CN110093366A - A kind of bacillus subtilis gluconate inducing expression element and construction method - Google Patents
A kind of bacillus subtilis gluconate inducing expression element and construction method Download PDFInfo
- Publication number
- CN110093366A CN110093366A CN201910368345.5A CN201910368345A CN110093366A CN 110093366 A CN110093366 A CN 110093366A CN 201910368345 A CN201910368345 A CN 201910368345A CN 110093366 A CN110093366 A CN 110093366A
- Authority
- CN
- China
- Prior art keywords
- promoter
- gntr
- inducing expression
- expression
- lyte
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of bacillus subtilis gluconate inducing expression element and construction methods, belong to field of genetic engineering.The present invention is with constitutive promoter PlytETranscriptional regulation protein GntR is expressed, further by constitutive promoter PthrSIn, integrate transcriptional regulation protein GntR binding sequence, realize with bacillus subtilis (Bacillus subtilis) 168 be host when, after adding gluconate, reach the induced expression level and lower leakage expression of higher-strength, its inducing expression intensity reaches 22500a.u., and leakage rate is reduced to 3.0% from 15.6%, lays a good foundation for screening-gene engineering bacteria or modulin expression.
Description
Technical field
The present invention relates to a kind of bacillus subtilis gluconate inducing expression element and construction methods, belong to hereditary work
Journey field.
Background technique
In bacillus subtilis metabolic engineering field, the promoter element of small-molecule substance inducing expression is responded, is answered extensively
For directions such as metabolic regulations.Currently, being usually used in the evoked promoter in bacillus subtilis, there is xylose evoked promoter Pxyl
With IPTG evoked promoter Pgrac.But xylose evoked promoter PxylThere is a problem of that xylose is expensive, IPTG induction is opened
Mover Pgrac, it is expensive that there are IPTG, and there are problems that certain toxicity to cell.Secondly, xylose and IPTG induction are opened
There is higher leakage expression problem in mover.Disadvantages described above seriously limits it in bacillus subtilis metabolic engineering field
Application.Gluconate is cheap as a kind of simple carbon source, and is a kind of suitable inducer to cytotoxic.It is logical
Genetic engineering transformation promoter is crossed, the evoked response element for being more appropriate to bacillus subtilis can be obtained.However, how to be transformed
Promoter realizes higher inducing expression intensity and lower leakage expression with response glucose hydrochlorate, is a value
The problem of must furtheing investigate.Only by releasing the carbon metabolism reptation behavior of withered grass gemma born of the same parents bacillus PgntWT original promoter,
It is not enough to realize the strong inducing expression response element of response glucose hydrochlorate (referring to paper " Bacillus disclosed in 2016
subtilis GntR regulation modified to devise artificial transient induction
Systems "), therefore inducing expression intensity limits gluconic acid Salt treatment far below xylose and IPTG evoked promoter
Application of the Expression element in bacillus subtilis metabolic engineering field.
Summary of the invention
In order to solve the above technical problems, realizing the inducing expression promoter element in response to grape hydrochlorate, and reach
Higher induced expression level and lower leakage expression,
The first purpose of the invention is to provide a kind of inducing expression promoter elements;The inducing substrate of the element responds is
Gluconate;The element is to contain GntR albumen, PlytEPromoter, PthrSWith the plasmid of GntR binding sequence;The PlytE
Promoter regulation GntR albumen;The PthrSIt is integrated with GntR binding sequence, the nucleotide sequence such as SEQ ID NO.4 after integration
It is shown;Promoter PlytEWith promoter PthrSTranscriptional orientation it is opposite.
In one embodiment of the invention, the PlytEThe nucleotide sequence of promoter is as shown in SEQ ID NO.1.
In one embodiment of the invention, the transcriptional regulation protein GntR contains ammonia shown in SEQ ID NO.2
Base acid sequence.
In one embodiment of the invention, the nucleotide sequence such as SEQ ID of the transcriptional regulation protein is encoded
Shown in NO.6.
In one embodiment of the invention, the plasmid is pHT01, pP43NMK or pSTOP1622 plasmid.
In one embodiment of the invention, GntR promoter is also contained in the element;Encode the GntR starting
The nucleotide sequence of son is as shown in SEQ ID NO.8.
In one embodiment of the invention, the GntR albumen, PlytEPromoter and integrate GntR binding sequence
Promoter PthrSIt is arranged on same plasmid.
In one embodiment of the invention, the nucleotide sequence of the plasmid is as shown in SEQ NO.11.
A second object of the present invention is to provide the genetic engineering bacteriums for containing the gluconate inducing expression element.
In one embodiment of the invention, the genetic engineering bacterium is host with bacillus subtilis.
Third mesh of the invention is to provide a kind of gluconate inducing expression element and is metabolized work in bacillus subtilis
The application in journey field.
In one embodiment of the invention, the application is to promote the expression of destination protein.
In one embodiment of the invention, the gene of the destination protein is encoded by promoter PlytERegulation.
In one embodiment of the invention, the application is to reduce leakage expression.
In one embodiment of the invention, the application is the genetic engineering bacterium of screening expression target gene.
In one embodiment of the invention, the activation condition of the gluconate inducing expression element are as follows: culture
Contain gluconate in environment;Condition of culture is 30~37 DEG C of 16~48h of culture.
The utility model has the advantages that (1) present invention is by by transcriptional regulation protein GntR binding site sequence
ATACTTGTATACAAGTATACT is integrated into stronger composition type expression promoter PthrSIn, it is higher to obtain intensity of activation
Gluconate inducing expression promoter element.
(2) present invention is relatively strong under the conditions of fermentation medium by replacement transcriptional regulation protein GntR original promoter
Constitutive promoter PlytE, transcriptional regulation protein GntR expression quantity is improved, gluconate inducing expression element is reduced and exists
Without the leakage expression under gluconate existence condition.
(3) gluconate inducing expression promoter element provided by the invention activates table in bacillus subtilis
Reach 22000a.u. (with strong promoter P in bacillus subtilis up to intensity43Expression intensity 30000a.u. is close).Further lead to
Reinforcement transcriptional regulation protein GntR expression is crossed, so that gluconate inducing expression promoter element is in no gluconate
Leakage expression under existence condition is only 3% or so.Further to pass through genetic engineering, transformed bacillus bacillus grape
Sugar lime inducing expression promoter is laid a good foundation.Gluconate inducing expression promoter construction method letter provided by the invention
It is single, it is easy to use, there is good metabolic engineering application prospect.
