CN110093366B - Bacillus subtilis gluconate induction expression element and construction method thereof - Google Patents
Bacillus subtilis gluconate induction expression element and construction method thereof Download PDFInfo
- Publication number
- CN110093366B CN110093366B CN201910368345.5A CN201910368345A CN110093366B CN 110093366 B CN110093366 B CN 110093366B CN 201910368345 A CN201910368345 A CN 201910368345A CN 110093366 B CN110093366 B CN 110093366B
- Authority
- CN
- China
- Prior art keywords
- promoter
- gntr
- gluconate
- bacillus subtilis
- lyte
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/001—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination
- C12N2830/002—Vector systems having a special element relevant for transcription controllable enhancer/promoter combination inducible enhancer/promoter combination, e.g. hypoxia, iron, transcription factor
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a bacillus subtilis gluconate induced expression element and a construction method thereof, belonging to the field of genetic engineering. The invention uses a constitutive promoter P lytE Expressing the transcriptional regulator protein GntR, further by expression in the constitutive promoter P thrS In the method, a transcription regulatory protein GntR binding sequence is integrated, so that when Bacillus subtilis 168 is taken as a host, a high-intensity induced expression level and a low leakage expression level are achieved after gluconate is added, the induced expression intensity reaches 22500a.u., the leakage amount is reduced from 15.6% to 3.0%, and a foundation is laid for screening gene engineering bacteria or regulating protein expression.
Description
Technical Field
The invention relates to a bacillus subtilis gluconate induced expression element and a construction method thereof, belonging to the field of genetic engineering.
Background
In the field of bacillus subtilis metabolic engineering, a promoter element responding to small molecular substance induced expression is widely applied to metabolic regulation and control in other directions. Currently, the inducible promoter commonly used in Bacillus subtilis is xylose inducible promoter P xyl And IPTG inducible promoter P grac . However, xylose inducible promoter P xyl The problem of high cost of xylose exists, and IPTG induces promoter P grac IPTG is expensive and has certain toxicity to cells. Secondly, both xylose and IPTG inducible promoters suffer from higher leaky expression problems. The defects seriously limit the application of the bacillus subtilis in the field of metabolic engineering. Gluconate, as a simple carbon source, is inexpensive and non-toxic to cells and is a suitable inducer. By genetically engineering promoters, inducible response elements more suitable for B.subtilis can be obtained. However, how to modify the promoter to respond to gluconate to achieve higher inducible expression strength and lower leaky expression level is a problem worthy of intensive study. The strong inducible expression response element in response to gluconate is not sufficiently achieved only by relieving the repression effect of carbon source metabolism of the original promoter of Bacillus subtilis PgntWT (see the 2016 published paper "Bacillus subtilis GntR regulation modified to device identification transferinduction systems) with induction expression strength much lower than xylose and IPTG-induced promoters, thus limiting the application of gluconate-induced expression elements in the field of bacillus subtilis metabolic engineering.
Disclosure of Invention
To solve the above technical problem, inducible expression promoter elements that respond to gluconate are realized and brought to a higher inducible expression level, as well as a lower leaky expression level.
The first object of the present invention is to provide an inducible expression promoter element; the inducing substrate of the response of the element is gluconate; the element contains GntR protein and P lytE Promoter, P thrS And a GntR binding sequence; said P is lytE The promoter regulates the GntR protein; the P is thrS Is integrated with a GntR binding sequence, and the integrated nucleotide sequence is shown as SEQ ID NO. 4; promoter P lytE And promoter P thrS The direction of transcription of (a) is opposite.
In one embodiment of the present invention, said P lytE The nucleotide sequence of the promoter is shown as SEQ ID NO. 1.
In one embodiment of the invention, the transcriptional regulator protein GntR has an amino acid sequence as set forth in SEQ ID No. 2.
In one embodiment of the present invention, the nucleotide sequence encoding the transcription regulatory protein is shown in SEQ ID NO. 6.
In one embodiment of the invention, the plasmid is the pHT01, pP43NMK or pSTOP1622 plasmid.
In one embodiment of the invention, the element further comprises a GntR promoter; the nucleotide sequence for coding the GntR promoter is shown as SEQ ID NO. 8.
In one embodiment of the invention, the GntR protein, P lytE Promoter and promoter P incorporating GntR binding sequences thrS Set on the same plasmid.
In one embodiment of the present invention, the nucleotide sequence of the plasmid is shown in SEQ NO. 11.
The second purpose of the invention is to provide a genetically engineered bacterium containing the gluconate-induced expression element.
In one embodiment of the present invention, the genetically engineered bacterium is a bacillus subtilis host.
The third purpose of the invention is to provide the application of the gluconate-induced expression element in the field of bacillus subtilis metabolic engineering.
In one embodiment of the invention, the application is to promote expression of a protein of interest.
In one embodiment of the invention, the gene encoding the protein of interest is subjected to promoter P lytE Regulation and control of (1).
In one embodiment of the invention, the use is for reducing leaky expression levels.
In one embodiment of the invention, the application is to screen genetically engineered bacteria expressing a target gene.
In one embodiment of the present invention, the activation conditions of the gluconate-induced expression element are: the culture environment contains gluconate; the culture condition is that the culture is carried out for 16-48 h at 30-37 ℃.
Has the advantages that: (1) the invention integrates the GntR binding site sequence ATACTTGTATACAAGTATACT of the transcriptional control protein into a stronger constitutive expression promoter P thrS In the method, a gluconate-induced expression promoter element with high activation strength is obtained.
(2) The invention changes the original promoter of the transcription regulatory protein GntR into a stronger constitutive promoter P under the condition of a fermentation medium lytE The expression level of the transcription regulatory protein GntR is improved, and the leakage expression level of a gluconate-induced expression element under the condition of no gluconate is reduced.
(3) The gluconate-induced expression promoter element provided by the invention has the activated expression intensity of 22000a.u in bacillus subtilis (and a strong promoter P in bacillus subtilis) 43 Expression intensity 30000a.u. approach). Further enhancing the expression level of the transcription regulatory protein GntR to ensure that the induction expression of the gluconate is startedThe expression level of the leakage of the rotor element in the absence of gluconate is only about 3%. Lays a foundation for further modifying a bacillus subtilis gluconate induced expression promoter through gene engineering. The gluconate-induced expression promoter provided by the invention is simple in construction method, convenient to use and has a good metabolic engineering application prospect.
Detailed Description
The sequences involved in the specific embodiments are as follows:
constitutive P lytE The nucleotide sequence of the promoter is shown as SEQ ID NO. 1;
the amino acid sequence of the transcription regulation protein GntR is shown in SEQ ID NO. 2;
constitutive promoter P thrS The nucleotide sequence of (A) is shown as SEQ ID NO. 3;
constitutive promoter P thrS The nucleotide sequence after the GntR binding sequence is integrated is shown as SEQ ID NO. 4;
the original base sequence of the transcription regulatory protein GntR is shown as SEQ ID NO. 5;
the nucleotide sequence of the 120 th base of the transcription regulatory protein GntR after C is replaced by T is shown as SEQ ID NO. 6;
the nucleotide sequence of the GntR original promoter is shown as SEQ ID NO. 7;
the sequence of the GntR promoter of the encoded and optimized transcription regulation protein is shown as SEQ ID NO. 8;
the amino acid sequence of the green fluorescent protein GFP is shown as SEQ NO. 9;
the nucleotide sequence of the gluconate-induced expression element plasmid pHT-BaL-optimal after the original GntR promoter is optimized is shown in SEQ NO. 10;
replacement of the GntR promoter with constitutive P lytE The base sequence of the gluconate-induced expression element plasmid pHT-BaL-lytE behind the promoter is shown in SEQ NO. 11.
The culture conditions of the bacillus subtilis containing the gluconate-induced expression promoter element are as follows:
fermentation medium (g/L): 60 parts of sodium gluconate, 6 parts of tryptone, 12 parts of yeast powder, 6 parts of ammonium sulfate, 12.5 parts of dipotassium hydrogen phosphate, 2.5 parts of potassium dihydrogen phosphate and 3 parts of magnesium sulfate.
The culture conditions are as follows: culturing at 37 deg.C and 200rpm for 48 h.
The green fluorescent protein and thallus concentration detection method comprises the following steps:
the Tecan microplate reader is adopted to detect green fluorescent protein, the excitation wavelength is 490nm, the emission wavelength is 530nm, and the gain is 60. The detection wavelength of the thallus concentration is 600 nm.
Leak expression amount calculation formula (%): x ═ a-b)/c
Wherein a is the fluorescence intensity of the gluconate-induced expression element when gluconate is not added, b is the fluorescence intensity of the bacillus subtilis 168 strain as a control strain, and c is the fluorescence intensity of the gluconate-induced expression element when gluconate is added.
EXAMPLE 1 construction of the gluconic acid response element tool plasmid pHT-BaL-optimal
Designing a primer pHT-F:
5'-ACACATGGCATGGATGAACTATACAAATAATTCACGTCACGCGTCCATGGAGA-3' and pHT-R: 5'-GAGCTCGAATTCACTGGCCGTCGTTTTA-3', amplifying pHT01 plasmid skeleton with pHT01 plasmid as template; design primer GntR-F:
5'-ACGACGGCCAGTGAATTCGAGCTCCTAGTCATTGTTGTATTCAGCTCCTTTTGCCAGC A-3' and GntR-R: 5'-ATGCTAGACTCCAAAGACCTGTTGTATCCCG-3', changing the 120 th position of original GntR sequence (shown in SEQ ID NO. 5) in the bacillus subtilis from C to T, relieving the glucose catabolism repression effect, and the GntR sequence after base change is SEQ ID NO.6, and the coded amino acid sequence is not changed. The expression promoter sequence of the original transcription regulatory protein GntR in the bacillus subtilis is SEQ ID NO.7, nucleotides 127, 128 and 129 of the original GntR promoter are replaced by CAT to ACA, the glucose catabolism repression effect is relieved, and the GntR promoter sequence after nucleotide replacement is SEQ ID NO. 8. Design primer PGntR-F:
5'-GATACAACAGGTCTTTGGAGTCTAGCATACACTCACCTTCCTCACTCAAGGAGTATAC T-3' and PGntR-R:
5'-GCAATATGGTAAAAATTTAAATAAAAATTAGAAATGAAAGTGTTTGA-3', synthesizing the GntR gene after codon optimization, and using the synthesized GntR gene as a template to amplify the GntR promoter sequence SEQ ID NO.8 after gene sequence optimization; designing a primer PthrS-F: 5' -
AATTTTTATTTAAATTTTTACCATATTGCTATGTATATTGATTCTCATTTGCTCGCGCC-3' and PthrS-R: 5' -
GTGTACATTTCACCTCCTTTAAGGAGTATACTTGTATACAAGTATTATAAATTGTTCAATCC AAAAAATCAACACGAT-3' using Bacillus subtilis 168 genome as template to amplify P containing GntR binding sequence thrS A promoter sequence (SEQ ID NO. 4); design of primer 5-
ACTCCTTAAAGGAGGTGAAATGTACACATGGGTAAGGGAGAAGAACTTTTCACTGGA-3 ' and 5'-TTATTTGTATAGTTCATCCATGCCATGTGTAATC-3', and the GFP gene sequence SEQ ID NO.9 was amplified using plasmid pBSX-GFP (disclosed in the paper, characterisation and application of endogenous phase-dependent promoters in Bacillus subtilis, application. Microbiol. Biotechnol.101, 4151-61) as a template.
A GntR promoter gene fragment shown in SEQ ID NO.8, a GntR repressor gene fragment shown in SEQ ID NO.6 and P shown in SEQ ID NO.4 thrS The promoter gene fragment, the fluorescent protein GFP gene fragment shown in SEQ ID NO.9 and the pHT01 plasmid fragment, wherein the 5 DNA fragments are assembled by a NEB Gibson Assembly Master Mix Kit to construct a gluconic acid response element tool plasmid pHT-BaL-optimal plasmid.
Example 2 construction of gluconate-inducible expression element Bacillus subtilis BS-pHT-BaL-optimal
The pHT-BaL-optimal plasmid constructed in the example 1 is transformed into Bacillus subtilis 168 to obtain a recombinant Bacillus subtilis engineering bacterium which is named as BS-pHT-BaL-optimal.
EXAMPLE 3 construction of the gluconic acid response element tool plasmid pHT-BaL-lytE
Designing primers pHT-lytE-F: 5'-TATGTATATTGATTCTCATTTGCTCGCGCCGCTGA-3' and pHT-lytE-R: 5'-AAAGGAGGTGAAATGTACACATGCTAGACTCCAAAGACCTGTTGTATCCCGCA-3', and amplifying a plasmid skeleton fragment by using the pHT-BaL-optimal plasmid constructed by the method in the embodiment 1 as a template; design of primers 5' -GTGTACATTTCACCTCCTTTCCCAAATGTTAACTCTATATATATGTATCTCTTTTTTTAAA TTAATCT-3 ' and 5'-AATGAGAATCAATATACATACTCCTCGAATATACTTTATCACTCATTTTTCCGATATAT-3' amplification of P lytE A promoter sequence.
The plasmid skeleton fragment and P are amplified by taking the pHT-BaL-optimal plasmid as a template lytE The promoter fragment was composed of 2 DNA fragments, and was assembled by the NEB Gibson Assembly Master Mix Kit to construct the gluconate-responsive element tool plasmid pHT-BaL-lytE plasmid.
Example 4 construction of gluconate-inducible expression element Bacillus subtilis BS-pHT-BaL-lytE
The pHT-BaL-lytE plasmid prepared in example 3 was transformed into Bacillus subtilis 168 to obtain a recombinant Bacillus subtilis engineering bacterium, which was named BS-pHT-BaL-lytE.
Example 5 fermentation of Bacillus subtilis BS-pHT-BaL-optimal with sodium gluconate
The strain BS-pHT-BaL-optical prepared according to the method of example 2 was cultured at 37 ℃ and 200rpm in a fermentation medium containing 60g/L of sodium gluconate for 48 hours. And finally, determining the intensity of the green fluorescent protein of the fermentation liquor to be 22500a.u., and successfully obtaining the gluconate induced expression element with strong induced expression intensity. When the fermentation medium is not added with sodium gluconate, the fermentation is carried out for 48 hours, the green fluorescent protein intensity of the fermentation liquid is 3500a.u., and the leakage expression amount is 15.6%.
Example 6 fermentation of Bacillus subtilis BS-pHT-BaL-lytE with sodium gluconate
The strain BS-pHT-BaL-lytE prepared in accordance with the method of example 4 was cultured at 37 ℃ and 200rpm in a fermentation medium containing 60g/L of sodium gluconate for 48 hours. Finally, the strength of the green fluorescent protein of the fermentation liquor is 22000a.u., and compared with the control strain BS-pHT-BaL-optimal, the induced expression strength is not obviously reduced. However, when the fermentation medium is not added with sodium gluconate, the fermentation time is 48 hours, the green fluorescent protein intensity of the fermentation liquid is only 660a.u., and the leakage expression amount is reduced from 15.6% to 3.0%.
Comparative example 1 Effect of different promoters on the Regulation Effect of inducible expression elements
Employing the strategy of example 1Constructing inducible expression elements, with the difference that P is separately introduced thrS Promoter replacement by P yvyD Promoter, P phrK Promoter and P odhA The promoter, the method of example 5 or 6 was used to verify the regulatory effect, and the results showed P phrK The induction activation intensity of an induction expression element constructed by the promoter is only 3000a.u., and P is yvyD Promoter and P odhA The promoter constructs an inducible expression element which can not be activated to express.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by one skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
SEQUENCE LISTING
<110> university in south of the Yangtze river
<120> bacillus subtilis gluconate induction expression element and construction method
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 300
<212> DNA
<213> Artificial sequence
<400> 1
ctcctcgaat atactttatc actcattttt ccgatatatg agccgacccc gaaagttttt 60
catttatttc ctttatgttg aaaaacatcc cataaaacat gacaaaagca ctcgtttttt 120
gtcacctttg caatgaaaat gaaatattta atacccttaa aaactttttt ttagaacgaa 180
taattaagaa atttgtcaca tgaagtcaag actatttctg atgggaatct atccttataa 240
tagaaatcaa taagattaat ttaaaaaaag agatacatat atatagagtt aacatttggg 300
<210> 2
<211> 243
<212> PRT
<213> Artificial sequence
<400> 2
Met Leu Asp Ser Lys Asp Leu Leu Tyr Pro Ala Lys Trp Leu Ser Lys
1 5 10 15
Ala Ser Thr Gly Val Arg Val Ala Tyr Glu Leu Arg Met Arg Ile Val
20 25 30
Ser Gly Leu Ile Glu Ser Gly Thr Ile Leu Ser Glu Asn Thr Ile Ala
35 40 45
Ala Glu Phe Ser Val Ser Arg Ser Pro Val Arg Glu Ala Leu Lys Ile
50 55 60
Leu Ala Ser Glu Lys Ile Ile Arg Leu Glu Arg Met Gly Ala Val Val
65 70 75 80
Ile Gly Leu Thr Glu Lys Lys Ile Ala Glu Ile Tyr Asp Val Arg Leu
85 90 95
Leu Leu Glu Thr Phe Val Phe Glu Arg Leu Val Lys Ile Asp Ile Glu
100 105 110
Pro Leu Val Lys Asp Leu Ser Lys Ile Leu Glu Met Met Lys Val Ser
115 120 125
Ile Lys Tyr Glu Asp Ala Asp Glu Phe Ser Phe Gln Asp Val Leu Phe
130 135 140
His Glu Thr Ile Ile Arg Ala Ile Asp His Ser Tyr Ile Gln Met Ile
145 150 155 160
Trp Asn Asn Leu Lys Pro Val Met Glu Ser Phe Ile Leu Leu Ser Met
165 170 175
Arg Val Arg Leu Lys Glu Lys Tyr Glu Asp Phe Thr Arg Ile Leu Asp
180 185 190
Asn His Glu Leu Tyr Ile Gln Ala Ile Lys Thr Lys Asp Arg Ala Leu
195 200 205
Met Ile Gln Ser Leu His Gln Asn Phe Asp Asp Val Gln Asp Lys Val
210 215 220
Glu Asp Leu Trp Leu Ser Gln Gln Met Leu Ala Lys Gly Ala Glu Tyr
225 230 235 240
Asn Asn Asp
<210> 3
<211> 300
<212> DNA
<213> Artificial sequence
<400> 3
tatgtatatt gattctcatt tgctcgcgcc gctgatttcc attgcgcctg atgaagtcgt 60
gctttatacc gaccagcccg agcacatgat ggcaaggacc attcaaaacg tatttcaaga 120
gagagtggaa atgctcccgc tgcatgcttt tacagatgca gaaataccgg tgaagcactc 180
ggaaggatga gggccggcag cctgtctatt taaggctgtc ggtttaaaaa aaaggaaacg 240
cgatcgtgtt gattttttgg attgaacaat ttataataca taggagatta agaaagacac 300
<210> 4
<211> 300
<212> DNA
<213> Artificial sequence
<400> 4
tatgtatatt gattctcatt tgctcgcgcc gctgatttcc attgcgcctg atgaagtcgt 60
gctttatacc gaccagcccg agcacatgat ggcaaggacc attcaaaacg tatttcaaga 120
gagagtggaa atgctcccgc tgcatgcttt tacagatgca gaaataccgg tgaagcactc 180
ggaaggatga gggccggcag cctgtctatt taaggctgtc ggtttaaaaa aaaggaaacg 240
cgatcgtgtt gattttttgg attgaacaat ttataatact tgtatacaag tatactcctt 300
<210> 5
<211> 732
<212> DNA
<213> Artificial sequence
<400> 5
atgctagact ccaaagacct gttgtatccc gcaaaatggc tctcaaaagc gtcaaccgga 60
gttcgtgtcg catacgagct gagaatgcgg atcgtttcag gtctgattga aagcggtacc 120
attttatcag aaaatacaat cgccgccgag ttttcagtaa gccgttcgcc ggttcgcgaa 180
gcgctaaaaa tactcgcatc cgaaaaaatc atccgcttag aacgaatggg agcggtcgta 240
attggtttaa ctgagaagaa aatcgcggaa atttatgatg tgcggttact attagaaaca 300
tttgtctttg aacggcttgt caaaatagac attgagcctt tagttaagga tctcagcaaa 360
attcttgaaa tgatgaaagt ctcaatcaaa tatgaggatg ctgacgaatt ttcatttcaa 420
gatgtgctgt tccatgaaac gattatccga gcgattgatc attcatacat tcagatgatc 480
tggaacaatc taaaacccgt catggaaagc tttattcttt tatcgatgcg ggtacggtta 540
aaggaaaagt atgaagactt cacaaggatt ttagataacc acgagcttta tattcaagcc 600
atcaaaacaa aggatagggc gctgatgatt cagtctcttc accaaaactt tgatgatgtg 660
caggataagg tagaagacct atggctctca caacaaatgc tggcaaaagg agctgaatac 720
aacaatgact ag 732
<210> 6
<211> 732
<212> DNA
<213> Artificial sequence
<400> 6
atgctagact ccaaagacct gttgtatccc gcaaaatggc tctcaaaagc gtcaaccgga 60
gttcgtgtcg catacgagct gagaatgcgg atcgtttcag gtctgattga aagcggtact 120
attttatcag aaaatacaat cgccgccgag ttttcagtaa gccgttcgcc ggttcgcgaa 180
gcgctaaaaa tactcgcatc cgaaaaaatc atccgcttag aacgaatggg agcggtcgta 240
attggtttaa ctgagaagaa aatcgcggaa atttatgatg tgcggttact attagaaaca 300
tttgtctttg aacggcttgt caaaatagac attgagcctt tagttaagga tctcagcaaa 360
attcttgaaa tgatgaaagt ctcaatcaaa tatgaggatg ctgacgaatt ttcatttcaa 420
gatgtgctgt tccatgaaac gattatccga gcgattgatc attcatacat tcagatgatc 480
tggaacaatc taaaacccgt catggaaagc tttattcttt tatcgatgcg ggtacggtta 540
aaggaaaagt atgaagactt cacaaggatt ttagataacc acgagcttta tattcaagcc 600
atcaaaacaa aggatagggc gctgatgatt cagtctcttc accaaaactt tgatgatgtg 660
caggataagg tagaagacct atggctctca caacaaatgc tggcaaaagg agctgaatac 720
aacaatgact ag 732
<210> 7
<211> 114
<212> DNA
<213> Artificial sequence
<400> 7
gcaatatggt aaaaatttaa ataaaaatta gaaatgaaag tgtttgcata aaagaaatat 60
tcacgttatc atacttgtat acaagtatac tccttgagtg aggaaggtga gtgt 114
<210> 8
<211> 114
<212> DNA
<213> Artificial sequence
<400> 8
gcaatatggt aaaaatttaa ataaaaatta gaaatgaaag tgtttgacaa aaagaaatat 60
tcacgttatc atacttgtat acaagtatac tccttgagtg aggaaggtga gtgt 114
<210> 9
<211> 238
<212> PRT
<213> Artificial sequence
<400> 9
Met Gly Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val
1 5 10 15
Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu
20 25 30
Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys
35 40 45
Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu
50 55 60
Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Arg
65 70 75 80
His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg
85 90 95
Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val
100 105 110
Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile
115 120 125
Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn
130 135 140
Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly
145 150 155 160
Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val
165 170 175
Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro
180 185 190
Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser
195 200 205
Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val
210 215 220
Thr Ala Ala Gly Ile Thr His Gly Met Asp Glu Leu Tyr Lys
225 230 235
<210> 10
<211> 8250
<212> DNA
<213> Artificial sequence
<400> 10
tattggtatg actggtttta agcgcaaaaa aagttgcttt ttcgtaccta ttaatgtatc 60
gttttagaaa accgactgta aaaagtacag tcggcattat ctcatattat aaaagccagt 120
cattaggcct atctgacaat tcctgaatag agttcataaa caatcctgca tgataaccat 180
cacaaacaga atgatgtacc tgtaaagata gcggtaaata tattgaatta cctttattaa 240
tgaattttcc tgctgtaata atgggtagaa ggtaattact attattattg atatttaagt 300
taaacccagt aaatgaagtc catggaataa tagaaagaga aaaagcattt tcaggtatag 360
gtgttttggg aaacaatttc cccgaaccat tatatttctc tacatcagaa aggtataaat 420
cataaaactc tttgaagtca ttctttacag gagtccaaat accagagaat gttttagata 480
caccatcaaa aattgtataa agtggctcta acttatccca ataacctaac tctccgtcgc 540
tattgtaacc agttctaaaa gctgtatttg agtttatcac ccttgtcact aagaaaataa 600
atgcagggta aaatttatat ccttcttgtt ttatgtttcg gtataaaaca ctaatatcaa 660
tttctgtggt tatactaaaa gtcgtttgtt ggttcaaata atgattaaat atctcttttc 720
tcttccaatt gtctaaatca attttattaa agttcatttg atatgcctcc taaattttta 780
tctaaagtga atttaggagg cttacttgtc tgctttcttc attagaatca atcctttttt 840
aaaagtcaat attactgtaa cataaatata tattttaaaa atatcccact ttatccaatt 900
ttcgtttgtt gaactaatgg gtgctttagt tgaagaataa aagaccacat taaaaaatgt 960
ggtcttttgt gtttttttaa aggatttgag cgtagcgaaa aatccttttc tttcttatct 1020
tgataataag ggtaactatt gccgatcgtc cattccgaca gcatcgccag tcactatggc 1080
gtgctgctag cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 1140
ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 1200
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattcgagct 1260
cctagtcatt gttgtattca gctccttttg ccagcatttg ttgtgagagc cataggtctt 1320
ctaccttatc ctgcacatca tcaaagtttt ggtgaagaga ctgaatcatc agcgccctat 1380
cctttgtttt gatggcttga atataaagct cgtggttatc taaaatcctt gtgaagtctt 1440
catacttttc ctttaaccgt acccgcatcg ataaaagaat aaagctttcc atgacgggtt 1500
ttagattgtt ccagatcatc tgaatgtatg aatgatcaat cgctcggata atcgtttcat 1560
ggaacagcac atcttgaaat gaaaattcgt cagcatcctc atatttgatt gagactttca 1620
tcatttcaag aattttgctg agatccttaa ctaaaggctc aatgtctatt ttgacaagcc 1680
gttcaaagac aaatgtttct aatagtaacc gcacatcata aatttccgcg attttcttct 1740
cagttaaacc aattacgacc gctcccattc gttctaagcg gatgattttt tcggatgcga 1800
gtatttttag cgcttcgcga accggcgaac ggcttactga aaactcggcg gcgattgtat 1860
tttctgataa aatagtaccg ctttcaatca gacctgaaac gatccgcatt ctcagctcgt 1920
atgcgacacg aactccggtt gacgcttttg agagccattt tgcgggatac aacaggtctt 1980
tggagtctag catacactca ccttcctcac tcaaggagta tacttgtata caagtatgat 2040
aacgtgaata tttctttttg tcaaacactt tcatttctaa tttttattta aatttttacc 2100
atattgctat gtatattgat tctcatttgc tcgcgccgct gatttccatt gcgcctgatg 2160
aagtcgtgct ttataccgac cagcccgagc acatgatggc aaggaccatt caaaacgtat 2220
ttcaagagag agtggaaatg ctcccgctgc atgcttttac agatgcagaa ataccggtga 2280
agcactcgga aggatgaggg ccggcagcct gtctatttaa ggctgtcggt ttaaaaaaaa 2340
ggaaacgcga tcgtgttgat tttttggatt gaacaattta taatacttgt atacaagtat 2400
actccttaaa ggaggtgaaa tgtacacatg ggtaagggag aagaactttt cactggagtt 2460
gtcccaattc ttgttgaatt agatggtgat gttaatgggc acaaattttc tgtcagtgga 2520
gagggtgaag gtgatgcaac atacggaaaa cttaccctta aatttatttg cactactgga 2580
aagcttcctg ttccttggcc aacacttgtc actactctta cttatggtgt tcaatgcttt 2640
tcaagatacc cagatcatat gaagcggcac gacttcttca agagcgccat gcctgaggga 2700
tacgtgcagg agaggaccat cttcttcaag gacgacggga actacaagac acgtgctgaa 2760
gtcaagtttg agggagacac cctcgtcaac agaatcgagc ttaagggaat cgatttcaag 2820
gaggacggaa acatcctcgg ccacaagttg gaatacaact acaactccca caacgtatac 2880
atcatggcag acaaacaaaa gaatggaatc aaagttaact tcaaaattag acacaacatt 2940
gaagatggaa gcgttcaact agcagaccat tatcaacaaa atactccaat tggcgatggc 3000
cctgtccttt taccagacaa ccattacctg tccacacaat ctgccctttc gaaagatccc 3060
aacgaaaaga gagaccacat ggtccttctt gagtttgtaa cagctgctgg gattacacat 3120
ggcatggatg aactatacaa ataattcacg tcacgcgtcc atggagatct ttgtctgcaa 3180
ctgaaaagtt tataccttac ctggaacaaa tggttgaaac atacgaggct aatatcggct 3240
tattaggaat agtccctgta ctaataaaat caggtggatc agttgatcag tatattttgg 3300
acgaagctcg gaaagaattt ggagatgact tgcttaattc cacaattaaa ttaagggaaa 3360
gaataaagcg atttgatgtt caaggaatca cggaagaaga tactcatgat aaagaagctc 3420
taaaactatt caataacctt acaatggaat tgatcgaaag ggtggaaggt taatggtacg 3480
aaaattaggg gatctaccta gaaagccaca aggcgatagg tcaagcttaa agaaccctta 3540
catggatctt acagattctg aaagtaaaga aacaacagag gttaaacaaa cagaaccaaa 3600
aagaaaaaaa gcattgttga aaacaatgaa agttgatgtt tcaatccata ataagattaa 3660
atcgctgcac gaaattctgg cagcatccga agggaattca tattacttag aggatactat 3720
tgagagagct attgataaga tggttgagac attacctgag agccaaaaaa ctttttatga 3780
atatgaatta aaaaaaagaa ccaacaaagg ctgagacaga ctccaaacga gtctgttttt 3840
ttaaaaaaaa tattaggagc attgaatata tattagagaa ttaagaaaga catgggaata 3900
aaaatatttt aaatccagta aaaatatgat aagattattt cagaatatga agaactctgt 3960
ttgtttttga tgaaaaaaca aacaaaaaaa atccacctaa cggaatctca atttaactaa 4020
cagcggccaa actgagaagt taaatttgag aaggggaaaa ggcggattta tacttgtatt 4080
taactatctc cattttaaca ttttattaaa ccccatacaa gtgaaaatcc tcttttacac 4140
tgttccttta ggtgatcgcg gagggacatt atgagtgaag taaacctaaa aggaaataca 4200
gatgaattag tgtattatcg acagcaaacc actggaaata aaatcgccag gaagagaatc 4260
aaaaaaggga aagaagaagt ttattatgtt gctgaaacgg aagagaagat atggacagaa 4320
gagcaaataa aaaacttttc tttagacaaa tttggtacgc atatacctta catagaaggt 4380
cattatacaa tcttaaataa ttacttcttt gatttttggg gctatttttt aggtgctgaa 4440
ggaattgcgc tctatgctca cctaactcgt tatgcatacg gcagcaaaga cttttgcttt 4500
cctagtctac aaacaatcgc taaaaaaatg gacaagactc ctgttacagt tagaggctac 4560
ttgaaactgc ttgaaaggta cggttttatt tggaaggtaa acgtccgtaa taaaaccaag 4620
gataacacag aggaatcccc gatttttaag attagacgta aggttccttt gctttcagaa 4680
gaacttttaa atggaaaccc taatattgaa attccagatg acgaggaagc acatgtaaag 4740
aaggctttaa aaaaggaaaa agagggtctt ccaaaggttt tgaaaaaaga gcacgatgaa 4800
tttgttaaaa aaatgatgga tgagtcagaa acaattaata ttccagaggc cttacaatat 4860
gacacaatgt atgaagatat actcagtaaa ggagaaattc gaaaagaaat caaaaaacaa 4920
atacctaatc ctacaacatc ttttgagagt atatcaatga caactgaaga ggaaaaagtc 4980
gacagtactt taaaaagcga aatgcaaaat cgtgtctcta agccttcttt tgatacctgg 5040
tttaaaaaca ctaagatcaa aattgaaaat aaaaattgtt tattacttgt accgagtgaa 5100
tttgcatttg aatggattaa gaaaagatat ttagaaacaa ttaaaacagt ccttgaagaa 5160
gctggatatg ttttcgaaaa aatcgaacta agaaaagtgc aataaactgc tgaagtattt 5220
cagcagtttt ttttatttag aaatagtgaa aaaaatataa tcagggaggt atcaatattt 5280
aatgagtact gatttaaatt tatttagact ggaattaata attaacacgt agactaatta 5340
aaatttaatg agggataaag aggatacaaa aatattaatt tcaatcccta ttaaatttta 5400
acaagggggg gattaaaatt taattagagg tttatccaca agaaaagacc ctaataaaat 5460
ttttactagg gttataacac tgattaattt cttaatgggg gagggattaa aatttaatga 5520
caaagaaaac aatcttttaa gaaaagcttt taaaagataa taataaaaag agctttgcga 5580
ttaagcaaaa ctctttactt tttcattgac attatcaaat tcatcgattt caaattgttg 5640
ttgtatcata aagttaattc tgttttgcac aaccttttca ggaatataaa acacatctga 5700
ggcttgtttt ataaactcag ggtcgctaaa gtcaatgtaa cgtagcatat gatatggtat 5760
agcttccacc caagttagcc tttctgcttc ttctgaatgt ttttcatata cttccatggg 5820
tatctctaaa tgattttcct catgtagcaa ggtatgagca aaaagtttat ggaattgata 5880
gttcctctct ttttcttcaa cttttttatc taaaacaaac actttaacat ctgagtcaat 5940
gtaagcataa gatgtttttc cagtcataat ttcaatccca aatcttttag acagaaattc 6000
tggacgtaaa tcttttggtg aaagaatttt tttatgtagc aatatatccg atacagcacc 6060
ttctaaaagc gttggtgaat agggcatttt acctatctcc tctcattttg tggaataaaa 6120
atagtcatat tcgtccatct acctatccta ttatcgaaca gttgaacttt ttaatcaagg 6180
atcagtcctt tttttcatta ttcttaaact gtgctcttaa ctttaacaac tcgatttgtt 6240
tttccagatc tcgagggtaa ctagcctcgc cgatcccgca agaggcccgg cagtcaggtg 6300
gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa 6360
atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 6420
agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 6480
ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 6540
gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 6600
gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 6660
tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 6720
acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 6780
aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 6840
cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 6900
gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 6960
cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 7020
tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 7080
tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 7140
ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 7200
tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 7260
gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 7320
ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 7380
tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 7440
agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 7500
aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 7560
cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt 7620
agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 7680
tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 7740
gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 7800
gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 7860
ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 7920
gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 7980
ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 8040
ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 8100
acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt 8160
gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag 8220
cggaagagcg cccaatacgc atgcttaagt 8250
<210> 11
<211> 8436
<212> DNA
<213> Artificial sequence
<400> 11
tattggtatg actggtttta agcgcaaaaa aagttgcttt ttcgtaccta ttaatgtatc 60
gttttagaaa accgactgta aaaagtacag tcggcattat ctcatattat aaaagccagt 120
cattaggcct atctgacaat tcctgaatag agttcataaa caatcctgca tgataaccat 180
cacaaacaga atgatgtacc tgtaaagata gcggtaaata tattgaatta cctttattaa 240
tgaattttcc tgctgtaata atgggtagaa ggtaattact attattattg atatttaagt 300
taaacccagt aaatgaagtc catggaataa tagaaagaga aaaagcattt tcaggtatag 360
gtgttttggg aaacaatttc cccgaaccat tatatttctc tacatcagaa aggtataaat 420
cataaaactc tttgaagtca ttctttacag gagtccaaat accagagaat gttttagata 480
caccatcaaa aattgtataa agtggctcta acttatccca ataacctaac tctccgtcgc 540
tattgtaacc agttctaaaa gctgtatttg agtttatcac ccttgtcact aagaaaataa 600
atgcagggta aaatttatat ccttcttgtt ttatgtttcg gtataaaaca ctaatatcaa 660
tttctgtggt tatactaaaa gtcgtttgtt ggttcaaata atgattaaat atctcttttc 720
tcttccaatt gtctaaatca attttattaa agttcatttg atatgcctcc taaattttta 780
tctaaagtga atttaggagg cttacttgtc tgctttcttc attagaatca atcctttttt 840
aaaagtcaat attactgtaa cataaatata tattttaaaa atatcccact ttatccaatt 900
ttcgtttgtt gaactaatgg gtgctttagt tgaagaataa aagaccacat taaaaaatgt 960
ggtcttttgt gtttttttaa aggatttgag cgtagcgaaa aatccttttc tttcttatct 1020
tgataataag ggtaactatt gccgatcgtc cattccgaca gcatcgccag tcactatggc 1080
gtgctgctag cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg 1140
ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc gattaagttg 1200
ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattcgagct 1260
cctagtcatt gttgtattca gctccttttg ccagcatttg ttgtgagagc cataggtctt 1320
ctaccttatc ctgcacatca tcaaagtttt ggtgaagaga ctgaatcatc agcgccctat 1380
cctttgtttt gatggcttga atataaagct cgtggttatc taaaatcctt gtgaagtctt 1440
catacttttc ctttaaccgt acccgcatcg ataaaagaat aaagctttcc atgacgggtt 1500
ttagattgtt ccagatcatc tgaatgtatg aatgatcaat cgctcggata atcgtttcat 1560
ggaacagcac atcttgaaat gaaaattcgt cagcatcctc atatttgatt gagactttca 1620
tcatttcaag aattttgctg agatccttaa ctaaaggctc aatgtctatt ttgacaagcc 1680
gttcaaagac aaatgtttct aatagtaacc gcacatcata aatttccgcg attttcttct 1740
cagttaaacc aattacgacc gctcccattc gttctaagcg gatgattttt tcggatgcga 1800
gtatttttag cgcttcgcga accggcgaac ggcttactga aaactcggcg gcgattgtat 1860
tttctgataa aatagtaccg ctttcaatca gacctgaaac gatccgcatt ctcagctcgt 1920
atgcgacacg aactccggtt gacgcttttg agagccattt tgcgggatac aacaggtctt 1980
tggagtctag catcccaaat gttaactcta tatatatgta tctctttttt taaattaatc 2040
ttattgattt ctattataag gatagattcc catcagaaat agtcttgact tcatgtgaca 2100
aatttcttaa ttattcgttc taaaaaaaag tttttaaggg tattaaatat ttcattttca 2160
ttgcaaaggt gacaaaaaac gagtgctttt gtcatgtttt atgggatgtt tttcaacata 2220
aaggaaataa atgaaaaact ttcggggtcg gctcatatat cggaaaaatg agtgataaag 2280
tatattcgag gagtatgtat attgattctc atttgctcgc gccgctgatt tccattgcgc 2340
ctgatgaagt cgtgctttat accgaccagc ccgagcacat gatggcaagg accattcaaa 2400
acgtatttca agagagagtg gaaatgctcc cgctgcatgc ttttacagat gcagaaatac 2460
cggtgaagca ctcggaagga tgagggccgg cagcctgtct atttaaggct gtcggtttaa 2520
aaaaaaggaa acgcgatcgt gttgattttt tggattgaac aatttataat acttgtatac 2580
aagtatactc cttaaaggag gtgaaatgta cacatgggta agggagaaga acttttcact 2640
ggagttgtcc caattcttgt tgaattagat ggtgatgtta atgggcacaa attttctgtc 2700
agtggagagg gtgaaggtga tgcaacatac ggaaaactta cccttaaatt tatttgcact 2760
actggaaagc ttcctgttcc ttggccaaca cttgtcacta ctcttactta tggtgttcaa 2820
tgcttttcaa gatacccaga tcatatgaag cggcacgact tcttcaagag cgccatgcct 2880
gagggatacg tgcaggagag gaccatcttc ttcaaggacg acgggaacta caagacacgt 2940
gctgaagtca agtttgaggg agacaccctc gtcaacagaa tcgagcttaa gggaatcgat 3000
ttcaaggagg acggaaacat cctcggccac aagttggaat acaactacaa ctcccacaac 3060
gtatacatca tggcagacaa acaaaagaat ggaatcaaag ttaacttcaa aattagacac 3120
aacattgaag atggaagcgt tcaactagca gaccattatc aacaaaatac tccaattggc 3180
gatggccctg tccttttacc agacaaccat tacctgtcca cacaatctgc cctttcgaaa 3240
gatcccaacg aaaagagaga ccacatggtc cttcttgagt ttgtaacagc tgctgggatt 3300
acacatggca tggatgaact atacaaataa ttcacgtcac gcgtccatgg agatctttgt 3360
ctgcaactga aaagtttata ccttacctgg aacaaatggt tgaaacatac gaggctaata 3420
tcggcttatt aggaatagtc cctgtactaa taaaatcagg tggatcagtt gatcagtata 3480
ttttggacga agctcggaaa gaatttggag atgacttgct taattccaca attaaattaa 3540
gggaaagaat aaagcgattt gatgttcaag gaatcacgga agaagatact catgataaag 3600
aagctctaaa actattcaat aaccttacaa tggaattgat cgaaagggtg gaaggttaat 3660
ggtacgaaaa ttaggggatc tacctagaaa gccacaaggc gataggtcaa gcttaaagaa 3720
cccttacatg gatcttacag attctgaaag taaagaaaca acagaggtta aacaaacaga 3780
accaaaaaga aaaaaagcat tgttgaaaac aatgaaagtt gatgtttcaa tccataataa 3840
gattaaatcg ctgcacgaaa ttctggcagc atccgaaggg aattcatatt acttagagga 3900
tactattgag agagctattg ataagatggt tgagacatta cctgagagcc aaaaaacttt 3960
ttatgaatat gaattaaaaa aaagaaccaa caaaggctga gacagactcc aaacgagtct 4020
gtttttttaa aaaaaatatt aggagcattg aatatatatt agagaattaa gaaagacatg 4080
ggaataaaaa tattttaaat ccagtaaaaa tatgataaga ttatttcaga atatgaagaa 4140
ctctgtttgt ttttgatgaa aaaacaaaca aaaaaaatcc acctaacgga atctcaattt 4200
aactaacagc ggccaaactg agaagttaaa tttgagaagg ggaaaaggcg gatttatact 4260
tgtatttaac tatctccatt ttaacatttt attaaacccc atacaagtga aaatcctctt 4320
ttacactgtt cctttaggtg atcgcggagg gacattatga gtgaagtaaa cctaaaagga 4380
aatacagatg aattagtgta ttatcgacag caaaccactg gaaataaaat cgccaggaag 4440
agaatcaaaa aagggaaaga agaagtttat tatgttgctg aaacggaaga gaagatatgg 4500
acagaagagc aaataaaaaa cttttcttta gacaaatttg gtacgcatat accttacata 4560
gaaggtcatt atacaatctt aaataattac ttctttgatt tttggggcta ttttttaggt 4620
gctgaaggaa ttgcgctcta tgctcaccta actcgttatg catacggcag caaagacttt 4680
tgctttccta gtctacaaac aatcgctaaa aaaatggaca agactcctgt tacagttaga 4740
ggctacttga aactgcttga aaggtacggt tttatttgga aggtaaacgt ccgtaataaa 4800
accaaggata acacagagga atccccgatt tttaagatta gacgtaaggt tcctttgctt 4860
tcagaagaac ttttaaatgg aaaccctaat attgaaattc cagatgacga ggaagcacat 4920
gtaaagaagg ctttaaaaaa ggaaaaagag ggtcttccaa aggttttgaa aaaagagcac 4980
gatgaatttg ttaaaaaaat gatggatgag tcagaaacaa ttaatattcc agaggcctta 5040
caatatgaca caatgtatga agatatactc agtaaaggag aaattcgaaa agaaatcaaa 5100
aaacaaatac ctaatcctac aacatctttt gagagtatat caatgacaac tgaagaggaa 5160
aaagtcgaca gtactttaaa aagcgaaatg caaaatcgtg tctctaagcc ttcttttgat 5220
acctggttta aaaacactaa gatcaaaatt gaaaataaaa attgtttatt acttgtaccg 5280
agtgaatttg catttgaatg gattaagaaa agatatttag aaacaattaa aacagtcctt 5340
gaagaagctg gatatgtttt cgaaaaaatc gaactaagaa aagtgcaata aactgctgaa 5400
gtatttcagc agtttttttt atttagaaat agtgaaaaaa atataatcag ggaggtatca 5460
atatttaatg agtactgatt taaatttatt tagactggaa ttaataatta acacgtagac 5520
taattaaaat ttaatgaggg ataaagagga tacaaaaata ttaatttcaa tccctattaa 5580
attttaacaa gggggggatt aaaatttaat tagaggttta tccacaagaa aagaccctaa 5640
taaaattttt actagggtta taacactgat taatttctta atgggggagg gattaaaatt 5700
taatgacaaa gaaaacaatc ttttaagaaa agcttttaaa agataataat aaaaagagct 5760
ttgcgattaa gcaaaactct ttactttttc attgacatta tcaaattcat cgatttcaaa 5820
ttgttgttgt atcataaagt taattctgtt ttgcacaacc ttttcaggaa tataaaacac 5880
atctgaggct tgttttataa actcagggtc gctaaagtca atgtaacgta gcatatgata 5940
tggtatagct tccacccaag ttagcctttc tgcttcttct gaatgttttt catatacttc 6000
catgggtatc tctaaatgat tttcctcatg tagcaaggta tgagcaaaaa gtttatggaa 6060
ttgatagttc ctctcttttt cttcaacttt tttatctaaa acaaacactt taacatctga 6120
gtcaatgtaa gcataagatg tttttccagt cataatttca atcccaaatc ttttagacag 6180
aaattctgga cgtaaatctt ttggtgaaag aattttttta tgtagcaata tatccgatac 6240
agcaccttct aaaagcgttg gtgaataggg cattttacct atctcctctc attttgtgga 6300
ataaaaatag tcatattcgt ccatctacct atcctattat cgaacagttg aactttttaa 6360
tcaaggatca gtcctttttt tcattattct taaactgtgc tcttaacttt aacaactcga 6420
tttgtttttc cagatctcga gggtaactag cctcgccgat cccgcaagag gcccggcagt 6480
caggtggcac ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac 6540
attcaaatat gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa 6600
aaaggaagag tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat 6660
tttgccttcc tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc 6720
agttgggtgc acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga 6780
gttttcgccc cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg 6840
cggtattatc ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc 6900
agaatgactt ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag 6960
taagagaatt atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc 7020
tgacaacgat cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg 7080
taactcgcct tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg 7140
acaccacgat gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac 7200
ttactctagc ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac 7260
cacttctgcg ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg 7320
agcgtgggtc tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg 7380
tagttatcta cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg 7440
agataggtgc ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac 7500
tttagattga tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg 7560
ataatctcat gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg 7620
tagaaaagat caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc 7680
aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc 7740
tttttccgaa ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt 7800
agccgtagtt aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc 7860
taatcctgtt accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact 7920
caagacgata gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac 7980
agcccagctt ggagcgaacg acctacaccg aactgagata cctacagcgt gagctatgag 8040
aaagcgccac gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg 8100
gaacaggaga gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg 8160
tcgggtttcg ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga 8220
gcctatggaa aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt 8280
ttgctcacat gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct 8340
ttgagtgagc tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg 8400
aggaagcgga agagcgccca atacgcatgc ttaagt 8436
Claims (8)
1. An inducible expression element, wherein an inducible substrate to which the element responds is gluconate; the element contains transcription regulatory protein GntR, P lytE Promoter, promoter P incorporating GntR binding sequence thrS (ii) a The P is lytE Promoter regulates transcriptional regulatory protein GntR; the promoter P incorporating the GntR binding sequence thrS The nucleotide sequence of (A) is shown as SEQ ID NO. 4; promoter P lytE And promoter P thrS The transcription direction of (1) is opposite; encoding said P lytE The nucleotide sequence of the promoter is shown as SEQ ID NO. 1; the amino acid sequence of the transcription regulatory protein GntR is shown as SEQ ID NO. 2.
2. The inducible expression element of claim 1 wherein the nucleotide sequence of the gene encoding the transcriptional regulator protein GntR is set forth as SEQ ID No. 6.
3. The inducible expression element of claim 1 or 2 wherein the transcriptional regulator protein GntR, P lytE Promoter and promoter P incorporating GntR binding sequences thrS Set on the same plasmid.
4. The inducible expression element of claim 3 wherein the plasmid comprises pHT01, pP43NMK or pSTOP 1622.
5. A genetically engineered bacterium containing the inducible expression element of any one of claims 1 to 4, wherein Bacillus subtilis is used as a host.
6. The use of the inducible expression element of any one of claims 1 to 4 in promoting expression of a protein of interest in Bacillus subtilis.
7. Use of the inducible expression element of any one of claims 1 to 4 in screening for Bacillus subtilis expressing a gene of interest.
8. The use of the genetically engineered bacteria of claim 5 for promoting the expression of a protein of interest.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910368345.5A CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910368345.5A CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110093366A CN110093366A (en) | 2019-08-06 |
| CN110093366B true CN110093366B (en) | 2022-09-27 |
Family
ID=67446817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910368345.5A Active CN110093366B (en) | 2019-05-05 | 2019-05-05 | Bacillus subtilis gluconate induction expression element and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110093366B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112961879A (en) * | 2021-02-26 | 2021-06-15 | 江南大学 | Recombinant bacillus subtilis with improved production stability of N-acetylneuraminic acid |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS61100194A (en) * | 1984-10-23 | 1986-05-19 | Mitsui Toatsu Chem Inc | Gluconic acid operon and promoter of bacillus subtilis |
-
2019
- 2019-05-05 CN CN201910368345.5A patent/CN110093366B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPS61100194A (en) * | 1984-10-23 | 1986-05-19 | Mitsui Toatsu Chem Inc | Gluconic acid operon and promoter of bacillus subtilis |
Non-Patent Citations (1)
| Title |
|---|
| 枯草芽孢杆菌葡萄糖酸操纵子突变株的构建;张西锋等;《江苏农业科学》;20121231;第40卷(第1期);第50-52页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110093366A (en) | 2019-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11875298B2 (en) | Sensor for NADP (H) and development of alcohol dehydrogenases | |
| KR102191739B1 (en) | Modified foot-and-mouth disease virus 3C protease, composition and method thereof | |
| CN111235080B (en) | Gene recombination escherichia coli and production method of 5-hydroxytryptamine | |
| CN111154707B (en) | Method for producing genetically engineered escherichia coli and melatonin | |
| CN110093366B (en) | Bacillus subtilis gluconate induction expression element and construction method thereof | |
| CN107988250B (en) | Construction method of universal chlamydomonas foreign gene expression vector | |
| CN104278031B (en) | Promoter A regulated by xanthine as well as recombinant expression vector and application of promoter A | |
| CN114480474B (en) | Construction and application of marine nannochloropsis transcription activation CRISPRa system | |
| KR101443052B1 (en) | Modified chondroitin synthase polypeptide and crystal thereof | |
| CN110499336A (en) | A method of genome pointed decoration efficiency is improved using small molecule compound | |
| CN106479928B (en) | The indigenous plasmid of one plant of resistance to resistance to high COD salt water meningitidis strains and the source bacterial strain with high salt | |
| KR101878801B1 (en) | Method of genome engineering in clostridia | |
| TW201209164A (en) | Method for enhancing production of disease-resistant usage proteins using bioreactors | |
| CN110272881B (en) | Endonuclease SpCas9 high specificity truncated variant TSpCas9-V1/V2 and application thereof | |
| CN111909914B (en) | High PAM compatibility truncated variant txCas9 of endonuclease SpCas9 and application thereof | |
| CN110241098B (en) | Truncated high-specificity variant of CRISPR nuclease SpCas9 of streptococcus pyogenes and application thereof | |
| CN106520818B (en) | A kind of method of quick covering riemerella anatipestifer missing gene | |
| CN112553237A (en) | Novel mariner transposon system, application and construction of bacillus subtilis insertion mutant library | |
| CN112662697B (en) | Chlamydomonas reinhardtii TCTN1 expression plasmid and construction method and application thereof | |
| KR101989814B1 (en) | Shuttle plasmid replicable in clostridium and escherichia coli, and recombinant microorganism having enhanced pentose metabolism and fermentation performance prepared using the same | |
| CN109136228A (en) | Application of the long-chain non-coding RNA-NKILA in bone tissue injury repair | |
| CN106636023A (en) | Method for enhancing expression intensity of zwf gene promoter | |
| CN114369593B (en) | Method for preparing chiral amine by silica-binding peptide-mediated alcohol dehydrogenase and amine dehydrogenase co-immobilization cascade reaction | |
| CN115992164A (en) | CRISPRi gene suppression system, genetically engineered bacterium containing CRISPRi gene suppression system and application of CRISPRi gene suppression system | |
| CN109136227A (en) | Application of the long-chain non-coding RNA-HOXA-AS2 in bone tissue injury repair |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |