthine regulation and control.

Another object of the present invention is to provide a kind of DNA fragmentation for xanthine induction.

Another object of the present invention is to provide a kind of recombinant expression vector for xanthine induction expression protein.

Another object of the present invention is to provide the recombinant bacterial strain comprising above-mentioned recombinant expression vector.

Another object of the present invention is to provide a kind of transgenic cell line by xanthine induction expression protein.

Another object of the present invention is to provide the application of above-mentioned promotor A, DNA fragmentation, recombinant expression vector, recombinant bacterial strain or transgenic cell line.

Promotor A by xanthine regulation and control of the present invention, its nucleotide sequence is as shown in SEQ ID NO.1:

tttacatagg tagacatcta agtatatgtt gtgtggaacc gatttaataa aacaattt 58

DNA fragmentation for xanthine induction of the present invention, wherein, the promotor CP6 that the encoding gene that described DNA fragmentation comprises the promotor A by xanthine regulation and control according to claim 1, the encoding gene of modulin HucR, the encoding gene of translocator YgfU, the encoding gene driving modulin HucR and translocator YgfU is expressed and red fluorescent protein gene, the nucleotide sequence of described DNA fragmentation is as shown in SEQ ID NO.2:

tttacatagg tagacatcta agtatatgtt gtgtggaacc gatttaataa aacaatttca 60

cacaggaaac agctatgacc atgattacgc caagcttgca tgcctgcagg tcgactctag 120

tggatccccg ggtaccgatg gcctcctccg aggacgtcat caaggagttc atgcgcttca 180

aggtgcgcat ggagggctcc gtgaacggcc acgagttcga gatcgagggc gagggcgagg 240

gccgccccta cgagggcacc cagaccgcca agctgaaggt gaccaagggc ggccccctgc 300

ccttcgcctg ggacatcctg tccccccagt tccagtacgg ctccaaggtg tacgtgaagc 360

accccgccga catccccgac tacaagaagc tgtccttccc cgagggcttc aagtgggagc 420

gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac ccaggactcc tccctgcagg 480

acggctcctt catctacaag gtgaagttca tcggcgtgaa cttcccctcc gacggccccg 540

taatgcagaa gaagactatg ggctgggagg cctccaccga gcgcctgtac ccccgcgacg 600

gcgtgctgaa gggcgagatc cacaaggccc tgaagctgaa ggacggcggc cactacctgg 660

tggagttcaa gtccatctac atggccaaga agcccgtgca gctgcccggc tactactacg 720

tggactccaa gctggacatc acctcccaca acgaggacta caccatcgtg gagcagtacg 780

agcgcgccga gggccgccac cacctgttcc tgtagagatc tccaactgag cgccggtcgc 840

taccattacc aacttgtctg gtgtcaaaaa taataggcct actagtcggc cgtacgggcc 900

ctttcgtctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga 960

gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 1020

agcgggtgtt ggcgggtgtc ggggctgggc tagcttattc tccatgctca tttttcttca 1080

gcttgcgcat cagaagccac atacgtactg tcctgacttt taaatcttta tcagagacgg 1140

attccttcac caggtcagca tgatgctgat agccattaaa gaagacgttc agcacaacgg 1200

cgctaagggt tgcgagcata atgccgctat gtagcagcgg ttgcagtacg gccggtaact 1260

tagaaaagaa atcgtgagag agcgtcggag tcatgccaac gccgagactg atcgccacaa 1320

tatagaggtt gtaacggttg gtggtgtagt tacagcgcga cagaattcga atccctgtcg 1380

ccagtaccat gccgaacatc actagaccag cgccgcccag cacaaattgc ggaatggagg 1440

ctaccagcac cgccattttt ggcaccatgc caaacaggat taatataatt cccgaagaaa 1500

tacacaccca gcggctatga acgcgcgtca cgctaaccag gccaacgttt tgagaaaatg 1560

acgtgtgggg gaagctgtta aacgtgccgc ctatcattgt ccctacgcca tcgacacgca 1620

gcccgcgaat aatatcgtgc gaagagagtt tacgaccgac tatttcaccc agtgccagga 1680

acatccccat tgactcgata aacacgatga ttaacacggc agtcatggtc agaatggaaa 1740

cgggatcgaa aatcggcata ccaaacgaca tcggcgtaac aatcgcaaac catgaagcat 1800

catgtagccc ggataaattg acttcattca tcatccacga aagtaaaaag ccaaatacaa 1860

tccccagtaa tacggcgacg ttggacataa atcctttcgc atagcgagta atgagcaaga 1920

taaaaattaa gacggcaaag gagataccta aataaacggg attaccatat tgcggattcc 1980

ctttacctcc ggcggcccag tcaataccca cctgaatgat gctaagcccg atagaagtaa 2040

taaccacacc ggtaaccagt ggcgggaata aaggcatcaa gcgaccgata agtggcgcta 2100

ataatgtggt gataaaaccc gcggcgatag tggcaccaaa tatccccagc aggccgatat 2160

ccgggttcat cccaatggct atcattggtg ttacagcagc aaaggtcacc gacataatca 2220

ccggcaggcg gatccccata aagcggccga taccgataca ttgcaataat gtgacgatcc 2280

cgcagcaaaa gagatccgag ctaatgagca tcgcaatagc ttcttttgag aggcccagtc 2340

ggtcaccaat cataagagga acagcgactg cacctgcgta catgacaagg acgtgttgca 2400

gaccgagtat gatcagcttt cctggtgata atatgcggtc aacctcatca gttgggcggt 2460

cttgcccaga agatgaggga agttgggaat ctatggcgct cattgtactc ttcgagctca 2520

acaccctgtt cgaggcccgc cagcatacga ccagccagtt cttccagagt acgctgttcc 2580

tgcgcagaca gcggcgccag cacacgctga gtggtcgcca ggtgagctgg cagcagatga 2640

gtaaccagcg cacggccctg cggagtcaga cggatgcttg cagaacggcg gtcgcgctca 2700

tcttcgcggc gttcaatcag acctttttcc agaagacgaa caatgcggtt agaagtggac 2760

gggccgctga tcgccgccag ggcggacagt tcggtcgggc gcagaccttc cggcggagca 2820

gaacggtaca gggtcagcag caggtcccaa cccgcagcgt tcaggccaga tgccgcataa 2880

gtacgttcaa tttcacgacc cagtgcagcg tgcagacgct ccagcagcag cagggtcagc 2940

atcgggccag cgcttggggt cagaccatcg gaatccggac cttgaccatg gttcaggcgt 3000

gcccagtcgc tacgaatacg ttccagcagc gcagcagtat cgttatccat gcgcgcgctc 3060

atcatatgtg cctccttcta gacccattct taaggatccc gaacagtact cagttattat 3120

atcatccgga aatatctgtg tcaagaataa actcccacat g 3161

Recombinant expression vector for xanthine induction expression protein of the present invention, comprises the above-mentioned promotor A by xanthine regulation and control.

According to recombinant expression vector of the present invention, preferably, described expression vector is plasmid SHY, comprises DNA fragmentation according to claim 2, and the nucleotide sequence of described plasmid SHY is as shown in SEQ ID NO.3:

agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc 60

acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc 120

tcactcatta ggcaccccag gctttacata ggtagacatc taagtatatg ttgtgtggaa 180

ccgatttaat aaaacaattt cacacaggaa acagctatga ccatgattac gccaagcttg 240

catgcctgca ggtcgactct agtggatccc cgggtaccga tggcctcctc cgaggacgtc 300

atcaaggagt tcatgcgctt caaggtgcgc atggagggct ccgtgaacgg ccacgagttc 360

gagatcgagg gcgagggcga gggccgcccc tacgagggca cccagaccgc caagctgaag 420

gtgaccaagg gcggccccct gcccttcgcc tgggacatcc tgtcccccca gttccagtac 480

ggctccaagg tgtacgtgaa gcaccccgcc gacatccccg actacaagaa gctgtccttc 540

cccgagggct tcaagtggga gcgcgtgatg aacttcgagg acggcggcgt ggtgaccgtg 600

acccaggact cctccctgca ggacggctcc ttcatctaca aggtgaagtt catcggcgtg 660

aacttcccct ccgacggccc cgtaatgcag aagaagacta tgggctggga ggcctccacc 720

gagcgcctgt acccccgcga cggcgtgctg aagggcgaga tccacaaggc cctgaagctg 780

aaggacggcg gccactacct ggtggagttc aagtccatct acatggccaa gaagcccgtg 840

cagctgcccg gctactacta cgtggactcc aagctggaca tcacctccca caacgaggac 900

tacaccatcg tggagcagta cgagcgcgcc gagggccgcc accacctgtt cctgtagaga 960

tctccaactg agcgccggtc gctaccatta ccaacttgtc tggtgtcaaa aataataggc 1020

ctactagtcg gccgtacggg ccctttcgtc tcgcgcgttt cggtgatgac ggtgaaaacc 1080

tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 1140

gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggctgg gctagcttat 1200

tctccatgct catttttctt cagcttgcgc atcagaagcc acatacgtac tgtcctgact 1260

tttaaatctt tatcagagac ggattccttc accaggtcag catgatgctg atagccatta 1320

aagaagacgt tcagcacaac ggcgctaagg gttgcgagca taatgccgct atgtagcagc 1380

ggttgcagta cggccggtaa cttagaaaag aaatcgtgag agagcgtcgg agtcatgcca 1440

acgccgagac tgatcgccac aatatagagg ttgtaacggt tggtggtgta gttacagcgc 1500

gacagaattc gaatccctgt cgccagtacc atgccgaaca tcactagacc agcgccgccc 1560

agcacaaatt gcggaatgga ggctaccagc accgccattt ttggcaccat gccaaacagg 1620

attaatataa ttcccgaaga aatacacacc cagcggctat gaacgcgcgt cacgctaacc 1680

aggccaacgt tttgagaaaa tgacgtgtgg gggaagctgt taaacgtgcc gcctatcatt 1740

gtccctacgc catcgacacg cagcccgcga ataatatcgt gcgaagagag tttacgaccg 1800

actatttcac ccagtgccag gaacatcccc attgactcga taaacacgat gattaacacg 1860

gcagtcatgg tcagaatgga aacgggatcg aaaatcggca taccaaacga catcggcgta 1920

acaatcgcaa accatgaagc atcatgtagc ccggataaat tgacttcatt catcatccac 1980

gaaagtaaaa agccaaatac aatccccagt aatacggcga cgttggacat aaatcctttc 2040

gcatagcgag taatgagcaa gataaaaatt aagacggcaa aggagatacc taaataaacg 2100

ggattaccat attgcggatt ccctttacct ccggcggccc agtcaatacc cacctgaatg 2160

atgctaagcc cgatagaagt aataaccaca ccggtaacca gtggcgggaa taaaggcatc 2220

aagcgaccga taagtggcgc taataatgtg gtgataaaac ccgcggcgat agtggcacca 2280

aatatcccca gcaggccgat atccgggttc atcccaatgg ctatcattgg tgttacagca 2340

gcaaaggtca ccgacataat caccggcagg cggatcccca taaagcggcc gataccgata 2400

cattgcaata atgtgacgat cccgcagcaa aagagatccg agctaatgag catcgcaata 2460

gcttcttttg agaggcccag tcggtcacca atcataagag gaacagcgac tgcacctgcg 2520

tacatgacaa ggacgtgttg cagaccgagt atgatcagct ttcctggtga taatatgcgg 2580

tcaacctcat cagttgggcg gtcttgccca gaagatgagg gaagttggga atctatggcg 2640

ctcattgtac tcttcgagct caacaccctg ttcgaggccc gccagcatac gaccagccag 2700

ttcttccaga gtacgctgtt cctgcgcaga cagcggcgcc agcacacgct gagtggtcgc 2760

caggtgagct ggcagcagat gagtaaccag cgcacggccc tgcggagtca gacggatgct 2820

tgcagaacgg cggtcgcgct catcttcgcg gcgttcaatc agaccttttt ccagaagacg 2880

aacaatgcgg ttagaagtgg acgggccgct gatcgccgcc agggcggaca gttcggtcgg 2940

gcgcagacct tccggcggag cagaacggta cagggtcagc agcaggtccc aacccgcagc 3000

gttcaggcca gatgccgcat aagtacgttc aatttcacga cccagtgcag cgtgcagacg 3060

ctccagcagc agcagggtca gcatcgggcc agcgcttggg gtcagaccat cggaatccgg 3120

accttgacca tggttcaggc gtgcccagtc gctacgaata cgttccagca gcgcagcagt 3180

atcgttatcc atgcgcgcgc tcatcatatg tgcctccttc tagacccatt cttaaggatc 3240

ccgaacagta ctcagttatt atatcatccg gaaatatctg tgtcaagaat aaactcccac 3300

atgcataatg ggatcctgca ggaattcgat atcaagctta tcgataccgt cgacctcgag 3360

tgaaataccg cacagatgcg taaggagaaa ataccgcatc aggcggcctt aagggcctcg 3420

tgatacgcct atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg 3480

gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 3540

atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 3600

agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 3660

ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 3720

gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 3780

gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 3840

tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 3900

acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 3960

aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 4020

cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 4080

gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 4140

cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 4200

tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 4260

tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 4320

ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 4380

tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 4440

gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 4500

ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 4560

tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 4620

agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 4680

aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 4740

cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt 4800

agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 4860

tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 4920

gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 4980

gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 5040

ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 5100

gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 5160

ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 5220

ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 5280

acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt 5340

gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag 5400

cggaag 5406

The coding gene sequence of the modulin HucR described in above-mentioned DNA fragmentation is above-mentioned plasmid SHY(SEQ ID NO.3) from 5 ' end 2662-3224 Nucleotide, concrete nucleotide sequence is as shown in SEQ ID NO.6:

aacaccctgt tcgaggcccg ccagcatacg accagccagt tcttccagag tacgctgttc 60

ctgcgcagac agcggcgcca gcacacgctg agtggtcgcc aggtgagctg gcagcagatg 120

agtaaccagc gcacggccct gcggagtcag acggatgctt gcagaacggc ggtcgcgctc 180

atcttcgcgg cgttcaatca gacctttttc cagaagacga acaatgcggt tagaagtgga 240

cgggccgctg atcgccgcca gggcggacag ttcggtcggg cgcagacctt ccggcggagc 300

agaacggtac agggtcagca gcaggtccca acccgcagcg ttcaggccag atgccgcata 360

agtacgttca atttcacgac ccagtgcagc gtgcagacgc tccagcagca gcagggtcag 420

catcgggcca gcgcttgggg tcagaccatc ggaatccgga ccttgaccat ggttcaggcg 480

tgcccagtcg ctacgaatac gttccagcag cgcagcagta tcgttatcca tgcgcgcgct 540

catcatatgt gcctccttct aga 563

The coding gene sequence of described translocator YgfU be above-mentioned plasmid SHY from 5 ' end 1197-2645 Nucleotide, concrete nucleotide sequence is as shown in SEQ ID NO.7:

ttattctcca tgctcatttt tcttcagctt gcgcatcaga agccacatac gtactgtcct 60

gacttttaaa tctttatcag agacggattc cttcaccagg tcagcatgat gctgatagcc 120

attaaagaag acgttcagca caacggcgct aagggttgcg agcataatgc cgctatgtag 180

cagcggttgc agtacggccg gtaacttaga aaagaaatcg tgagagagcg tcggagtcat 240

gccaacgccg agactgatcg ccacaatata gaggttgtaa cggttggtgg tgtagttaca 300

gcgcgacaga attcgaatcc ctgtcgccag taccatgccg aacatcacta gaccagcgcc 360

gcccagcaca aattgcggaa tggaggctac cagcaccgcc atttttggca ccatgccaaa 420

caggattaat ataattcccg aagaaataca cacccagcgg ctatgaacgc gcgtcacgct 480

aaccaggcca acgttttgag aaaatgacgt gtgggggaag ctgttaaacg tgccgcctat 540

cattgtccct acgccatcga cacgcagccc gcgaataata tcgtgcgaag agagtttacg 600

accgactatt tcacccagtg ccaggaacat ccccattgac tcgataaaca cgatgattaa 660

cacggcagtc atggtcagaa tggaaacggg atcgaaaatc ggcataccaa acgacatcgg 720

cgtaacaatc gcaaaccatg aagcatcatg tagcccggat aaattgactt cattcatcat 780

ccacgaaagt aaaaagccaa atacaatccc cagtaatacg gcgacgttgg acataaatcc 840

tttcgcatag cgagtaatga gcaagataaa aattaagacg gcaaaggaga tacctaaata 900

aacgggatta ccatattgcg gattcccttt acctccggcg gcccagtcaa tacccacctg 960

aatgatgcta agcccgatag aagtaataac cacaccggta accagtggcg ggaataaagg 1020

catcaagcga ccgataagtg gcgctaataa tgtggtgata aaacccgcgg cgatagtggc 1080

accaaatatc cccagcaggc cgatatccgg gttcatccca atggctatca ttggtgttac 1140

agcagcaaag gtcaccgaca taatcaccgg caggcggatc cccataaagc ggccgatacc 1200

gatacattgc aataatgtga cgatcccgca gcaaaagaga tccgagctaa tgagcatcgc 1260

aatagcttct tttgagaggc ccagtcggtc accaatcata agaggaacag cgactgcacc 1320

tgcgtacatg acaaggacgt gttgcagacc gagtatgatc agctttcctg gtgataatat 1380

gcggtcaacc tcatcagttg ggcggtcttg cccagaagat gagggaagtt gggaatctat 1440

ggcgctcat 1449

The coding gene sequence of the promotor CP6 that the encoding gene of above-mentioned driving modulin HucR and the encoding gene of translocator YgfU are expressed is that above-mentioned plasmid SHY is from 5 ' end 1197-2645 Nucleotide.

The coding gene sequence of above-mentioned red fluorescent protein gene is that above-mentioned plasmid SHY is from 5 ' end 280-957 Nucleotide.

Present invention also offers the recombinant bacterial strain comprising recombinant expression vector described in claim 3 or 4.

According to recombinant bacterial strain of the present invention, above-mentioned thalline is preferably intestinal bacteria.

Transgenic cell line by xanthine induction expression protein of the present invention, comprises the promotor A by xanthine regulation and control according to claim 1.

Method by xanthine induction expression protein of the present invention, comprises the following steps:

1) encoding gene of target protein is imported in host strain by the recombinant expression vector described in claim 3 or 4, obtain recombinant bacterial strain;

2) ferment in containing xanthic substratum above-mentioned recombinant bacterial strain, realizes xanthine induction target protein and express.

Present invention also offers the above-mentioned application being subject to the promotor A of xanthine regulation and control, DNA fragmentation, recombinant expression vector, recombinant bacterial strain and/or the transgenic cell line for xanthine induction, preferably they induce the application in target protein expression or the detection of xanthine biotype at xanthine.

Above-mentioned xanthine biotype detects to be specially and utilizes target protein expression level to monitor xanthine concentration.

The key element of the HucR regulator control system of the present invention's radioresistant cocci has transformed E. coli lactose promoter, and making it can by xanthine induction regulating controlling.For verifying this result; system constructing with this promotor and reporter gene (red fluorescent protein) is applicable to colibacillary plasmid by the present invention; this plasmid comprises replication origin, resistance screening gene, modulin HucR; simultaneously in order to strengthen its sensitivity, this plasmid also comprises can to self translocator YgfU of the xanthic intestinal bacteria of intracellular transport.Transformation of the present invention is as shown in sequence (SEQ ID NO.5) below:

tttacaTAGGTAGACATCTAAGTA tatgttgtgtggaaccgatttaataaaacaatttcacac aggaaacagctatgaccatgattacgccaagcttgcatgcctgcaggtcgactctagtggatccccgggtaccg

Underlined region is E. coli lac promoter-35 district and-10th district; Capitalization thickened portion is HucR modulin binding site; Italicized item is the transformation that this research is done DsRed plasmid, is intended to destroy lacO region, namely gets rid of LacI modulin to the interference of this research; Black matrix underlined sequences is ribosome bind site district; In carrier of the present invention (as SHY plasmid), after above-mentioned SEQ ID NO.5 sequence, insert goal gene sequence (ATG).

The present invention is by transformation E. coli lac promoter-35 district and-10th district, and obtain a new promotor, this promotor can, under the cooperation of modulin HucR and translocator YgfU, utilize xanthine to induce the expression of target protein.Promotor of the present invention and correlated expression system can be used to carry out target protein expression under xanthic induction.The present invention also can be used for xanthine biotype detection system.

Accompanying drawing explanation

Fig. 1 is the structural representation of SHY plasmid in the embodiment of the present invention.

Fig. 2 is the induction result of recombinant bacterium DH5 α/SHY in the embodiment of the present invention.

Embodiment

The experimental technique used in following embodiment if no special instructions, be ordinary method, specifically can refer to concrete grammar listed in " Molecular Cloning: A Laboratory guide " (third edition) J. Pehanorm Brooker one book to carry out, or carry out according to test kit and product description; Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.

The acquisition of embodiment 1 promotor A and the DNA fragmentation for xanthine induction

The nucleotide sequence (SEQ ID NO.3) of the described plasmid SHY in following embodiment and unique difference of control plasmid HY nucleotide sequence (SEQ ID NO.8) be only by SEQ ID NO.8 from the lac promotor of 5 ' end 143-200 position Nucleotide replace with SEQ ID NO.3 from the promotor A(shown in 5 ' end 143-200 position Nucleotide and SEQ ID NO.1).

The concrete construction process of above-mentioned plasmid is as follows:

1, the acquisition of modulin HucR and encoding gene thereof

Extract radioresistant cocci (Deinococcus radiodurans) (ATCC13939) genomic dna and with it for template, with 5 '-gcacatatgatgagcgcgcgcatggataac-3 ' (forward) and 5 '-agagagctcttaaacaccctgttcgaggc-3 ' (reverse) for primer carries out pcr amplification.Pcr amplification condition is as follows: first 95 DEG C of denaturation 4min, then 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 30s, totally 30 circulations; Last 72 DEG C extend 10min.

Reclaim above-mentioned PCR reaction product, carry out agarose gel electrophoresis detection, obtain the band (through order-checking, the nucleotides sequence of its encoding sequence is classified as shown in SEQ ID NO. 6) of 563bp.

By the PCR primer NdeI of above-mentioned acquisition 563bp and SacI double digestion, DsRed carrier (Clontech company, production code member 632412) the carrier framework T of digestion products and the 3311bp cut through same enzyme ₄ligase enzyme (purchased from precious biotech firm) 16 DEG C of connections are spent the night, and connect product conversion and enter intestinal bacteria MC1061 competent cell, obtain recombinant bacterium.

Extract the plasmid of recombinant bacterium, this plasmid is for inserting DsRed carrier (existing constitutive promoter CP6 by the modulin HucR gene shown in SEQ ID NO.6, after this promotor, insert modulin HucR gene) NdeI and SacI restriction enzyme site between the carrier that obtains, sequence verification is errorless, called after SH plasmid, this plasmid comprise drive HucR encoding gene to express promotor CP6(SEQ ID NO.3 from 5 ' end 3244-3303 Nucleotide), HucR encoding gene (SEQ ID NO.6).

SEQ ID NO.3 is the encoding gene of modulin HucR from 5 ' end 2662-3224 Nucleotide, and the aminoacid sequence of the modulin HucR of coding is as shown in SEQ ID NO.15:

Met Ser Ala Arg Met Asp Asn Asp Thr Ala Ala Leu Leu Glu Arg Ile

1 5 10 15

Arg Ser Asp Trp Ala Arg Leu Asn His Gly Gln Gly Pro Asp Ser Asp

20 25 30

Gly Leu Thr Pro Ser Ala Gly Pro Met Leu Thr Leu Leu Leu Leu Glu

35 40 45

Arg Leu His Ala Ala Leu Gly Arg Glu Ile Glu Arg Thr Tyr Ala Ala

50 55 60

Ser Gly Leu Asn Ala Ala Gly Trp Asp Leu Leu Leu Thr Leu Tyr Arg

65 70 75 80

Ser Ala Pro Pro Glu Gly Leu Arg Pro Thr Glu Leu Ser Ala Leu Ala

85 90 95

Ala Ile Ser Gly Pro Ser Thr Ser Asn Arg Ile Val Arg Leu Leu Glu

100 105 110

Lys Gly Leu Ile Glu Arg Arg Glu Asp Glu Arg Asp Arg Arg Ser Ala

115 120 125

Ser Ile Arg Leu Thr Pro Gln Gly Arg Ala Leu Val Thr His Leu Leu

130 135 140

Pro Ala His Leu Ala Thr Thr Gln Arg Val Leu Ala Pro Leu Ser Ala

145 150 155 160

Gln Glu Gln Arg Thr Leu Glu Glu Leu Ala Gly Arg Met Leu Ala Gly

165 170 175

Leu Glu Gln Gly Val

180

2, the acquisition of translocator YgfU and encoding gene and control plasmid HY

Extract intestinal bacteria MC1061(Casadaban, MJ & Cohen, SN (1980) Analysis of gene control signals by DNA fusion and cloning in Escherichia coli.J.Mol.Biol.138179-207; The public can obtain from Institute of Microorganism, Academia Sinica) genomic dna and with it for template, with 5 '-ttcgagctcaacaccctgttcgaggcccgc-3 ' (forward) and 5 '-gctgaagaaaaatgagcatggagaataagctagccca-3 ' (reverse) for primer carries out pcr amplification.Pcr amplification condition is as follows: first 95 DEG C of denaturation 4min, then 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 1min30s, totally 30 circulations; Last 72 DEG C extend 10min.

Reclaim above-mentioned PCR reaction product, carry out agarose gel electrophoresis detection, obtain the band (for SEQ ID NO.3 is from the shown translocator YgfU encoding gene of 5 ' end 1197-2645 position Nucleotide, specifically as shown in SEQ ID NO.7) of 1449bp.The aminoacid sequence of the xanthine translocator YgfU of coding is as shown in SEQ ID NO.16:

Met Ser Ala Ile Asp Ser Gln Leu Pro Ser Ser Ser Gly Gln Asp Arg

1 5 10 15

Pro Thr Asp Glu Val Asp Arg Ile Leu Ser Pro Gly Lys Leu Ile Ile

20 25 30

Leu Gly Leu Gln His Val Leu Val Met Tyr Ala Gly Ala Val Ala Val

35 40 45

Pro Leu Met Ile Gly Asp Arg Leu Gly Leu Ser Lys Glu Ala Ile Ala

50 55 60

Met Leu Ile Ser Ser Asp Leu Phe Cys Cys Gly Ile Val Thr Leu Leu

65 70 75 80

Gln Cys Ile Gly Ile Gly Arg Phe Met Gly Ile Arg Leu Pro Val Ile

85 90 95

Met Ser Val Thr Phe Ala Ala Val Thr Pro Met Ile Ala Ile Gly Met

100 105 110

Asn Pro Asp Ile Gly Leu Leu Gly Ile Phe Gly Ala Thr Ile Ala Ala

115 120 125

Gly Phe Ile Thr Thr Leu Leu Ala Pro Leu Ile Gly Arg Leu Met Pro

130 135 140

Leu Phe Pro Pro Leu Val Thr Gly Val Val Ile Thr Ser Ile Gly Leu

145 150 155 160

Ser Ile Ile Gln Val Gly Ile Asp Trp Ala Ala Gly Gly Lys Gly Asn

165 170 175

Pro Gln Tyr Gly Asn Pro Val Tyr Leu Gly Ile Ser Phe Ala Val Leu

180 185 190

Ile Phe Ile Leu Leu Ile Thr Arg Tyr Ala Lys Gly Phe Met Ser Asn

195 200 205

Val Ala Val Leu Leu Gly Ile Val Phe Gly Phe Leu Leu Ser Trp Met

210 215 220

Met Asn Glu Val Asn Leu Ser Gly Leu His Asp Ala Ser Trp Phe Ala

225 230 235 240

Ile Val Thr Pro Met Ser Phe Gly Met Pro Ile Phe Asp Pro Val Ser

245 250 255

Ile Leu Thr Met Thr Ala Val Leu Ile Ile Val Phe Ile Glu Ser Met

260 265 270

Gly Met Phe Leu Ala Leu Gly Glu Ile Val Gly Arg Lys Leu Ser Ser

275 280 285

His Asp Ile Ile Arg Gly Leu Arg Val Asp Gly Val Gly Thr Met Ile

290 295 300

Gly Gly Thr Phe Asn Ser Phe Pro His Thr Ser Phe Ser Gln Asn Val

305 310 315 320

Gly Leu Val Ser Val Thr Arg Val His Ser Arg Trp Val Cys Ile Ser

325 330 335

Ser Gly Ile Ile Leu Ile Leu Phe Gly Met Val Pro Lys Met Ala Val

340 345 350

Leu Val Ala Ser Ile Pro Gln Phe Val Leu Gly Gly Ala Gly Leu Val

355 360 365

Met Phe Gly Met Val Leu Ala Thr Gly Ile Arg Ile Leu Ser Arg Cys

370 375 380

Asn Tyr Thr Thr Asn Arg Tyr Asn Leu Tyr Ile Val Ala Ile Ser Leu

385 390 395 400

Gly Val Gly Met Thr Pro Thr Leu Ser His Asp Phe Phe Ser Lys Leu

405 410 415

Pro Ala Val Leu Gln Pro Leu Leu His Ser Gly Ile Met Leu Ala Thr

420 425 430

Leu Ser Ala Val Val Leu Asn Val Phe Phe Asn Gly Tyr Gln His His

435 440 445

Ala Asp Leu Val Lys Glu Ser Val Ser Asp Lys Asp Leu Lys Val Arg

450 455 460

Thr Val Arg Met Trp Leu Leu Met Arg Lys Leu Lys Lys Asn Glu His

465 470 475 480

Gly Glu

By the PCR primer NheI of the 1449bp size of above-mentioned acquisition and SacI double digestion, the SH carrier framework T of digestion products and the 3941bp cut through same enzyme ₄ligase enzyme (purchased from precious biotech firm) 16 DEG C of connections are spent the night, and connect product conversion and enter intestinal bacteria MC1061 competent cell, obtain recombinant bacterium.

Extract the plasmid of recombinant bacterium, this plasmid is translocator YgfU encoding gene (SEQ ID NO.7) is inserted the SacI enzyme of SH carrier and NheI cuts the carrier obtained between site, sequence verification is errorless, and (YgfU gene, immediately following HucR gene, also utilizes CP6 promotor to express to called after HY plasmid.

HY plasmid is as shown in SEQ ID NO.8, comprise contrast DNA fragmentation, it is that SEQ ID NO.8 is from 5 ' end 3244-3303 nucleotide sequence that contrast DNA fragmentation comprises its encoding sequence of promotor CP6(driving HucR encoding gene and YgfU encoding gene to express), (its encoding sequence is as shown in SEQ ID NO.6 for HucR encoding gene, namely SEQ ID NO.8 is from 5 ' end 2662-3224 nucleotide sequence), (its encoding sequence is as shown in SEQ ID NO.7 for YgfU encoding gene, namely SEQ ID NO.8 is from 5 ' end 1197-2645 position nucleotide sequence), red fluorescent protein RFP gene (its encoding sequence is that SEQ ID NO.8 is from 5 ' end 280-957), its encoding sequence of Lac operon lac(driving red fluorescent protein RFP genetic expression is that SEQ ID NO.8 is from 5 ' end 143-200 position Nucleotide).

Contrast DNA fragmentation is made up of the DNA fragmentation 1 containing the promotor CP6, HucR encoding gene and the YgfU encoding gene that drive HucR encoding gene and YgfU encoding gene to express, red fluorescent protein RFP gene and the DNA fragmentation 2 containing the Lac operon lac driving red fluorescent protein RFP genetic expression; Wherein, DNA fragmentation 1 is the shown DNA molecular of SEQ ID NO.8 from 5 ' end 958-3303 position Nucleotide, red fluorescent protein RFP gene coded sequence is that in sequence table, SEQ ID NO.8 is from 5 ' end 280-957, and DNA fragmentation 2 is for SEQ ID NO.8 is from the DNA molecular shown in 5 ' end 143-279 position Nucleotide.

The nucleotide sequence of HY plasmid, as shown in SEQ ID NO.8, wherein contrasts DNA fragmentation for SEQ ID NO.8 is from the double chain DNA molecule shown in 5 ' end 143-3303 Nucleotide.

3, the promotor A driving goal gene (red fluorescent protein gene) to express, for the DNA fragmentation of xanthine induction and the acquisition of recombinant vectors SHY

In radioresistant cocci genome, the DNA binding sequence row of modulin HucR in HucO are confirmed in experiment.In order to transform-35th district and-10th district of the promotor lac in HY plasmid, adding new fragment when designing following primer, obtaining new promotor.

With 5 '-atctaagta tatgttgtgtggaaccgatttaataaaacaa-3 ' (forward) and 5 '-gtctaccta tgtaaagcctggggtgcctaatg-3 ' (reverse) is primer, the above-mentioned 2 HY plasmids obtained (SEQ ID NO.8) carry out pcr amplification, by HY plasmid linearization for template.Pcr amplification condition is as follows: first 95 DEG C of denaturation 4min, then 95 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 6min, totally 30 circulations; Last 72 DEG C extend 10min.。

Reclaim above-mentioned PCR reaction product, carry out agarose gel electrophoresis detection, obtain the band of 5404bp.

By above-mentioned 5404bp linearization plasmid fragment T ₄ligase enzyme (purchased from precious biotech firm) 16 DEG C of connections are spent the night, and connect product conversion and enter intestinal bacteria MC1061 competent cell, obtain recombinant bacterium.

Extract the plasmid of recombinant bacterium, the nucleotide sequence of this plasmid is as shown in SEQ ID NO.3, called after SHY plasmid, for recombinant vectors (its structural representation as shown in Figure 1, the promotor wherein regulated and controled by xanthine is the promotor of driving target protein of the present invention genetic expression, and nucleotide sequence is as shown in SEQ ID NO.1).

The DNA fragmentation contained for xanthine induction in SHY plasmid, it is the reverse complementary sequence of SEQ ID NO.3 from 5 ' end 3244-3303 Nucleotide that DNA fragmentation for xanthine induction comprises its encoding sequence of promotor CP6(driving HucR encoding gene and YgfU encoding gene to express), (its encoding sequence is as shown in SEQ ID NO.6 for HucR encoding gene, namely SEQ ID NO.3 is from 5 ' end 2662-3224 nucleotide sequence), (its encoding sequence is as shown in SEQ ID NO.7 for YgfU encoding gene, namely SEQ ID NO.3 is from 5 ' end 1197-2645 position nucleotide sequence), red fluorescence RFP protein gene (its encoding sequence is that SEQ ID NO.3 is from 5 ' end 280-957), drive its nucleotide sequence of promotor A(by xanthine regulation and control of the present invention of red fluorescent protein RFP genetic expression as shown in SEQ ID NO.1, namely encoding sequence is that SEQ ID NO.3 is from 5 ' end 143-200 position Nucleotide).

DNA fragmentation for xanthine induction is made up of the DNA fragmentation 1 containing the promotor CP6 driving HucR encoding gene and YgfU encoding gene to express, HucR encoding gene, YgfU encoding gene, red fluorescent protein RFP gene and the DNA fragmentation 2 containing the promotor A driving red fluorescent protein RFP genetic expression; Wherein, DNA fragmentation 1 is the shown DNA molecular (SEQ ID NO.4) of SEQ ID NO.3 from 5 ' end 958-3303 position Nucleotide, red fluorescent protein RFP gene coded sequence be SEQ ID NO.3 from 5 ' end 280-957 position Nucleotide, DNA fragmentation 2 is for SEQ ID NO.3 is from the double chain DNA molecule (SEQ ID NO.5) shown in 5 ' end 143-279 position Nucleotide.

The nucleotides sequence of DNA fragmentation for xanthine induction be classified as SEQ ID NO.3 from shown in 5 ' end 143-3303 Nucleotide double chain DNA molecule (its concrete nucleotide sequence as shown in SEQ ID NO.2, namely comprise after transformation by xanthine regulation and control promotor A, reporter gene, by the modulin HucR of constitutive promoter regulating and expressing and translocator YgfU).

The nucleotide sequence SEQ ID NO.3 of SHY plasmid and unique difference of control plasmid HY nucleotide sequence SEQ ID NO.8 be only by SEQ ID NO.8 from the promotor lac shown in 5 ' end 143-200 position Nucleotide replace with SEQ ID NO.3 in sequence table from the promotor A shown in 5 ' end 143-200 position Nucleotide.

The application in xanthine induction destination gene expression of embodiment 2 promotor A and the DNA fragmentation for xanthine induction

Proceeded to respectively in bacillus coli DH 5 alpha by the recombinant vectors SHY obtained by embodiment 1 and control plasmid HY, obtaining recombinant bacterium DH5 α/SHY containing SHY and the recombinant bacterium DH5 α/HY(containing HY, to extract plasmid sequence verification respectively correct).

Single bacterium colony of picking recombinant bacterium DH5 α/SHY and recombinant bacterium DH5 α/HY, adding LB substratum (the Tryptones 10g/L of ammonia benzyl antibiotics resistance, NaCl10g/L, yeast extract 5g/L, adding microbiotic ammonia benzyl mycin to 100 μ g/mL) 37 DEG C of shaking table overnight incubation (12h) to bacteria concentrations reach capacity (OD600 is 3.5), obtain seed liquor.

Seed liquor accessed according to inoculum size 1% in the xanthine substratum of different concns and induce 12h, culture condition is 37 DEG C of shaking tables (250rpm).Terminate to induction time, take out culture, collected by centrifugation thalline abandons supernatant liquor (3000g, 10min); Again with Tris-HCl(50mM, pH8.0) resuspended thalline, draw 200 μ L thalline with microplate reader test bacteria concentration OD ₆₀₀and red fluorescent protein reading.

The xanthine substratum of above-mentioned different concns is prepared as follows: by Tryptones, NaCl, yeast extract, ammonia benzyl mycin, xanthine and pH7.0, concentration is 3-morpholine propanesulfonic acid (MOPS) damping fluid mother liquor and the water mixing of 500mM, wherein the final concentration of Tryptones is 10g/L, the final concentration of NaCl is 10g/L, the final concentration of yeast extract is 5g/L, the final concentration of ammonia benzyl mycin is 100 μ g/mL, the final concentration of 3-morpholine propanesulfonic acid (MOPS) damping fluid is 17mM, xanthine final concentration in the xanthine substratum of different concns is respectively 0 μM, 1 μM, 2 μMs, 3 μMs, 5 μMs and 7 μMs.

As shown in Figure 2, ordinate zou is reporter gene red fluorescent protein fold induction (for xanthine induced reporter gene red fluorescent protein reading/without the ratio of xanthine induced reporter gene red fluorescent protein reading) to the induction result of recombinant bacterium DH5 α/SHY; Can find out, be in the substratum in 0 μM, 1 μM, 2 μMs, 3 μMs, 5 μMs and 7 μMs at xanthine final concentration, recombinant bacterium DH5 α/SHY grows and after induction expression protein, reporter gene red fluorescent protein reading is respectively 406,787,1178,2826,4292,7512; Xanthine induced reporter gene red fluorescent protein reading/be respectively 1,1.9,2.9,6.9,10.5 and 18.5 times without the ratio of xanthine induced reporter gene red fluorescent protein reading.Test result shows, and along with xanthine concentration increases, reporter gene red fluorescent protein reading increases.Illustrate that promotor A, the DNA fragmentation for xanthine induction containing promotor A, SHY carrier can make target protein red fluorescent protein express under xanthic induction.

Claims (13)

1., by a promotor A for xanthine regulation and control, it is characterized in that, the nucleotide sequence of described promotor A is as shown in SEQ ID NO.1.

2. the DNA fragmentation for xanthine induction, it is characterized in that, the promotor CP6 that the encoding gene that described DNA fragmentation comprises the promotor A by xanthine regulation and control according to claim 1, the encoding gene of modulin HucR, the encoding gene of translocator YgfU, the encoding gene driving modulin HucR and translocator YgfU is expressed and red fluorescent protein gene, the nucleotide sequence of described DNA fragmentation is as shown in SEQ ID NO.2.

3. for a recombinant expression vector for xanthine induction expression protein, it is characterized in that, comprise promotor A according to claim 1.

4. recombinant expression vector according to claim 3, is characterized in that, described expression vector is plasmid SHY, comprises DNA fragmentation according to claim 2, and the nucleotide sequence of described plasmid SHY is as shown in SEQ ID NO.3.

5. comprise the recombinant bacterial strain of recombinant expression vector described in claim 3 or 4.

6. recombinant bacterial strain according to claim 5, is characterized in that, described bacterial strain is intestinal bacteria.

7. by a transgenic cell line for xanthine induction expression protein, it is characterized in that, comprise the promotor A by xanthine regulation and control according to claim 1.

8., by a method for xanthine induction expression protein, comprise the following steps:

1) encoding gene of target protein is imported in Host Strains by the recombinant expression vector described in claim 3 or 4, obtain recombinant bacterium;

2) ferment in containing xanthic substratum above-mentioned recombinant bacterium, realizes xanthine induction target protein and express.

9. the application of promotor A described in claim 1 in xanthine induction target protein is expressed or xanthine biotype detects.

10. the application of DNA fragmentation described in claim 2 in xanthine induction target protein is expressed or xanthine biotype detects.

The application of recombinant expression vector described in 11. claims 3 or 4 in xanthine induction target protein is expressed or xanthine biotype detects.

The application of recombinant bacterial strain described in 12. claims 5 or 6 in xanthine induction target protein is expressed or xanthine biotype detects.

Transgenic cell described in 13. claims 7 ties up to the application in xanthine induction target protein expression or the detection of xanthine biotype.