Specific embodiment
Sequence involved in specific embodiment is as follows:
Composing type PlytEPromoter nucleotide sequence is as shown in SEQ ID NO.1;
The amino acid sequence of transcriptional regulation protein GntR is as shown in SEQ ID NO.2;
Constitutive promoter PthrSNucleotide sequence as shown in SEQ ID NO.3;
Constitutive promoter PthrSNucleotide sequence after integrating GntR binding sequence is as shown in SEQ ID NO.4;
The original base sequence of transcriptional regulation protein GntR is as shown in SEQ ID NO.5;
120 bit bases of transcriptional regulation protein GntR are changed to the nucleotide sequence after T as C as shown in SEQ ID NO.6;
The nucleotide sequence of GntR original promoter is encoded as shown in SEQ ID NO.7;
Transcriptional regulation protein GntR promoter sequence after code optimization is as shown in SEQ ID NO.8;
The amino acid sequence of green fluorescent protein GFP is as shown in SEQ NO.9;
Gluconate inducing expression element plasmid pHT-BaL-optimal base sequence after optimizing original GntR promoter
Column are as shown in SEQ NO.10;
GntR promoter is replaced with into composing type PlytEGluconate inducing expression element plasmid pHT- after promoter
BaL-lytE base sequence is as shown in SEQ NO.11.
The bacillus subtilis condition of culture of the promoter element of inducing expression containing gluconate:
Fermentation medium (g/L): sodium gluconate 60, tryptone 6, yeast powder 12, ammonium sulfate 6, dipotassium hydrogen phosphate
12.5, potassium dihydrogen phosphate 2.5, magnesium sulfate 3.
Condition of culture: 37 DEG C, 200rpm, under the conditions of cultivate 48h.
Green fluorescent protein and cell concentration detection method:
Green fluorescent protein is detected using Tecan microplate reader, excitation wavelength 490nm, launch wavelength 530nm, gain 60.
Cell concentration Detection wavelength is 600nm.
Reveal expression quantity calculation formula (%): x=(a-b)/c
Wherein, a is gluconate inducing expression element, and the fluorescence intensity when being not added with gluconate, b is withered grass
Fluorescence intensity of 168 bacterial strain of bacillus as control strain, c are gluconate inducing expression element in addition gluconic acid
Fluorescence intensity when salt.
Embodiment 1 constructs gluconic acid response element tool plasmid pHT-BaL-optimal
Design primer pHT-F:
5 '-ACACATGGCATGGATGAACTATACAAATAATTCACGTCACGCGTCCATGGAGA-3 ' and pHT-R:
5 '-GAGCTCGAATTCACTGGCCGTCGTTTTA-3 ' expand pHT01 plasmid backbone using pHT01 plasmid as template;Design is drawn
Object GntR-F:
5 '-ACGACGGCCAGTGAATTCGAGCTCCTAGTCATTGTTGTATTCAGCTCCTTTTGCCA GCA-3 ' and
GntR-R:5 '-ATGCTAGACTCCAAAGACCTGTTGTATCCCG-3 ', by GntR sequence (SEQ original in bacillus subtilis
Shown in ID NO.5) nucleotide sequence the 120th T is become from C, glucose catabolism reptation behavior is released, after replacing base
GntR sequence be SEQ ID NO.6, coding amino acid sequence have not been changed.Original transcriptional control egg in bacillus subtilis
White GntR expression promoter sequence is SEQ ID NO.7, by the 127th, 128 and 129 nucleotide of original GntR promoter by CAT
It is changed to ACA, releases glucose catabolism reptation behavior, the GntR promoter sequence after replacing nucleotide is SEQ ID
NO.8.Design primer PGntR-F:
5 '-GATACAACAGGTCTTTGGAGTCTAGCATACACTCACCTTCCTCACTCAAGGAGTAT ACT-3 ' and
PGntR-R:
5 '-GCAATATGGTAAAAATTTAAATAAAAATTAGAAATGAAAGTGTTTGA-3 ', after codon optimization
GntR gene chemical synthesis after using it as template, expand optimization gene sequence after GntR promoter sequence SEQ ID NO.8;Design
Primer PthrS-F:5 '-
AATTTTTATTTAAATTTTTACCATATTGCTATGTATATTGATTCTCATTTGCTCGC GCC-3 ' and
PthrS-R:5 '-
GTGTACATTTCACCTCCTTTAAGGAGTATACTTGTATACAAGTATTATAAATTGTTCAATCCAAAAAA
TCAACACGAT-3 ' expands the P of the binding sequence containing GntR using 168 genome of bacillus subtilis as templatethrSPromoter sequence
It arranges (SEQ ID NO.4);Design primer 5 '-
ACTCCTTAAAGGAGGTGAAATGTACACATGGGTAAGGGAGAAGAACTTTTCACTGG A-3 ' and 5 '-TTA
TTTGTATAGTTCATCCATGCCATGTGTAATC-3 ' (has been disclosed in paper with plasmid pBSX-GFP
Characterization and application of endogenous phase-dependent promoters in
Bacillus subtilis.Appl.Microbiol.Biotechnol.101, in 4151-61.) it is template, expand GFP gene
Sequence SEQ ID NO.9.
By GntR aporepressor base shown in GntR promoter gene segment, SEQ ID NO.6 shown in SEQ ID NO.8
Because of P shown in segment, SEQ ID NO.4thrSFluorescin GFP gene shown in promoter gene segment and SEQ ID NO.9
Segment and pHT01 plasmid fragments, above 5 DNA fragmentations by NEB Gibson Assembly Master Mix Kit into
Row assembling, constructs gluconic acid response element tool plasmid pHT-BaL-optimal plasmid.
Embodiment 2 constructs gluconate inducing expression element bacillus subtilis BS-pHT-BaL-optimal
PHT-BaL-optimal plasmid conversion bacillus subtilis (Bacillus subtilis) that embodiment 1 is constructed
168, recombined bacillus subtilis engineering bacteria is obtained, BS-pHT-BaL-optimal is named as.
Embodiment 3 constructs gluconic acid response element tool plasmid pHT-BaL-lytE
Design primer pHT-lytE-F:5 '-TATGTATATTGATTCTCATTTGCTCGCGCCGCTGA-3 ' and pHT-
LytE-R:5 '-AAAGGAGGTGAAATGTACACATGCTAGACTCCAAAGACCTGTTGTATCCCGCA-3 ' is with embodiment 1
The pHT-BaL-optimal plasmid of method building is template amplification plasmid backbone segment;5 '-GTGTACATTTCAC of design primer
- the AATGAGAATCAAT of CTCCTTTCCCAAATGTTAACTCTATATATATGTATCTCTTTTTTTAAATTAATCT- 3 ' and 5 '
ATACATACTCCTCGAATATACTTTATCACTCATTTTTCCGATATAT-3 ' expands PlytEPromoter sequence.
The above pHT-BaL-optimal plasmid is template amplification plasmid backbone segment and PlytEPromoter fragment totally 2 DNA
Segment is assembled by NEB Gibson Assembly Master Mix Kit, constructs gluconic acid response element tool
Plasmid pHT-BaL-lytE plasmid.
Embodiment 4 constructs gluconate inducing expression element bacillus subtilis BS-pHT-BaL-lytE
PHT-BaL-lytE plasmid conversion bacillus subtilis (Bacillus subtilis) prepared by embodiment 3
168, recombined bacillus subtilis engineering bacteria is obtained, BS-pHT-BaL-lytE is named as.
5 bacillus subtilis BS-pHT-BaL-optimal of embodiment adds sodium gluconate induction fermentation
By the bacterial strain BS-pHT-BaL-optimal prepared according to the method for embodiment 2 in 37 DEG C, 200rpm, containing
48h is cultivated in the fermentation medium of 60g/L sodium gluconate.Finally measurement fermentation liquid green fluorescent protein intensity is
22500a.u. successfully obtains the gluconate inducing expression element of strong inducing expression intensity.When not added in fermentation medium
When sodium gluconate, ferment 48h, and fermentation liquid green fluorescent protein intensity is 3500a.u., and leakage expression quantity is 15.6%.
6 bacillus subtilis BS-pHT-BaL-lytE of embodiment adds sodium gluconate induction fermentation
By the bacterial strain BS-pHT-BaL-lytE prepared according to the method for embodiment 4 under 37 DEG C, 200rpm, containing
48h is cultivated in the fermentation medium of 60g/L sodium gluconate.Finally measurement fermentation liquid green fluorescent protein intensity is
22000a.u., compared to control strain BS-pHT-BaL-optimal, inducing expression intensity is not decreased significantly.But when
When not adding sodium gluconate in fermentation medium, ferment 48h, and fermentation liquid green fluorescent protein intensity is only 660a.u., leakage
Expression quantity is reduced to 3.0% from 15.6%.
Influence of 1 different promoters of comparative example to inducing expression element regulating effect
Using the construction of strategy inducing expression element of embodiment 1, difference is, respectively by PthrSThe replacement of promoter promoter
For PyvyDPromoter, PphrKPromoter and PodhAPromoter, using method validation regulating effect described in embodiment 5 or 6, as a result
Show PphrKThe inducing expression original part of promoter building, induced activation intensity only has 3000a.u., and PyvyDPromoter and PodhAIt opens
The inducing expression original part of mover building, cannot be activated expression.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>a kind of bacillus subtilis gluconate inducing expression element and construction method
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 300
<212> DNA
<213>artificial sequence
<400> 1
ctcctcgaat atactttatc actcattttt ccgatatatg agccgacccc gaaagttttt 60
catttatttc ctttatgttg aaaaacatcc cataaaacat gacaaaagca ctcgtttttt 120
gtcacctttg caatgaaaat gaaatattta atacccttaa aaactttttt ttagaacgaa 180
taattaagaa atttgtcaca tgaagtcaag actatttctg atgggaatct atccttataa 240
tagaaatcaa taagattaat ttaaaaaaag agatacatat atatagagtt aacatttggg 300
<210> 2
<211> 243
<212> PRT
<213>artificial sequence
<400> 2
Met Leu Asp Ser Lys Asp Leu Leu Tyr Pro Ala Lys Trp Leu Ser Lys
1 5 10 15
Ala Ser Thr Gly Val Arg Val Ala Tyr Glu Leu Arg Met Arg Ile Val
20 25 30
Ser Gly Leu Ile Glu Ser Gly Thr Ile Leu Ser Glu Asn Thr Ile Ala
35 40 45
Ala Glu Phe Ser Val Ser Arg Ser Pro Val Arg Glu Ala Leu Lys Ile
50 55 60
Leu Ala Ser Glu Lys Ile Ile Arg Leu Glu Arg Met Gly Ala Val Val
65 70 75 80
Ile Gly Leu Thr Glu Lys Lys Ile Ala Glu Ile Tyr Asp Val Arg Leu
85 90 95
Leu Leu Glu Thr Phe Val Phe Glu Arg Leu Val Lys Ile Asp Ile Glu
100 105 110
Pro Leu Val Lys Asp Leu Ser Lys Ile Leu Glu Met Met Lys Val Ser
115 120 125
Ile Lys Tyr Glu Asp Ala Asp Glu Phe Ser Phe Gln Asp Val Leu Phe
130 135 140
His Glu Thr Ile Ile Arg Ala Ile Asp His Ser Tyr Ile Gln Met Ile
145 150 155 160
Trp Asn Asn Leu Lys Pro Val Met Glu Ser Phe Ile Leu Leu Ser Met
165 170 175
Arg Val Arg Leu Lys Glu Lys Tyr Glu Asp Phe Thr Arg Ile Leu Asp
180 185 190
Asn His Glu Leu Tyr Ile Gln Ala Ile Lys Thr Lys Asp Arg Ala Leu
195 200 205
Met Ile Gln Ser Leu His Gln Asn Phe Asp Asp Val Gln Asp Lys Val
210 215 220
Glu Asp Leu Trp Leu Ser Gln Gln Met Leu Ala Lys Gly Ala Glu Tyr
225 230 235 240
Asn Asn Asp
<210> 3
<211> 300
<212> DNA
<213>artificial sequence
<400> 3
tatgtatatt gattctcatt tgctcgcgcc gctgatttcc attgcgcctg atgaagtcgt 60
gctttatacc gaccagcccg agcacatgat ggcaaggacc attcaaaacg tatttcaaga 120
gagagtggaa atgctcccgc tgcatgcttt tacagatgca gaaataccgg tgaagcactc 180
ggaaggatga gggccggcag cctgtctatt taaggctgtc ggtttaaaaa aaaggaaacg 240
cgatcgtgtt gattttttgg attgaacaat ttataataca taggagatta agaaagacac 300
<210> 4
<211> 300
<212> DNA
<213>artificial sequence
<400> 4
tatgtatatt gattctcatt tgctcgcgcc gctgatttcc attgcgcctg atgaagtcgt 60
gctttatacc gaccagcccg agcacatgat ggcaaggacc attcaaaacg tatttcaaga 120
gagagtggaa atgctcccgc tgcatgcttt tacagatgca gaaataccgg tgaagcactc 180
ggaaggatga gggccggcag cctgtctatt taaggctgtc ggtttaaaaa aaaggaaacg 240
cgatcgtgtt gattttttgg attgaacaat ttataatact tgtatacaag tatactcctt 300
<210> 5
<211> 732
<212> DNA
<213>artificial sequence
<400> 5
atgctagact ccaaagacct gttgtatccc gcaaaatggc tctcaaaagc gtcaaccgga 60
gttcgtgtcg catacgagct gagaatgcgg atcgtttcag gtctgattga aagcggtacc 120
attttatcag aaaatacaat cgccgccgag ttttcagtaa gccgttcgcc ggttcgcgaa 180
gcgctaaaaa tactcgcatc cgaaaaaatc atccgcttag aacgaatggg agcggtcgta 240
attggtttaa ctgagaagaa aatcgcggaa atttatgatg tgcggttact attagaaaca 300
tttgtctttg aacggcttgt caaaatagac attgagcctt tagttaagga tctcagcaaa 360
attcttgaaa tgatgaaagt ctcaatcaaa tatgaggatg ctgacgaatt ttcatttcaa 420
gatgtgctgt tccatgaaac gattatccga gcgattgatc attcatacat tcagatgatc 480
tggaacaatc taaaacccgt catggaaagc tttattcttt tatcgatgcg ggtacggtta 540
aaggaaaagt atgaagactt cacaaggatt ttagataacc acgagcttta tattcaagcc 600
atcaaaacaa aggatagggc gctgatgatt cagtctcttc accaaaactt tgatgatgtg 660
caggataagg tagaagacct atggctctca caacaaatgc tggcaaaagg agctgaatac 720
aacaatgact ag 732
<210> 6
<211> 732
<212> DNA
<213>artificial sequence
<400> 6
atgctagact ccaaagacct gttgtatccc gcaaaatggc tctcaaaagc gtcaaccgga 60
gttcgtgtcg catacgagct gagaatgcgg atcgtttcag gtctgattga aagcggtact 120
attttatcag aaaatacaat cgccgccgag ttttcagtaa gccgttcgcc ggttcgcgaa 180
gcgctaaaaa tactcgcatc cgaaaaaatc atccgcttag aacgaatggg agcggtcgta 240
attggtttaa ctgagaagaa aatcgcggaa atttatgatg tgcggttact attagaaaca 300
tttgtctttg aacggcttgt caaaatagac attgagcctt tagttaagga tctcagcaaa 360
attcttgaaa tgatgaaagt ctcaatcaaa tatgaggatg ctgacgaatt ttcatttcaa 420
gatgtgctgt tccatgaaac gattatccga gcgattgatc attcatacat tcagatgatc 480
tggaacaatc taaaacccgt catggaaagc tttattcttt tatcgatgcg ggtacggtta 540
aaggaaaagt atgaagactt cacaaggatt ttagataacc acgagcttta tattcaagcc 600
atcaaaacaa aggatagggc gctgatgatt cagtctcttc accaaaactt tgatgatgtg 660
caggataagg tagaagacct atggctctca caacaaatgc tggcaaaagg agctgaatac 720
aacaatgact ag 732
<210> 7
<211> 114
<212> DNA
<213>artificial sequence
<400> 7
gcaatatggt aaaaatttaa ataaaaatta gaaatgaaag tgtttgcata aaagaaatat 60
tcacgttatc atacttgtat acaagtatac tccttgagtg aggaaggtga gtgt 114
<210> 8
<211> 114
<212> DNA
<213>artificial sequence
<400> 8
gcaatatggt aaaaatttaa ataaaaatta gaaatgaaag tgtttgacaa aaagaaatat 60
tcacgttatc atacttgtat acaagtatac tccttgagtg aggaaggtga gtgt 114
<210> 9
<211> 238
<212> PRT
<213>artificial sequence
<400> 9
Met Gly Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
1 5 10 15
Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu
20 25 30
Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys
35 40 45
Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu
50 55 60
Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg
65 70 75 80
His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95
Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val
100 105 110
Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile
115 120 125
Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140
Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly
145 150 155 160
Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val
165 170 175
Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190
Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser
195 200 205
Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220
Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 10
<211> 8250
<212> DNA
<213>artificial sequence
<400> 10
tattggtatg actggtttta agcgcaaaaa aagttgcttt ttcgtaccta ttaatgtatc 60
gttttagaaa accgactgta aaaagtacag tcggcattat ctcatattat aaaagccagt 120
cattaggcct atctgacaat tcctgaatag agttcataaa caatcctgca tgataaccat 180
cacaaacaga atgatgtacc tgtaaagata gcggtaaata tattgaatta cctttattaa 240
tgaattttcc tgctgtaata atgggtagaa ggtaattact attattattg atatttaagt 300
taaacccagt aaatgaagtc catggaataa tagaaagaga aaaagcattt tcaggtatag 360
gtgttttggg aaacaatttc cccgaaccat tatatttctc tacatcagaa aggtataaat 420
cataaaactc tttgaagtca ttctttacag gagtccaaat accagagaat gttttagata 480
caccatcaaa aattgtataa agtggctcta acttatccca ataacctaac tctccgtcgc 540
tattgtaacc agttctaaaa gctgtatttg agtttatcac ccttgtcact aagaaaataa 600
atgcagggta aaatttatat ccttcttgtt ttatgtttcg gtataaaaca ctaatatcaa 660
tttctgtggt tatactaaaa gtcgtttgtt ggttcaaata atgattaaat atctcttttc 720
tcttccaatt gtctaaatca attttattaa agttcatttg atatgcctcc taaattttta 780
tctaaagtga atttaggagg cttacttgtc tgctttcttc attagaatca atcctttttt 840
aaaagtcaat attactgtaa cataaatata tattttaaaa atatcccact ttatccaatt 900
ttcgtttgtt gaactaatgg gtgctttagt tgaagaataa aagaccacat taaaaaatgt 960
ggtcttttgt gtttttttaa aggatttgag cgtagcgaaa aatccttttc tttcttatct 1020
tgataataag ggtaactatt gccgatcgtc cattccgaca gcatcgccag tcactatggc 1080
gtgctgctag cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 1140
ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 1200
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattcgagct 1260
cctagtcatt gttgtattca gctccttttg ccagcatttg ttgtgagagc cataggtctt 1320
ctaccttatc ctgcacatca tcaaagtttt ggtgaagaga ctgaatcatc agcgccctat 1380
cctttgtttt gatggcttga atataaagct cgtggttatc taaaatcctt gtgaagtctt 1440
catacttttc ctttaaccgt acccgcatcg ataaaagaat aaagctttcc atgacgggtt 1500
ttagattgtt ccagatcatc tgaatgtatg aatgatcaat cgctcggata atcgtttcat 1560
ggaacagcac atcttgaaat gaaaattcgt cagcatcctc atatttgatt gagactttca 1620
tcatttcaag aattttgctg agatccttaa ctaaaggctc aatgtctatt ttgacaagcc 1680
gttcaaagac aaatgtttct aatagtaacc gcacatcata aatttccgcg attttcttct 1740
cagttaaacc aattacgacc gctcccattc gttctaagcg gatgattttt tcggatgcga 1800
gtatttttag cgcttcgcga accggcgaac ggcttactga aaactcggcg gcgattgtat 1860
tttctgataa aatagtaccg ctttcaatca gacctgaaac gatccgcatt ctcagctcgt 1920
atgcgacacg aactccggtt gacgcttttg agagccattt tgcgggatac aacaggtctt 1980
tggagtctag catacactca ccttcctcac tcaaggagta tacttgtata caagtatgat 2040
aacgtgaata tttctttttg tcaaacactt tcatttctaa tttttattta aatttttacc 2100
atattgctat gtatattgat tctcatttgc tcgcgccgct gatttccatt gcgcctgatg 2160
aagtcgtgct ttataccgac cagcccgagc acatgatggc aaggaccatt caaaacgtat 2220
ttcaagagag agtggaaatg ctcccgctgc atgcttttac agatgcagaa ataccggtga 2280
agcactcgga aggatgaggg ccggcagcct gtctatttaa ggctgtcggt ttaaaaaaaa 2340
ggaaacgcga tcgtgttgat tttttggatt gaacaattta taatacttgt atacaagtat 2400
actccttaaa ggaggtgaaa tgtacacatg ggtaagggag aagaactttt cactggagtt 2460
gtcccaattc ttgttgaatt agatggtgat gttaatgggc acaaattttc tgtcagtgga 2520
gagggtgaag gtgatgcaac atacggaaaa cttaccctta aatttatttg cactactgga 2580
aagcttcctg ttccttggcc aacacttgtc actactctta cttatggtgt tcaatgcttt 2640
tcaagatacc cagatcatat gaagcggcac gacttcttca agagcgccat gcctgaggga 2700
tacgtgcagg agaggaccat cttcttcaag gacgacggga actacaagac acgtgctgaa 2760
gtcaagtttg agggagacac cctcgtcaac agaatcgagc ttaagggaat cgatttcaag 2820
gaggacggaa acatcctcgg ccacaagttg gaatacaact acaactccca caacgtatac 2880
atcatggcag acaaacaaaa gaatggaatc aaagttaact tcaaaattag acacaacatt 2940
gaagatggaa gcgttcaact agcagaccat tatcaacaaa atactccaat tggcgatggc 3000
cctgtccttt taccagacaa ccattacctg tccacacaat ctgccctttc gaaagatccc 3060
aacgaaaaga gagaccacat ggtccttctt gagtttgtaa cagctgctgg gattacacat 3120
ggcatggatg aactatacaa ataattcacg tcacgcgtcc atggagatct ttgtctgcaa 3180
ctgaaaagtt tataccttac ctggaacaaa tggttgaaac atacgaggct aatatcggct 3240
tattaggaat agtccctgta ctaataaaat caggtggatc agttgatcag tatattttgg 3300
acgaagctcg gaaagaattt ggagatgact tgcttaattc cacaattaaa ttaagggaaa 3360
gaataaagcg atttgatgtt caaggaatca cggaagaaga tactcatgat aaagaagctc 3420
taaaactatt caataacctt acaatggaat tgatcgaaag ggtggaaggt taatggtacg 3480
aaaattaggg gatctaccta gaaagccaca aggcgatagg tcaagcttaa agaaccctta 3540
catggatctt acagattctg aaagtaaaga aacaacagag gttaaacaaa cagaaccaaa 3600
aagaaaaaaa gcattgttga aaacaatgaa agttgatgtt tcaatccata ataagattaa 3660
atcgctgcac gaaattctgg cagcatccga agggaattca tattacttag aggatactat 3720
tgagagagct attgataaga tggttgagac attacctgag agccaaaaaa ctttttatga 3780
atatgaatta aaaaaaagaa ccaacaaagg ctgagacaga ctccaaacga gtctgttttt 3840
ttaaaaaaaa tattaggagc attgaatata tattagagaa ttaagaaaga catgggaata 3900
aaaatatttt aaatccagta aaaatatgat aagattattt cagaatatga agaactctgt 3960
ttgtttttga tgaaaaaaca aacaaaaaaa atccacctaa cggaatctca atttaactaa 4020
cagcggccaa actgagaagt taaatttgag aaggggaaaa ggcggattta tacttgtatt 4080
taactatctc cattttaaca ttttattaaa ccccatacaa gtgaaaatcc tcttttacac 4140
tgttccttta ggtgatcgcg gagggacatt atgagtgaag taaacctaaa aggaaataca 4200
gatgaattag tgtattatcg acagcaaacc actggaaata aaatcgccag gaagagaatc 4260
aaaaaaggga aagaagaagt ttattatgtt gctgaaacgg aagagaagat atggacagaa 4320
gagcaaataa aaaacttttc tttagacaaa tttggtacgc atatacctta catagaaggt 4380
cattatacaa tcttaaataa ttacttcttt gatttttggg gctatttttt aggtgctgaa 4440
ggaattgcgc tctatgctca cctaactcgt tatgcatacg gcagcaaaga cttttgcttt 4500
cctagtctac aaacaatcgc taaaaaaatg gacaagactc ctgttacagt tagaggctac 4560
ttgaaactgc ttgaaaggta cggttttatt tggaaggtaa acgtccgtaa taaaaccaag 4620
gataacacag aggaatcccc gatttttaag attagacgta aggttccttt gctttcagaa 4680
gaacttttaa atggaaaccc taatattgaa attccagatg acgaggaagc acatgtaaag 4740
aaggctttaa aaaaggaaaa agagggtctt ccaaaggttt tgaaaaaaga gcacgatgaa 4800
tttgttaaaa aaatgatgga tgagtcagaa acaattaata ttccagaggc cttacaatat 4860
gacacaatgt atgaagatat actcagtaaa ggagaaattc gaaaagaaat caaaaaacaa 4920
atacctaatc ctacaacatc ttttgagagt atatcaatga caactgaaga ggaaaaagtc 4980
gacagtactt taaaaagcga aatgcaaaat cgtgtctcta agccttcttt tgatacctgg 5040
tttaaaaaca ctaagatcaa aattgaaaat aaaaattgtt tattacttgt accgagtgaa 5100
tttgcatttg aatggattaa gaaaagatat ttagaaacaa ttaaaacagt ccttgaagaa 5160
gctggatatg ttttcgaaaa aatcgaacta agaaaagtgc aataaactgc tgaagtattt 5220
cagcagtttt ttttatttag aaatagtgaa aaaaatataa tcagggaggt atcaatattt 5280
aatgagtact gatttaaatt tatttagact ggaattaata attaacacgt agactaatta 5340
aaatttaatg agggataaag aggatacaaa aatattaatt tcaatcccta ttaaatttta 5400
acaagggggg gattaaaatt taattagagg tttatccaca agaaaagacc ctaataaaat 5460
ttttactagg gttataacac tgattaattt cttaatgggg gagggattaa aatttaatga 5520
caaagaaaac aatcttttaa gaaaagcttt taaaagataa taataaaaag agctttgcga 5580
ttaagcaaaa ctctttactt tttcattgac attatcaaat tcatcgattt caaattgttg 5640
ttgtatcata aagttaattc tgttttgcac aaccttttca ggaatataaa acacatctga 5700
ggcttgtttt ataaactcag ggtcgctaaa gtcaatgtaa cgtagcatat gatatggtat 5760
agcttccacc caagttagcc tttctgcttc ttctgaatgt ttttcatata cttccatggg 5820
tatctctaaa tgattttcct catgtagcaa ggtatgagca aaaagtttat ggaattgata 5880
gttcctctct ttttcttcaa cttttttatc taaaacaaac actttaacat ctgagtcaat 5940
gtaagcataa gatgtttttc cagtcataat ttcaatccca aatcttttag acagaaattc 6000
tggacgtaaa tcttttggtg aaagaatttt tttatgtagc aatatatccg atacagcacc 6060
ttctaaaagc gttggtgaat agggcatttt acctatctcc tctcattttg tggaataaaa 6120
atagtcatat tcgtccatct acctatccta ttatcgaaca gttgaacttt ttaatcaagg 6180
atcagtcctt tttttcatta ttcttaaact gtgctcttaa ctttaacaac tcgatttgtt 6240
tttccagatc tcgagggtaa ctagcctcgc cgatcccgca agaggcccgg cagtcaggtg 6300
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 6360
atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 6420
agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 6480
ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 6540
gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 6600
gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 6660
tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 6720
acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 6780
aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 6840
cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 6900
gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 6960
cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 7020
tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 7080
tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 7140
ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 7200
tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 7260
gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 7320
ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 7380
tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 7440
agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 7500
aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 7560
cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt 7620
agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 7680
tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 7740
gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 7800
gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 7860
ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 7920
gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 7980
ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 8040
ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 8100
acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt 8160
gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag 8220
cggaagagcg cccaatacgc atgcttaagt 8250
<210> 11
<211> 8436
<212> DNA
<213>artificial sequence
<400> 11
tattggtatg actggtttta agcgcaaaaa aagttgcttt ttcgtaccta ttaatgtatc 60
gttttagaaa accgactgta aaaagtacag tcggcattat ctcatattat aaaagccagt 120
cattaggcct atctgacaat tcctgaatag agttcataaa caatcctgca tgataaccat 180
cacaaacaga atgatgtacc tgtaaagata gcggtaaata tattgaatta cctttattaa 240
tgaattttcc tgctgtaata atgggtagaa ggtaattact attattattg atatttaagt 300
taaacccagt aaatgaagtc catggaataa tagaaagaga aaaagcattt tcaggtatag 360
gtgttttggg aaacaatttc cccgaaccat tatatttctc tacatcagaa aggtataaat 420
cataaaactc tttgaagtca ttctttacag gagtccaaat accagagaat gttttagata 480
caccatcaaa aattgtataa agtggctcta acttatccca ataacctaac tctccgtcgc 540
tattgtaacc agttctaaaa gctgtatttg agtttatcac ccttgtcact aagaaaataa 600
atgcagggta aaatttatat ccttcttgtt ttatgtttcg gtataaaaca ctaatatcaa 660
tttctgtggt tatactaaaa gtcgtttgtt ggttcaaata atgattaaat atctcttttc 720
tcttccaatt gtctaaatca attttattaa agttcatttg atatgcctcc taaattttta 780
tctaaagtga atttaggagg cttacttgtc tgctttcttc attagaatca atcctttttt 840
aaaagtcaat attactgtaa cataaatata tattttaaaa atatcccact ttatccaatt 900
ttcgtttgtt gaactaatgg gtgctttagt tgaagaataa aagaccacat taaaaaatgt 960
ggtcttttgt gtttttttaa aggatttgag cgtagcgaaa aatccttttc tttcttatct 1020
tgataataag ggtaactatt gccgatcgtc cattccgaca gcatcgccag tcactatggc 1080
gtgctgctag cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 1140
ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 1200
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattcgagct 1260
cctagtcatt gttgtattca gctccttttg ccagcatttg ttgtgagagc cataggtctt 1320
ctaccttatc ctgcacatca tcaaagtttt ggtgaagaga ctgaatcatc agcgccctat 1380
cctttgtttt gatggcttga atataaagct cgtggttatc taaaatcctt gtgaagtctt 1440
catacttttc ctttaaccgt acccgcatcg ataaaagaat aaagctttcc atgacgggtt 1500
ttagattgtt ccagatcatc tgaatgtatg aatgatcaat cgctcggata atcgtttcat 1560
ggaacagcac atcttgaaat gaaaattcgt cagcatcctc atatttgatt gagactttca 1620
tcatttcaag aattttgctg agatccttaa ctaaaggctc aatgtctatt ttgacaagcc 1680
gttcaaagac aaatgtttct aatagtaacc gcacatcata aatttccgcg attttcttct 1740
cagttaaacc aattacgacc gctcccattc gttctaagcg gatgattttt tcggatgcga 1800
gtatttttag cgcttcgcga accggcgaac ggcttactga aaactcggcg gcgattgtat 1860
tttctgataa aatagtaccg ctttcaatca gacctgaaac gatccgcatt ctcagctcgt 1920
atgcgacacg aactccggtt gacgcttttg agagccattt tgcgggatac aacaggtctt 1980
tggagtctag catcccaaat gttaactcta tatatatgta tctctttttt taaattaatc 2040
ttattgattt ctattataag gatagattcc catcagaaat agtcttgact tcatgtgaca 2100
aatttcttaa ttattcgttc taaaaaaaag tttttaaggg tattaaatat ttcattttca 2160
ttgcaaaggt gacaaaaaac gagtgctttt gtcatgtttt atgggatgtt tttcaacata 2220
aaggaaataa atgaaaaact ttcggggtcg gctcatatat cggaaaaatg agtgataaag 2280
tatattcgag gagtatgtat attgattctc atttgctcgc gccgctgatt tccattgcgc 2340
ctgatgaagt cgtgctttat accgaccagc ccgagcacat gatggcaagg accattcaaa 2400
acgtatttca agagagagtg gaaatgctcc cgctgcatgc ttttacagat gcagaaatac 2460
cggtgaagca ctcggaagga tgagggccgg cagcctgtct atttaaggct gtcggtttaa 2520
aaaaaaggaa acgcgatcgt gttgattttt tggattgaac aatttataat acttgtatac 2580
aagtatactc cttaaaggag gtgaaatgta cacatgggta agggagaaga acttttcact 2640
ggagttgtcc caattcttgt tgaattagat ggtgatgtta atgggcacaa attttctgtc 2700
agtggagagg gtgaaggtga tgcaacatac ggaaaactta cccttaaatt tatttgcact 2760
actggaaagc ttcctgttcc ttggccaaca cttgtcacta ctcttactta tggtgttcaa 2820
tgcttttcaa gatacccaga tcatatgaag cggcacgact tcttcaagag cgccatgcct 2880
gagggatacg tgcaggagag gaccatcttc ttcaaggacg acgggaacta caagacacgt 2940
gctgaagtca agtttgaggg agacaccctc gtcaacagaa tcgagcttaa gggaatcgat 3000
ttcaaggagg acggaaacat cctcggccac aagttggaat acaactacaa ctcccacaac 3060
gtatacatca tggcagacaa acaaaagaat ggaatcaaag ttaacttcaa aattagacac 3120
aacattgaag atggaagcgt tcaactagca gaccattatc aacaaaatac tccaattggc 3180
gatggccctg tccttttacc agacaaccat tacctgtcca cacaatctgc cctttcgaaa 3240
gatcccaacg aaaagagaga ccacatggtc cttcttgagt ttgtaacagc tgctgggatt 3300
acacatggca tggatgaact atacaaataa ttcacgtcac gcgtccatgg agatctttgt 3360
ctgcaactga aaagtttata ccttacctgg aacaaatggt tgaaacatac gaggctaata 3420
tcggcttatt aggaatagtc cctgtactaa taaaatcagg tggatcagtt gatcagtata 3480
ttttggacga agctcggaaa gaatttggag atgacttgct taattccaca attaaattaa 3540
gggaaagaat aaagcgattt gatgttcaag gaatcacgga agaagatact catgataaag 3600
aagctctaaa actattcaat aaccttacaa tggaattgat cgaaagggtg gaaggttaat 3660
ggtacgaaaa ttaggggatc tacctagaaa gccacaaggc gataggtcaa gcttaaagaa 3720
cccttacatg gatcttacag attctgaaag taaagaaaca acagaggtta aacaaacaga 3780
accaaaaaga aaaaaagcat tgttgaaaac aatgaaagtt gatgtttcaa tccataataa 3840
gattaaatcg ctgcacgaaa ttctggcagc atccgaaggg aattcatatt acttagagga 3900
tactattgag agagctattg ataagatggt tgagacatta cctgagagcc aaaaaacttt 3960
ttatgaatat gaattaaaaa aaagaaccaa caaaggctga gacagactcc aaacgagtct 4020
gtttttttaa aaaaaatatt aggagcattg aatatatatt agagaattaa gaaagacatg 4080
ggaataaaaa tattttaaat ccagtaaaaa tatgataaga ttatttcaga atatgaagaa 4140
ctctgtttgt ttttgatgaa aaaacaaaca aaaaaaatcc acctaacgga atctcaattt 4200
aactaacagc ggccaaactg agaagttaaa tttgagaagg ggaaaaggcg gatttatact 4260
tgtatttaac tatctccatt ttaacatttt attaaacccc atacaagtga aaatcctctt 4320
ttacactgtt cctttaggtg atcgcggagg gacattatga gtgaagtaaa cctaaaagga 4380
aatacagatg aattagtgta ttatcgacag caaaccactg gaaataaaat cgccaggaag 4440
agaatcaaaa aagggaaaga agaagtttat tatgttgctg aaacggaaga gaagatatgg 4500
acagaagagc aaataaaaaa cttttcttta gacaaatttg gtacgcatat accttacata 4560
gaaggtcatt atacaatctt aaataattac ttctttgatt tttggggcta ttttttaggt 4620
gctgaaggaa ttgcgctcta tgctcaccta actcgttatg catacggcag caaagacttt 4680
tgctttccta gtctacaaac aatcgctaaa aaaatggaca agactcctgt tacagttaga 4740
ggctacttga aactgcttga aaggtacggt tttatttgga aggtaaacgt ccgtaataaa 4800
accaaggata acacagagga atccccgatt tttaagatta gacgtaaggt tcctttgctt 4860
tcagaagaac ttttaaatgg aaaccctaat attgaaattc cagatgacga ggaagcacat 4920
gtaaagaagg ctttaaaaaa ggaaaaagag ggtcttccaa aggttttgaa aaaagagcac 4980
gatgaatttg ttaaaaaaat gatggatgag tcagaaacaa ttaatattcc agaggcctta 5040
caatatgaca caatgtatga agatatactc agtaaaggag aaattcgaaa agaaatcaaa 5100
aaacaaatac ctaatcctac aacatctttt gagagtatat caatgacaac tgaagaggaa 5160
aaagtcgaca gtactttaaa aagcgaaatg caaaatcgtg tctctaagcc ttcttttgat 5220
acctggttta aaaacactaa gatcaaaatt gaaaataaaa attgtttatt acttgtaccg 5280
agtgaatttg catttgaatg gattaagaaa agatatttag aaacaattaa aacagtcctt 5340
gaagaagctg gatatgtttt cgaaaaaatc gaactaagaa aagtgcaata aactgctgaa 5400
gtatttcagc agtttttttt atttagaaat agtgaaaaaa atataatcag ggaggtatca 5460
atatttaatg agtactgatt taaatttatt tagactggaa ttaataatta acacgtagac 5520
taattaaaat ttaatgaggg ataaagagga tacaaaaata ttaatttcaa tccctattaa 5580
attttaacaa gggggggatt aaaatttaat tagaggttta tccacaagaa aagaccctaa 5640
taaaattttt actagggtta taacactgat taatttctta atgggggagg gattaaaatt 5700
taatgacaaa gaaaacaatc ttttaagaaa agcttttaaa agataataat aaaaagagct 5760
ttgcgattaa gcaaaactct ttactttttc attgacatta tcaaattcat cgatttcaaa 5820
ttgttgttgt atcataaagt taattctgtt ttgcacaacc ttttcaggaa tataaaacac 5880
atctgaggct tgttttataa actcagggtc gctaaagtca atgtaacgta gcatatgata 5940
tggtatagct tccacccaag ttagcctttc tgcttcttct gaatgttttt catatacttc 6000
catgggtatc tctaaatgat tttcctcatg tagcaaggta tgagcaaaaa gtttatggaa 6060
ttgatagttc ctctcttttt cttcaacttt tttatctaaa acaaacactt taacatctga 6120
gtcaatgtaa gcataagatg tttttccagt cataatttca atcccaaatc ttttagacag 6180
aaattctgga cgtaaatctt ttggtgaaag aattttttta tgtagcaata tatccgatac 6240
agcaccttct aaaagcgttg gtgaataggg cattttacct atctcctctc attttgtgga 6300
ataaaaatag tcatattcgt ccatctacct atcctattat cgaacagttg aactttttaa 6360
tcaaggatca gtcctttttt tcattattct taaactgtgc tcttaacttt aacaactcga 6420
tttgtttttc cagatctcga gggtaactag cctcgccgat cccgcaagag gcccggcagt 6480
caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac 6540
attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa 6600
aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat 6660
tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc 6720
agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga 6780
gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg 6840
cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc 6900
agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag 6960
taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc 7020
tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg 7080
taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg 7140
acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac 7200
ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac 7260
cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg 7320
agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg 7380
tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg 7440
agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac 7500
tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg 7560
ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 7620
tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 7680
aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 7740
tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 7800
agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 7860
taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 7920
caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 7980
agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 8040
aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 8100
gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 8160
tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 8220
gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt 8280
ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 8340
ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 8400
aggaagcgga agagcgccca atacgcatgc ttaagt 8436
Claims (10)
1. a kind of inducing expression element, which is characterized in that the inducing substrate of the element responds is gluconate;The element
Contain GntR albumen, PlytEPromoter, the promoter P for integrating GntR binding sequencethrS;The PlytEPromoter regulation GntR egg
It is white;The promoter P for integrating GntR binding sequencethrSContain the nucleotide sequence as shown in SEQ ID NO.4;Promoter
PlytEWith promoter PthrSTranscriptional orientation it is opposite.
2. inducing expression element according to claim 1, which is characterized in that encode the PlytEThe nucleotides sequence of promoter
Column are as shown in SEQ ID NO.1.
3. inducing expression element according to claim 1, which is characterized in that the transcriptional regulation protein GntR contains SEQ
Amino acid sequence shown in ID NO.2, or, the gene for encoding the transcriptional regulation protein GntR contains such as SEQ ID NO.6 institute
The nucleotide sequence shown.
4. any inducing expression element according to claim 1~3, which is characterized in that the GntR albumen, PlytEStarting
Son and the promoter P for integrating GntR binding sequencethrSIt is arranged on same plasmid.
5. inducing expression element according to claim 4, which is characterized in that the plasmid include pHT01, pP43NMK or
pSTOP1622。
6. the genetic engineering bacterium containing any inducing expression element of Claims 1 to 5.
7. genetic engineering bacterium according to claim 6, which is characterized in that with bacillus subtilis be host.
8. any inducing expression element of Claims 1 to 5 is promoting destination protein expression or is reducing albumen leakage expression side
The application in face.
9. application of any inducing expression element of Claims 1 to 5 in the microorganism of screening expression target gene.
10. the genetic engineering bacterium of claim 6 or 7 answering in terms of promoting destination protein expression or reducing albumen leakage expression
With.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910368345.5A CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910368345.5A CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110093366A true CN110093366A (en) | 2019-08-06 |
CN110093366B CN110093366B (en) | 2022-09-27 |
Family
ID=67446817
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910368345.5A Active CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110093366B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112961879A (en) * | 2021-02-26 | 2021-06-15 | 江南大学 | Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS61100194A (en) * | 1984-10-23 | 1986-05-19 | Mitsui Toatsu Chem Inc | Gluconic acid operon and promoter of bacillus subtilis |
-
2019
- 2019-05-05 CN CN201910368345.5A patent/CN110093366B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JPS61100194A (en) * | 1984-10-23 | 1986-05-19 | Mitsui Toatsu Chem Inc | Gluconic acid operon and promoter of bacillus subtilis |
Non-Patent Citations (1)
Title |
---|
张西锋等: "枯草芽孢杆菌葡萄糖酸操纵子突变株的构建", 《江苏农业科学》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112961879A (en) * | 2021-02-26 | 2021-06-15 | 江南大学 | Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid |
Also Published As
Publication number | Publication date |
---|---|
CN110093366B (en) | 2022-09-27 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11875298B2 (en) | Sensor for NADP (H) and development of alcohol dehydrogenases | |
KR102191739B1 (en) | Modified foot-and-mouth disease virus 3C protease, composition and method thereof | |
CN111235080B (en) | Gene recombination escherichia coli and production method of 5-hydroxytryptamine | |
CN111154707B (en) | Method for producing genetically engineered escherichia coli and melatonin | |
CN110093366B (en) | Bacillus subtilis gluconate induction expression element and construction method thereof | |
CN107988250B (en) | Construction method of universal chlamydomonas foreign gene expression vector | |
CN104278031B (en) | Promoter A regulated by xanthine as well as recombinant expression vector and application of promoter A | |
CN114480474B (en) | Construction and application of marine nannochloropsis transcription activation CRISPRa system | |
KR101443052B1 (en) | Modified chondroitin synthase polypeptide and crystal thereof | |
CN110241098B (en) | Truncated high-specificity variant of CRISPR nuclease SpCas9 of streptococcus pyogenes and application thereof | |
TW201209164A (en) | Method for enhancing production of disease-resistant usage proteins using bioreactors | |
CN106479928B (en) | The indigenous plasmid of one plant of resistance to resistance to high COD salt water meningitidis strains and the source bacterial strain with high salt | |
KR101878801B1 (en) | Method of genome engineering in clostridia | |
CN113736797B (en) | Culture method for improving yield of microalgae Triglyceride (TAG) and application thereof | |
CN110272881B (en) | Endonuclease SpCas9 high specificity truncated variant TSpCas9-V1/V2 and application thereof | |
CN111909914B (en) | High PAM compatibility truncated variant txCas9 of endonuclease SpCas9 and application thereof | |
CN112553237A (en) | Novel mariner transposon system, application and construction of bacillus subtilis insertion mutant library | |
KR101989814B1 (en) | Shuttle plasmid replicable in clostridium and escherichia coli, and recombinant microorganism having enhanced pentose metabolism and fermentation performance prepared using the same | |
CN106520818B (en) | A kind of method of quick covering riemerella anatipestifer missing gene | |
CN106636023B (en) | A method of enhancing zwf gene promoter expression intensity | |
CN112662697B (en) | Chlamydomonas reinhardtii TCTN1 expression plasmid and construction method and application thereof | |
CN109136228A (en) | Application of the long-chain non-coding RNA-NKILA in bone tissue injury repair | |
CN101613702B (en) | Establishing method of non-antibiotic resistance selecting and marking system based on QAPRTase gene and application | |
CN115992164A (en) | CRISPRi gene suppression system, genetically engineered bacterium containing CRISPRi gene suppression system and application of CRISPRi gene suppression system | |
CN109136227A (en) | Application of the long-chain non-coding RNA-HOXA-AS2 in bone tissue injury repair |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |