KR100918121B1 - E. coli strain for increasing acetyl-CoA consumption and method of producing vanillin using the strain and adsorbent resin - Google Patents

Abstract

The present invention relates to a feruloyl-CoA synthase that converts ferulic acid to feruloyl-CoA, an enoyl-CoA hydratase / aldolase that converts feruloyl-CoA to vanillin, and acetyl-CoA to CoA Culturing E. coli with increased vanillin production overexpressing the citrate synthetase to be converted and E. coli of the present invention in the presence of ferulic acid; And it provides a method for producing vanillin by the conversion of ferulic acid comprising the step of recovering vanillin from the culture. According to the present invention, it is possible to increase the vanillin productivity by developing E. coli, which increases the consumption of acetyl-CoA, and also by using an adsorbent resin.

Vanillin, ferulic acid, XAD-2 resin, E. coli

Description

Escherichia coli strain that increases acetyl-COA consumption and vanillin production method using the strain and the adsorbent resin {E. coli strain for increasing acetyl-CoA consumption and method of producing vanillin using the strain and adsorbent resin}

The present invention relates to a strain that increases the acetyl-CoA consumption and vanillin production method using the strain and the adsorbent resin, and more particularly, the present invention is an E. coli increased vanillin productivity by expressing an enzyme that increases the consumption of acetyl-CoA And it relates to a method for producing vanillin by conversion of ferulic acid using the E. coli.

Vanillin (3-methoxy-4-hydroxybenzaldehyde) is one of the most widely used aromatic molecules, especially in the food, as well as pharmaceutical, beverage and fragrance industries. Moreover, vanillin has antibacterial and antioxidant properties. Today, the annual global consumption of vanillin is more than 12,000 tonnes, of which only about 50 tonnes of natural vanillin are provided by chemical synthesis. Since the demand for natural vanillin cannot be met by vanilla pod extraction, the production of vanillin using biotechnological methods has been studied as an alternative method. Natural vanillin is very expensive, ranging from US $ 1,200 / kg to US $ 4,000 / kg as opposed to synthetic $ 15 / kg synthetic vanillin. Microbial conversion of natural substances such as eugenol, isoeugenol and ferulic acid to vanillin has been studied, but ferulic acid is considered as a suitable precursor of vanillin.

Ferulic acid is the most abundant hydroxyl cinnamic acid in the plant family and is mainly in the cell wall. It is covalently bound to lignin and other biopolymers. Agricultural waste contains a high percentage of ferulic acid used for the production of vanillin. In biotransformation, ferulic acid first fcs After activation to feruloyl-CoA by a feruloyl-CoA synthase encoded by the gene, the CoA thioester is then hydrated and by the anoyl-CoA hydratase / aldolase encoded by the ech gene Cleaved with vanillin and acetyl-CoA.

Numerous microorganisms, for example Amycolatopsis sp. Strain HR167 (Achterholt et al., Appl Microbiol Biotechnol 2000 , 54 , 799-807), Delftia Ashdoborance acidovorans ) (Peng et al., Appl Environ Microbiol 2003 , 69 , 1417-1427), Bacillus subtilis (Plaggenborg et al, FEMS Microbiol Lett 2001 , 205 , 9-16), Pseudomonas putida (Plaggenborg et al, Appl. Microbiol Biotechnol 2003 , 61 , 528-535), Sphingomonas paucimobilis ) (Masai et al., Appl Environ Microbiol 2002 , 68 , 4416-4424), Streptomyces setonii (Sutherland et al., Can J Microbiol) 1983, 29, 1253-1257) and species Rhodococcus (Rhodococcus sp.) (Plaggenborg et al., Appl Microbiol Biotechnol 2006 , 72 , 745-755) has been proposed for the production of vanillin from ferulic acid. However, the produced vanillin is quickly converted to other forms or used as a carbon and energy source. Vanillin production of at least 10.0 g / L has been recorded for actinomycetes such as Amycolatopsis sp. Strain HR167 and Streptomyces setonii , but fermentation and downstream processes are costly for the microorganism. expensive. Therefore, E. coli is considered the best choice for vanillin production, because E. coli has no vanillin degradation pathway and is due to well developed fermentation and downstream processes (Kim et al., Biotechnol Bioprocess). Eng 1999 , 4 , 170-175). Since vanillin exhibits antibacterial properties, satisfactory production of vanillin has not been realized in earlier studies using metabolically engineered Escherichia coli (Yoon et al., Biotechnol) . Bioprocess Eng 2005 , 10 , 378-384; Yoon et al., Biotechnol Lett 2005 , 27 , 1829-1832).

Korean Patent Laid-Open No. 2001-0085827 discloses a method for producing vanillin and its derivatives from a carbon source, the method comprising the steps of: a) converting the carbon source to vanillic acid with a recombinant microorganism; And b) reducing vanillin acid to vanillin, but a method of preparing vanillin and its derivatives is disclosed, but is different from recombinant strains expressing enzymes that increase the consumption of acetyl-CoA of the present invention.

In the bioconversion of ferulic acid to vanillin (see FIG. 1), simultaneous production of acetyl-CoA and its intracellular accumulation along with vanillin production will cause two major problems: (1) Vanillin is secreted extracellularly, Inhibition of the reaction of feruloyl-CoA to vanillin due to intracellular accumulation of acetyl-CoA and (2) Lack of CoA for the reaction of ferulate to feruloyl-CoA due to capture of CoA as acetyl-CoA.

Therefore, it is an object of the present invention to make the best use of the extra acetyl-CoA produced during vanillin production to enhance vanillin production.

The inventors have discovered that bioconversion of high concentrations of ferulic acid to vanillin can be achieved by using E. coli and food grade adsorbent resins with increased vanillin productivity by expressing enzymes that increase the consumption of acetyl-CoA. The invention was completed.

In order to solve the above technical problem, the present invention provides E. coli with increased vanillin productivity by expressing an enzyme that increases the consumption of acetyl-CoA.

The present invention also provides a method for producing vanillin by conversion of ferulic acid using the E. coli.

To achieve the object of the present invention, the present invention provides a feruloyl-CoA synthetase that converts ferulic acid to feruloyl-CoA, an enoyl-CoA hydratase / al which converts feruloyl-CoA to vanillin E. coli with increased vanillin production and vanillin production overexpressing citrate synthase converting acetyl-CoA to CoA.

In one embodiment of the present invention, feruloyl-CoA synthetase converts ferulic acid encoded by the fcs gene (SEQ ID NO: 1) into feruloyl-CoA, and ferrule encoded by the ech gene (SEQ ID NO: 2). Escherichia coli strains comprising pTAHEF, previously prepared by the inventors, which overexpress Enoyl-CoA hydratase / aldolase that converts royl-CoA to vanillin (Yoon et al., 2005 Biotechnol Lett 27, 1829- In 1832), E. coli was produced with increased vanillin production overexpressing citrate synthase, which converts acetyl-CoA encoded by the gltA gene (SEQ ID NO: 3) to CoA. Acetyl-CoA accumulates in cells by the action of the Enoyl-CoA hydratase / aldolase, which converts feruloyl-CoA to vanillin. Acetyl-CoA accumulated in cells inhibits the reaction of feruloyl-CoA to vanillin and also prevents the lack of CoA for the reaction of ferulate to feruloyl-CoA due to the capture of CoA as acetyl-CoA. Will result.

Thus, strains have been developed that increase the acetyl-CoA consumption accumulated in cells. In a specific manner, vanillin productivity was increased by reducing acetyl-CoA accumulated in cells by overexpressing citrate synthase, which converts acetyl-CoA encoded by the gltA gene into CoA. For example, overexpressing a citrate synthetase by amplifying the gltA gene from E. coli genomic DNA using appropriate PCR primers and incorporating the amplified gltA gene into the Xba I and Pst I sites of pTAHEF to construct pTAHEF- gltA can do.

In Escherichia coli according to an embodiment of the present invention, the E. coli may be deficient in an isocitrate dehydrogenase coding gene ( icdA gene) for converting isocitrate into α-ketoglutarate. Although the glyoxylate bypass has a shorter path than the TCA cycle, the influx of acetyl-CoA into the glyoxylate bypass is twice that of the TCA cycle (1 acetyl-CoA molecule) (2 acetyl-CoA molecules). The use of glyoxylate bypasses can be accomplished by deletion of the icdA gene. Thus, in the present invention, icdA encoding isocitrate dehydrogenase By amplifying the gltA gene in a strain that lacked the gene, more flow of isocitate was induced into the glyoxylate bypass. This increased the consumption of acetyl-CoA, which in turn increased the productivity of vanillin.

An example of the E. coli of the present invention is a feruloyl-CoA synthetase that converts ferulic acid encoded by the fcs gene to feruloyl-CoA, and feruloyl-CoA encoded by the ech gene to vanillin. Isoyl-CoA hydratase / aldolase, and isosheet to overexpress citrate synthase, which converts acetyl-CoA encoded by the gltA gene to CoA, and converts isocitrate to α-ketoglutarate The mutant strain of E. coli MG1655 lacks the late dehydrogenase coding gene ( icdA gene).

In order to achieve another object of the present invention, the present invention comprises the steps of: a) culturing E. coli of the present invention in the presence of ferulic acid; And b) provides a method for producing vanillin by the conversion of ferulic acid comprising the step of recovering vanillin from the culture.

The vanillin production method of the present invention comprises culturing E. coli of the present invention in the presence of ferulic acid. The E. coli mutant strain contains a feruloyl-CoA synthase that converts ferulic acid to feruloyl-CoA, an enoyl-CoA hydratase / aldolase that converts feruloyl-CoA to vanillin, and acetyl-CoA Escherichia coli may have increased production of vanillin, which overexpresses citrate synthase converting to CoA, preferably feruloyl-CoA synthase, feruloyl-CoA converting ferulic acid to feruloyl-CoA Overexpresses Enoyl-CoA hydratase / aldolase to convert to and citrate synthetase to convert from acetyl-CoA to CoA, where isocitrate dehydrogen to convert isocitrate to α-ketoglutarate Further deletion of the enzyme coding gene ( icdA gene) may be E. coli with increased vanillin production. Preferably, feruloyl-CoA synthetase converts ferulic acid encoded by the fcs gene to feruloyl-CoA, and enoyl-CoA converts feruloyl-CoA encoded by the ech gene to vanillin. Hydratase / aldolase, and isocitrate dehydrogenase, which overexpresses citrate synthase, which converts acetyl-CoA encoded by the gltA gene to CoA, and converts isocitrate to α-ketoglutarate The coding gene ( icdA gene) is a variant of Escherichia coli MG1655 which is more deficient.

The concentration of ferulic acid added as a substrate may be 1.0-10.0 g / L, but is not limited thereto.

E. coli mutant strains of the present invention can be cultured in synthetic, semisynthetic, or complex culture media. As the culture medium, a medium consisting of a carbon source, a nitrogen source, vitamins and minerals can be used. For example, a Man-Rogosa-Sharp (MRS) liquid medium and a liquid medium with milk added can be used. The carbon source may be one selected from the group consisting of starch, glucose, sucrose, galactose, fructose, glycerol and mixtures thereof, preferably glycerol. The nitrogen source may be selected from the group consisting of ammonium sulfate, ammonium nitrate, sodium nitrate, glutamic acid, casamino acid, yeast extract, peptone, tryptone, soybean meal, and mixtures thereof. Minerals include sodium chloride, dipotassium phosphate, magnesium sulfate And mixtures thereof.

Each of the carbon source, nitrogen source and mineral in the microbial culture medium may use 10 to 100 g, 5 to 40 g and 0.5 to 4 g per liter.

Vitamins added to the conventional culture medium may be selected from the group consisting of vitamin A, vitamin B, vitamin C, vitamin D, vitamin E and mixtures thereof. The vitamin may be added to a conventional culture medium at the same time as the above-mentioned medium, such as carbon sources, nitrogen sources, minerals, or the like, to the medium prepared by sterilization.

Incubation can be carried out under conventional E. coli culture conditions, for example at about 15-45 ° C. for about 10-72 hours.

In addition, the microorganism according to the present invention may be improved or improved to have equivalent activity or better activity by conventional physicochemical mutation methods and the like known in the art.

The vanillin production method of the present invention includes recovering vanillin from the culture. Culture of the E. coli mutant strain of the present invention in the presence of ferulic acid produces vanillin by the activity of an enzyme involved in the conversion of ferulic acid to vanillin. The vanillin thus produced can be recovered from the culture using methods commonly used in the art.

In a method according to one embodiment of the invention, the culturing in step a) can be carried out in the presence of an adsorbent resin. Since vanillin converted by ferulic acid inhibits vanillin production, it is possible to increase vanillin production by adsorbing with an adsorbent resin. Preferably, the adsorbent resin is a neutral resin such as Amberlite ^™ XAD-2, Amberlite ^™ XAD-7 and Amberlite ^™ XAD-16, and more preferably Amberlite ^™ XAD-2 resin. The adsorbent resin may use Lewatit ^™ OC 1062 or OC 1064.

In the method according to an embodiment of the present invention, the concentration of the adsorbent resin may be 10-70% (w / v). This is because vanillin production efficiency decreases when the concentration of the adsorbent resin is outside the above range. Preferably, the concentration of the adsorbent resin is 40% to 60% (w / v), more preferably about 50% (w / v).

According to the present invention, it is possible to increase the vanillin productivity by developing E. coli, which increases the consumption of acetyl-CoA, and also by using an adsorbent resin.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example

Materials and methods

Bacteria Strains and Cultures

Escherichia coli ^{DH5α (F - φ80d lac ZΔM15Δ (} lac ZYA- arg F) U169 deo R rec A1 end A1 hsd R17 (r K -, m K +) pho A sup E44λ - thi -1 gyr A96 rel A1), and the MG1655 It was used for vanillin production. E. coli MG1655 Δ icdA -deficient strain was prepared according to the method of Datsenko and Wanner (Datsenko KA and Wanner BL., 2000 Proc Natl Acad Sci USA, 97 (12): 6640-6645). To replace the kanamycin gene, a selection marker gene by homologous recombination with the icdA gene, to the kanamycin gene of pKD13 plasmid (Datsenko KA and Wanner BL., 2000 Proc Natl Acad Sci USA, 97 (12): 6640-6645) PCR primers were prepared having the nucleotide sequences of the upstream and downstream ends of the icdA gene while binding. The forward primer consists of a 50bp sequence at the upstream end of the icdA gene, followed by a 20bp kanamycin gene binding sequence, and the reverse primer consists of a 20bp at the downstream end of the icdA gene followed by a 20bp kanamycin gene binding sequence. have. The gene sequence of the forward primer is 5'-GAAAGTAAAGTAGTTGTTCCGGCACAAGGCAAGAAGATCACCCTGCAAAA ATTCCGGGGATCCGTCGACC -3 '(SEQ ID NO: 4) and the gene base sequence of the reverse primer is 5'-CCAGCTGGTAGCCCCAGTCTTTAAACGCTCCTTCGGTGAACTTCATGATG-GG TGTAGGCTGCT -GCTGCTGCT Kanamycin gene binding sites are underlined. PCR reactions were carried out using oligonucleotides of SEQ ID NOs: 4 and 5 as primers and pKD13 as a template. PCR used pfu polymerase as a polymerase, and the denaturation temperature was repeated 30 times at 94 ° C, 30 seconds at annealing 55 ° C and 60 seconds at 68 ° C polymerization. PCR reaction products were separated and purified through gel elution after electrophoresis.

The purified PCR reaction product was a 200 mm cuvette with MG1655 competent cells, including pKD46 (Datsenko KA and Wanner BL., 2000 Proc Natl Acad Sci USA, 97 (12): 6640-6645). Electro transformation to 2.5 kV through 1 ml of SOC medium (2% bacto tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl ₂ , 10 mM MgSO ₄ , 20 mM glucose) Cells were grown in a shaking incubator at 37 ° C. for 1 hour, and then 500 μl of the plated medium containing kanamycin (50 μg ⁻¹ ) was incubated at 37 ° C. Colony of kanamycin-resistant plate media was confirmed by colony PCR and homologous recombination to icdA. It was confirmed whether the gene was replaced. Primers used for colony PCR were prepared to bind directly to the region immediately adjacent to the icdA gene on the E. coli MG1655 chromosome. The forward primer is 5'-CATCGGTGAACTGCGGAAGAACATC-3 '(SEQ ID NO: 6), and the reverse primer is 5'-GACCGGCCAGCCTACCCCAAAACTAC-3' (SEQ ID NO: 7). Colony PCR was repeated 30 times at denaturation 94 ℃, 60 seconds at annealing 55 ℃ and 20 seconds at 72 ℃ polymerization through Taq polymerase.

The obtained E. coli MG1655 ΔicdA- deficient strain was subjected to 2YT medium (16 g / L tryptone, 10 g / L yeast extract, and 5 g / L sodium chloride) containing ampicillin (100 μg ml ⁻¹ ) in a shake (180 rpm) bath at 37 ° C. Incubated at. Ferulic acid (Sigma-Aldrich) was dissolved in 2YT medium and a 10% (w / v) ferulic acid feed was prepared with pH adjusted to pH 7.0 with NaOH. Various concentrations of ferulic acid were added to the medium and the effects on vanillin production were tested. The obtained E. coli MG1655 ΔicdA deficient strain was used as a host cell for preparing recombinant strains in Examples 3, 4 and 5 below.

gltA Construction of vanillin plasmid containing

The gltA gene encoding citrate synthase was amplified by PCR using Pfx polymerase (Invitrogen, USA) from the genomic DNA of Escherichia coli MG1655 using the following primers: Forward primer gltA -F, 5'-GC TCTAGA GGAG ACCTTAA ATG GCTG- 3 '(SEQ ID NO: 8) and reverse primer gltA -R, 5'-G CTGCAG CA TTA ACGCTTGATATCGC- 3' (SEQ ID NO: 9). In the primer sequences, coding regions, start or stop codons, and restriction sites are shown in bold, underlined, and italics, respectively. The amplified gltA gene was subcloned into the Eco RV site of the pBluescript vector (Stratagene Co .; Alting-MeesMA and Short JM, 1989 Nucleic Acids Res. 17 (22): 9494) to construct pBgltA, and the sequence was confirmed. The gene gltA cleaved from pBgltA by Xba I and Pst I was incorporated into the Xba I and Pst I sites of pTAHEF to construct pTAHEF- gltA . Plasmid pTAHEF was constructed as described in Yoon et al., 2005 Biotechnol Lett 27, 1829-1832. Briefly, DNA fragments containing ech (SEQ ID NO: 1) and fcs (SEQ ID NO: 2) obtained from genomic DNA of Amycolatopsis sp., Strain HR167 (DSM 9991) were prepared using Nhe I and Bam HI. Was cut from pDAHEF (Yoon et al., Biotechnology and Bioprocess Engineering 2005, 10: 1-1 ) , and the Nco I and Bam HI of pTrc99A (NCBI Genbank License No. M22744: SEQ ID NO: 10 ) Introduced in situ to obtain pTAHEF (FIG. 2). 2 is a diagram illustrating a manufacturing process of a pTAHEF vector. Transformation and other standard molecular biology techniques were performed as described in Sambrook et al, 2001 Molecular Cloning, 3rd Ed. Cold spring Harbor Laboratory Press, New York.

For vanillin production XAD Application of -2 resin

XAD-2 resin was purchased from Aldrich (USA). XAD-2 resin is a polystyrene cross-linked with hydrophobic material and is in the form of beads having a size of 20 to 60 mesh and is insoluble in water. Before use, the resin was soaked in methanol to remove impurities, and then thoroughly washed with sterile distilled water to remove residual methanol. Prior to addition to the culture medium, the resin was thoroughly washed with 2YT medium. After 48 hours of incubation, the resin was separated from the spent culture medium by centrifugation and vanillin adsorbed on the resin was extracted three times with ethanol for quantification.

Vanillin and Ferulic acid  analysis

Vanillin and ferulic acid (in ethanol extracted from culture broth and XAD-2 resin) were analyzed by reversed phase HPLC analysis as described previously (Yoon et al ,, 2005 Biotechnol Bioprocess Eng 10, 378-384; and Yoon et al., 2005 Biotechnol Lett 27, 1829-1832). Briefly, vanillin and ferulic acid in culture broth were subjected to reverse phase HPLC analysis using a Symmetry C18 column (250 × 4.6 mm, 5 μm, Waters, USA) with a Sentry guard column (20 × 4.6 mm, Waters, USA). Quantification The mobile phase used 20 mM sodium acetate, solvent A of pH 6.0, and solvent B of methanol by multiphasic gradient at a flow rate of 1 mL / min. The proportion of solvent B increased from 0% (v / v) at 0 minutes to 50% (v / v) at 7 minutes, then to 45% (v / v) at 10 minutes, finally 0% (at 20 minutes) v / v). The eluted metabolite was detected at 260 nm and 40 ° C.

Example  1: for vanillin production gltA  Effect of amplification

Acetyl-CoA produced during vanillin production from ferulic acid can be converted to CoA by the gltA gene encoding citrate synthase (FIG. 1). Thus, amplification of gltA can efficiently convert acetyl-CoA to CoA, resulting in enhanced production of vanillin via feruloyl-CoA. To investigate this, the gltA gene of Escherichia coli was introduced into pTAHEF containing fcs and ech genes, thereby obtaining a pTAHEF- gltA. Vanillin production was performed using 2YT medium containing 2.0 g / L ferulic acid as precursor. The amount and rate of vanillin production were much higher in E. coli DH5α with pTAHEF- gltA compared to E. coli DH5α-pTAHEF (FIG. 3). The maximum amount of vanillin production in pTAHEF and pTAHEF- gltA was 0.92 g / L and 1.50 g / L, respectively, at 36 hours. In the case of pTAHEF- gltA , ferulic acid was consumed almost completely at 12 hours (89.4%), while in the case of pTAHEF 54.4% was consumed. This indicates that the pTAHEF- gltA strain is much faster in ferulic acid consumption than the pTAHEF strain. Of vanillin molar conversion yield (of the sugar consumed ferulic acid production mM mM% vanillin) are also compared with 62.2% non-amplifying gltA was significantly increased to 98.9% by amplifying gltA. No difference in cell growth rate was observed between the two recombinant strains. This observation suggests that amplification of the gltA gene enhances vanillin production in pTAHEF- gltA without any effect on cell growth.

Example  2: of various concentrations Ferulic acid  Production of vanillin in the presence

Various concentrations of ferulic acid were initially added to 2YT medium. Since gltA amplification promotes ferulic acid consumption and ferulic acid is believed to be limited in FIG. 3, the effect of gltA on ferulic acid concentration (limited or redundant) was investigated. Production of vanillin by E. coli DH5α with pTAHEF- gltA was higher than E. coli DH5α-pTAHEF at all ferulic acid concentrations initially added (FIG. 4). At an initial ferulic acid concentration of 3.0 g / L at 48 hours, the pTAHEF- gltA strain produced 1.98 g / L most vanillin, more than two times higher than 0.91 g / L vanillin produced by the pTAHEF strain. Vanillin production by the pTAHEF- gltA strain decreased at initial ferulic acid above and below 3.0 g / L, while vanillin production by pTAHEF was 0.72 g / L-1.02 g / L at an initial ferulic acid concentration of at least 2.0 g / L. Almost similar. The molar conversion yield of 95.0% vanillin at an initial ferulic acid concentration of 1.0 g / L was gltA Obtained by amplification, which was much higher than 69.5% of the pTAHEF strain. At other initial ferulic acid concentrations, the molar yield of the pTAHEF- gltA strain was significantly higher than that of the pTAHEF strain. Ferulic acid was almost completely depleted by the pTAHEF- gltA strain at an initial ferulic acid concentration of 3.0 g / L, while relatively high residual ferulic acid was observed in the culture in the pTAHEF strain. The results indicate that the pTAHEF- gltA strain utilizes ferulic acid more efficiently than the pTAHEF strain. There was no significant difference in cell growth between pTAHEF and pTAHEF- gltA . Gradual decrease in cell growth was observed for increased initial ferulic acid concentration. Although vanillin production by pTAHEF- gltA was higher than pTAHEF, cell growth was similar or slightly higher.

Example  3: for vanillin production TCA  Circuit and Glyoxylate  bypass( bypass)  effect

Since the increase in acetyl-CoA consumption through the TCA circuit by gltA amplification enhanced vanillin production (FIG. 4), the increase in vanillin production was investigated by allowing cells to utilize glyoxylate bypasses rather than the TCA circuit. Although the glyoxylate bypass has a shorter path than the TCA circuit, the influx of acetyl-CoA into the glyoxylate bypass is twice that of the TCA circuit (1 acetyl-CoA molecule) (2 acetyl-CoA molecule). The use of glyoxylate bypass is icdA Can be achieved by deletion of a gene. Deletion of icdA encoding isocitrate dehydrogenase will induce the flow of isocitrate into glyoxylate bypass (FIG. 1).

The MG1655 strain ( MG1655ΔicdA- pTAHEF), which lacked the icdA gene into which pTAHEF was introduced, was incubated in 2YT medium for 48 hours with an initial addition of 3.0 g / L of ferulic acid (FIG. 5). At 48 hours of culture, vanillin production showed a significant increase in vanillin production at 2.20 g / L in the icdA- deficient strain MG1655Δ icdA-pTAHEF strain compared to 0.79 g / L of the parent strain MG1655-pTAHEF.

Ferulic acid consumption was more rapidly used in icdA deficient strains with a consumption of almost 95.0% (w / v) of ferulic acid initially added at 48 hours. Cell growth of the icdA- deficient strains slightly decreased at 48 hours as OD _600nm as 4.5 compared to 5.5 of the parent strain. The decrease in cell growth of the icdA deficient strain is thought to be due to the higher concentration of vanillin inhibition by increased vanillin production.

Example  4: for vanillin production gltA  Amplification and Glyoxylate  Combination effect of the bypass

which the icdA gene having the gltA pTAHEF- deficient E. coli MG1655 - using (MG1655 △ icdA pTAHEF- gltA) investigated the effect of the combination icdA deficient and amplifying gltA for vanillin production (Fig. 6). Very interestingly, vanillin production by the icdA- deficient strain with pTAHEF- gltA in 24 hours of cultivation was 1.97 g / L, approaching 2.32 g / L, the yield at 48 hours. Therefore, 85.0% of vanillin production at approximately 48 hours was produced in 24 hours with the consumption of 87.2% of the initially added ferulic acid.

On the other hand, icdA with pTAHEF The deletion strain produced only 1.21 g / L vanillin at 24 hours, consuming 88.6% of the initially added ferulic acid as can be seen in FIG. The molar conversion yield of vanillin increased from 56.0% (FIG. 5) to 92.0% by gltA amplification at 24 hours of culture. The results strongly suggest that gltA gene amplification together with icdA gene deletion significantly increases vanillin production rate, significantly improving vanillin production during the first 24 hours of culture. The molar conversion yield at 48 hours of the MG1655ΔicdA- pTAHEF- gltA strain was 98.4%, which was markedly improved compared to other strains.

We believe that MG1655 △ icdA / pTAHEF- gltA The strain was deposited on January 2, 2008 with the Korea Institute of Biotechnology Genetic Resources Gene Bank (KCTC), an international organization under the Budapest Treaty (Accession No. KCTC 11253BP).

Example  5: XAD -2 resin vanillin production

In Figure 6, there was no further significant increase in vanillin production after 24 hours, so it was suspected that there was a restriction of ferulic acid in the icdA deficient strain with pTAHEF- gltA . However, with an increase in ferulic acid concentration, a combined inhibition of initial ferulic acid concentration and increased vanillin concentration during culture can be expected. Reduction of Vanillin (Multiple) and Ferulic Acid (Minor) Toxicity Using XAD-2 Adsorbent Resin Improved vanillin production in NTG ( N -methyl- N' -nitro- N -nitrosoguanidine) mutant strains. Therefore, vanillin production was improved using the same XAD-2 resin for icdA deficient strains with pTAHEF- gltA . XAD-2 resin is believed to adsorb vanillin from the culture medium.

the icdA deficient strain having the gltA pTAHEF- with replacement of 50% (w / v) XAD -2 resin, were grown in 2YT medium containing early ferulic acid of 10.0 g / L. The highest vanillin production of 5.20 g / L was achieved in only 24 hours by the icdA deficient strain with pTAHEF- gltA while consuming 7.59 g / L ferulic acid, after which the plateau reached without further increase in vanillin production. (FIG. 7). A molar conversion yield of 87.0% was achieved at 24 hours by the icdA deficient strain with pTAHEF- gltA with the addition of XAD-2 resin. The same strain without resin produced only 1.15 g / L vanillin, consuming 1.95 g / L ferulic acid. 10.0 g / L of free ferulic acid was very toxic to E. coli cell growth and vanillin production. When the XAD-2 resin was added, a substantial amount of 5.55 g / L of ferulic acid was adsorbed by the resin reducing the toxicity level of ferulic acid (FIG. 7C).

The concentration of free vanillin produced also did not increase significantly over time, thus reducing its toxic effect on cells because the produced vanillin was adsorbed by the resin (FIG. 7C). Therefore, reduced ferulic acid and vanillin toxicity by the resin significantly increased vanillin production. Cell growth in the presence of resin was lower than its absence. Lower cell growth was due to the adsorption of significant amounts of cells (about 70%) to the added resin. Therefore, resin cell growth will be much higher considering the amount of cells adsorbed.

1 is a schematic showing the recycling of coenzyme A (CoA) from acetyl-CoA during production of vanillin in ferulic acid linked to the TCA cycle and glyoxylate bypass in E. coli. GltA, which encodes a citrate synthetase, catalyzes the first reaction of the TCA cycle in which citrate is synthesized from acetyl-CoA to release CoA. Isocitrate lyase and malate synthase, the glyoxylate bypass enzymes encoded by aceAB , synthesize malate from isocitrate via glyoxylate. Coenzyme A is released as acetyl-CoA during the journey from glyoxylate to malate. Glyoxylate bypass induced by the deletion of icdA can cause recycling of two CoAs from two acetyl-CoAs. Genes and corresponding enzymes are as follows: fcs , feruloyl- CoA synthetase; ech , Enoyl-CoA hydratase / aldolase; gltA , citrate synthetase; icdA , isocitrate dehydrogenase; aceA , isocitrate lyase; aceB , malate synthetase.

2 is a diagram illustrating a manufacturing process of a pTAHEF vector.

3 shows the effect of the gltA gene on the production of vanillin from ferulic acid in E. coli DH5α. Cultivation was performed in 2YT medium containing 2 g / L ferulic acid at 37 ° C. for 48 hours. Filled and blank symbols indicate the presence and absence of gltA gene amplification, respectively. Circles, squares, and triangles represent the concentration of vanillin, the concentration of ferulic acid, and cell growth, respectively.

4 shows the production of vanillin from varying amounts of ferulic acid in E. coli DH5α. Cultivation was performed in 2YT medium at 37 ° C. for 48 hours. Filled and empty bars indicate the presence and absence of gltA gene amplification, respectively.

5 shows the production of vanillin from E. coli MG1655 and icdA deficient strains with pTAHEF . Cultivation was performed in 2YT medium containing 3.0 g / L ferulic acid at 37 ° C. for 48 hours. Empty and filled bars represent vanillin production at 24 and 48 hours, respectively.

6 shows the production of vanillin from a deletion strain of E. coli MG1655 and icdA with pTAHEF- gltA . Cultivation was performed in 2YT medium containing 3.0 g / L ferulic acid at 37 ° C. for 48 hours. Empty and filled bars represent vanillin production at 24 and 48 hours, respectively.

7 shows the effect of XAD-2 resin on vanillin production of icdA deficient strains with pTAHEF- gltA . Cultivation was performed in 2YT medium containing 10.0 g / L ferulic acid at 37 ° C. for 48 hours. In A and B, filled and blank symbols indicate the presence and absence of the addition of 50% (w / v) XAD-2 resin, respectively. Circles, squares and triangles represent the concentration of vanillin, the concentration of ferulic acid, and cell growth, respectively. (C) Empty + shaded, only shaded and only empty areas represent the resin adsorbed + resin nonadsorbed portions (total), resin adsorbed portions and resin nonadsorbed portions of ferulic acid and vanillin, respectively.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY <120> E. coli strain for increasing acetyl-CoA consumption and method          of producing vanillin using the strain and adsorbent resin <130> PN075382 <160> 11 <170> KopatentIn 1.71 <210> 1 <211> 864 <212> DNA <213> Amycolatopsis sp. HR167 <220> <221> misc_feature <222> (1) .. (864) <223> ech gene <400> 1 atgagcacag cggtcggcaa cgggcgggtc cggacggagc cgtggggcga gacggttctg 60 gtggagttcg acgaaggcat cgcctgggtc atgctcaacc ggccggacaa gcgcaacgcc 120 atgaacccca ccctgaacga cgagatggtg cgggtgctgg accacctgga gggcgacgac 180 cgctgccgag tgctggtgct gaccggcgcg ggcgagtcgt tctccgcggg catggacctc 240 aaggagtact tccgcgaggt cgacgccacc ggcagcaccg ccgtgcagat caaggtgcgg 300 cgggccagcg cggagtggca gtggaagcgg ctggcgaact ggagcaagcc gacgatcgcg 360 atggtcaacg gctggtgctt cggcggcgcg ttcaccccgc tggtggcctg cgacctggcc 420 ttcgccgacg aggacgcgcg gttcgggctg tccgaggtca actggggcat cccgccgggc 480 ggcgtggtca gccgggcgct ggcggcgacc gtgccgcagc gcgacgcgct gtactacatc 540 atgaccggtg agcccttcga cggcccgccg cgcgcggaga tgcgcctggt caacgaggcg 600 ctgcccgccg accggctgcg ggagcgcacc cgcgaggtgg cgctgaagct cgcgtcgatg 660 aaccaggtgg tcctgcacgc ggccaagacc gggtacaaga tcgcccagga gatgccctgg 720 gagcaggccg aggactacct ctacgccaag ctcgaccagt cccagttcgc cgacaaggcg 780 ggcgcccgcg ccaaggggct gacccagttc ctcgaccaga agtcctaccg gcccggcctg 840 agcgccttcg acccggagaa gtag 864 <210> 2 <211> 1476 <212> DNA <213> Amycolatopsis sp. HR167 <220> <221> misc_feature (222) (1) .. (1476) <223> fcs gene <400> 2 gtgcgcaacc agggtctggg ctcctggccg gtgcgccgcg ccaggatgag cccgcacgcg 60 acagccgtcc ggcacggcgg gacggcgctg acctacgccg agctgtcccg ccgcgtcgcg 120 cggctcgcca acgggctgcg ggccgccggg gtccgccccg gcgaccgggt ggcctacctc 180 gggccgaacc acccggccta cctggagacc ctgttcgcgt gcgggcaggc cggcgcggtg 240 ttcgtgccgc tgaacttccg gctgggcgtc ccggaactgg accacgcgct ggccgactcc 300 ggcgcgtcgg tccttatcca caccccggag cacgcggaga cggtcgcggc gctcgccgcc 360 ggccggctgc tgcgcgtgcc cgcgggcgag ctggacgccg cggacgacga gccgcccgac 420 ctgcccgtcg gcctcgacga cgtgtgcctg ctgatgtaca cctcgggcag caccggacgc 480 cccaagggcg cgatgctcac ccacggcaac ctcacctgga actgcgtcaa cgtcctggtg 540 gagaccgacc tggcgagcga cgagcgggca ctggtcgccg cgccgctgtt ccacgccgcc 600 gcgctcggca tggtgtgcct gcccaccctg ctcaagggcg gcacggtgat cctgcactcc 660 gcgttcgacc ccggcgccgt gctgtccgcg gtggaacagg agcgggtcac gctcgtgttc 720 ggcgtgccca cgatgtacca ggcgatcgcc gcgcacccgc ggtggcgcag cgccgacctg 780 tccagcctgc ggaccctgct gtgcggcggc gcgccggtgc ccgccgacct cgccagccgc 840 tacctcgacc gcgggctcgc gttcgtgcag ggctacggca tgaccgaggc cgcgccgggc 900 gtgctggtcc tcgaccgcgc gcacgtcgcg gagaagatcg gctccgccgg ggtgccctcg 960 ttcttcaccg acgtgcggct ggccggcccg tccggcgagc cggtgccgcc gggggagaag 1020 ggcgagatcg tggtcagcgg gcccaacgtg atgaagggct actggggcag gccggaggcg 1080 accgccgagg tgctgcgcga cgggtggttc cactccggcg acgtggccac cgtggacggc 1140 gacgggtact tccacgtcgt cgaccggctc aaggacatga tcatctccgg cggcgagaac 1200 atctacccgg ccgaggtgga gaacgagctg tacggctacc cgggtgtgga ggcgtgcgcc 1260 gtgatcggcg tgccggaccc gcgctggggc gaggtgggca aggcggtcgt cgtgcccgcc 1320 gacgggagcc gcatcgacgg cgacgagctg ctggcctggc tgcgcacccg gctggccggg 1380 tacaaggtgc ccaagtcggt cgagttcacc gaccggctgc ccacgaccgg ctccggcaag 1440 atcctcaagg gcgaggtccg ccgccgcttc ggctga 1476 <210> 3 <211> 1284 <212> DNA <213> Escherichia coli <220> <221> misc_feature (222) (1) .. (1284) <223> glt gene <400> 3 atggctgata caaaagcaaa actcaccctc aacggggata cagctgttga actggatgtg 60 ctgaaaggca cgctgggtca agatgttatt gatatccgta ctctcggttc aaaaggtgtg 120 ttcacctttg acccaggctt cacttcaacc gcatcctgcg aatctaaaat tacttttatt 180 gatggtgatg aaggtatttt gctgcaccgc ggtttcccga tcgatcagct ggcgaccgat 240 tctaactacc tggaagtttg ttacatcctg ctgaatggtg aaaaaccgac tcaggaacag 300 tatgacgaat ttaaaactac ggtgacccgt cataccatga tccacgagca gattacccgt 360 ctgttccatg ctttccgtcg cgactcgcat ccaatggcag tcatgtgtgg tattaccggc 420 gcgctggcgg cgttctatca cgactcgctg gatgttaaca atcctcgtca ccgtgaaatt 480 gccgcgttcc gcctgctgtc gaaaatgccg accatggccg cgatgtgtta caagtattcc 540 attggtcagc catttgttta cccgcgcaac gatctctcct acgccggtaa cttcctgaat 600 atgatgttct ccacgccgtg cgaaccgtat gaagttaatc cgattctgga acgtgctatg 660 gaccgtattc tgatcctgca cgctgaccat gaacagaacg cctctacctc caccgtgcgt 720 accgctggct cttcgggtgc gaacccgttt gcctgtatcg cagcaggtat tgcttcactg 780 tggggacctg cgcacggcgg tgctaacgaa gcggcgctga aaatgctgga agaaatcagc 840 tccgttaaac acattccgga atttgttcgt cgtgcgaaag acaaaaatga ttctttccgc 900 ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc cgcgcgccac cgtaatgcgt 960 gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg atgacctgct ggaagtggct 1020 atggagctgg aaaacatcgc gctgaacgac ccgtacttta tcgagaagaa actgtacccg 1080 aacgtcgatt tctactctgg tatcatcctg aaagcgatgg gtattccgtc ttccatgttc 1140 accgtcattt tcgcaatggc acgtaccgtt ggctggatcg cccactggag cgaaatgcac 1200 agtgacggta tgaagattgc ccgtccgcgt cagctgtata caggatatga aaaacgcgac 1260 tttaaaagcg atatcaagcg ttaa 1284 <210> 4 <211> 70 <212> DNA <213> Forward primer <400> 4 gaaagtaaag tagttgttcc ggcacaaggc aagaagatca ccctgcaaaa attccgggga 60 tccgtcgacc 70 <210> 5 <211> 70 <212> DNA <213> Reverse primer <400> 5 ccagctggta gccccagtct ttaaacgctc cttcggtgaa cttcatgatg tgtaggctgg 60 agctgcttcg 70 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 6 catcggtgaa ctgcggaaga acatc 25 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 7 gaccggccag cctaccccaa aactac 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Foward primer <400> 8 gctctagagg agaccttaaa tggctg 26 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 9 gctgcagcat taacgcttga tatcgc 26 <210> 10 <211> 4176 <212> DNA <213> Artificial Sequence <220> <223> pTrc99A cloning vector: Genbank Accession NO.M22744 <400> 10 gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc 60 ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc 120 gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc 180 tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga 240 taacaatttc acacaggaaa cagaccatgg aattcgagct cggtacccgg ggatcctcta 300 gagtcgacct gcaggcatgc aagcttggct gttttggcgg atgagagaag attttcagcc 360 tgatacagat taaatcagaa cgcagaagcg gtctgataaa acagaatttg cctggcggca 420 gtagcgcggt ggtcccacct gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg 480 atggtagtgt ggggtctccc catgcgagag tagggaactg ccaggcatca aataaaacga 540 aaggctcagt cgaaagactg ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc 600 ctgagtagga caaatccgcc gggagcggat ttgaacgttg cgaagcaacg gcccggaggg 660 tggcgggcag gacgcccgcc ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg 720 acggatggcc tttttgcgtt tctacaaact ctttttgttt atttttctaa atacattcaa 780 atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga 840 agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc 900 ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg 960 gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc 1020 gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat 1080 tatcccgtgt tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg 1140 acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag 1200 aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa 1260 cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc 1320 gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca 1380 cgatgcctac agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc 1440 tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc 1500 tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg 1560 ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta 1620 tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag 1680 gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga 1740 ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc 1800 tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa 1860 agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa 1920 aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc 1980 cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta gtgtagccgt 2040 agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc 2100 tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac 2160 gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca 2220 gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg 2280 ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag 2340 gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt 2400 ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat 2460 ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc 2520 acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt 2580 gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag 2640 cggaagagcg cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca 2700 tatggtgcac tctcagtaca atctgctctg atgccgcata gttaagccag tatacactcc 2760 gctatcgcta cgtgactggg tcatggctgc gccccgacac ccgccaacac ccgctgacgc 2820 gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg 2880 gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgaggc agcagatcaa 2940 ttcgcgcgcg aaggcgaagc ggcatgcatt tacgttgaca ccatcgaatg gtgcaaaacc 3000 tttcgcggta tggcatgata gcgcccggaa gagagtcaat tcagggtggt gaatgtgaaa 3060 ccagtaacgt tatacgatgt cgcagagtat gccggtgtct cttatcagac cgtttcccgc 3120 gtggtgaacc aggccagcca cgtttctgcg aaaacgcggg aaaaagtgga agcggcgatg 3180 gcggagctga attacattcc caaccgcgtg gcacaacaac tggcgggcaa acagtcgttg 3240 ctgattggcg ttgccacctc cagtctggcc ctgcacgcgc cgtcgcaaat tgtcgcggcg 3300 attaaatctc gcgccgatca actgggtgcc agcgtggtgg tgtcgatggt agaacgaagc 3360 ggcgtcgaag cctgtaaagc ggcggtgcac aatcttctcg cgcaacgcgt cagtgggctg 3420 atcattaact atccgctgga tgaccaggat gccattgctg tggaagctgc ctgcactaat 3480 gttccggcgt tatttcttga tgtctctgac cagacaccca tcaacagtat tattttctcc 3540 catgaagacg gtacgcgact gggcgtggag catctggtcg cattgggtca ccagcaaatc 3600 gcgctgttag cgggcccatt aagttctgtc tcggcgcgtc tgcgtctggc tggctggcat 3660 aaatatctca ctcgcaatca aattcagccg atagcggaac gggaaggcga ctggagtgcc 3720 atgtccggtt ttcaacaaac catgcaaatg ctgaatgagg gcatcgttcc cactgcgatg 3780 ctggttgcca acgatcagat ggcgctgggc gcaatgcgcg ccattaccga gtccgggctg 3840 cgcgttggtg cggatatctc ggtagtggga tacgacgata ccgaagacag ctcatgttat 3900 atcccgccgt caaccaccat caaacaggat tttcgcctgc tggggcaaac cagcgtggac 3960 cgcttgctgc aactctctca gggccaggcg gtgaagggca atcagctgtt gcccgtctca 4020 ctggtgaaaa gaaaaaccac cctggcgccc aatacgcaaa ccgcctctcc ccgcgcgttg 4080 gccgattcat taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg 4140 caacgcaatt aatgtgagtt agcgcgaatt gatctg 4176 <210> 11 <211> 1251 <212> DNA <213> E. coli <400> 11 atggaaagta aagtagttgt tccggcacaa ggcaagaaga tcaccctgca aaacggcaaa 60 ctcaacgttc ctgaaaatcc gattatccct tacattgaag gtgatggaat cggtgtagat 120 gtaaccccag ccatgctgaa agtggtcgac gctgcagtcg agaaagccta taaaggcgag 180 cgtaaaatct cctggatgga aatttacacc ggtgaaaaat ccacacaggt ttatggtcag 240 gacgtctggc tgcctgctga aactcttgat ctgattcgtg aatatcgcgt tgccattaaa 300 ggtccgctga ccactcctgt tggtggcggt attcgctctc tgaacgttgc cctgcgccag 360 gaactggatc tctacatctg cctgcgtccg gtacgttact atcagggcac tccaagcccg 420 gttaaacacc ctgaactgac cgatatggtt atcttccgtg aaaactcgga agacatttat 480 gcgggtatcg aatggaaagc agactctgcc gacgccgaga aagtgattaa attcctgcgt 540 gaagagatgg gggtgaagaa aattcgcttc ccggaacatt gtggtatcgg tattaagccg 600 tgttcggaag aaggcaccaa acgtctggtt cgtgcagcga tcgaatacgc aattgctaac 660 gatcgtgact ctgtgactct ggtgcacaaa ggcaacatca tgaagttcac cgaaggcgcg 720 tttaaagact ggggctacca gctggcgcgt gaagagtttg gcggtgaact gatcgacggc 780 ggcccgtggc tgaaagttaa aaacccgaac accggcaaag agatcgtcat taaagacgtg 840 attgctgatg cattcctgca acagatcctg ctgcgtccgg ctgaatatga tgttatcgcc 900 tgtatgaacc tgaacggtga ctacatttct gacgctctgg cagcgcaggt tggcggtatc 960 ggtatcgccc ctggagcaaa catcggtgac gaatgcgccc tgtttgaagc cacccacggt 1020 actgcgccga aatacgccgg tcaggacaaa gtaaaccctg gctctattat tctctccgct 1080 gagatgatgt tacgccatat gggctggact gaagccgcag acctgattgt taaaggtatg 1140 gaaggcgcaa tcaatgcgaa gaccgtaacc tatgacttcg agcgtctgat ggaaggcgct 1200 aaactgctga aatgttcaga atttggtgat gcgatcatca agaacatgta a 1251  

Claims (10)

Feruloyl-CoA synthase to convert ferulic acid to feruloyl-CoA, Enoyl-CoA hydratase / aldolase to convert feruloyl-CoA to vanillin, and sheet converting acetyl-CoA to CoA Escherichia coli , which lacks a gene encoding an isocitrate dehydrogenase ( icdA gene) that overexpresses a rate synthase and converts isocitrate to α-ketoglutarate, wherein the ferulic acid is feruloyl The fcs gene of SEQ ID NO: 2 encoding feruloyl -CoA synthetase converting to -CoA, the sequence of SEQ ID NO: 1 encoding enoyl-CoA hydratase / aldolase converting the feruloyl-CoA to vanillin ech gene, and the gltA gene of SEQ ID NO: 3 coding for citrate synthase that convert the acetyl -CoA as CoA is introduced from foreign, the conversion of isocitrate to α- Kane toggle rate doubles Of small citrate dehydrogenase is the icdA gene of SEQ ID NO: 11 encoding deletion to the E. coli (Escherichia coli). delete The Escherichia coli KCTC11253BP. a) Feruloyl-CoA synthase to convert ferulic acid to feruloyl-CoA, Enoyl-CoA hydratase / aldolase to convert feruloyl-CoA to vanillin, and acetyl-CoA to CoA Culturing E. coli with increased vanillin production overexpressing citrate synthetase in the presence of ferulic acid; And b) recovering vanillin from the culture, the method of producing vanillin by conversion of ferulic acid. The method of claim 4, wherein the culturing in step a) is carried out in the presence of an adsorbent resin. 6. The method of claim 5 wherein said adsorbent resin is a neutral resin. The method of claim 6, wherein the neutral resin is XAD-2 resin. The method of claim 5, wherein the concentration of the adsorbent resin is 10-70% (w / v). The method of claim 4, wherein the E. coli is deficient in a gene encoding an isocitrate dehydrogenase ( icdA gene) that converts isocitrate to α-ketoglutarate. The method according to claim 9, wherein the E. coli is a feruloyl-CoA synthase that converts the ferulic acid to feruloyl-CoA is encoded by the fcs gene of SEQ ID NO: 2, the feruloyl- CoA to vanillin Enoyl-CoA hydratase / aldolase to be converted is encoded by the ech gene of SEQ ID NO: 1, and the citrate synthetase to convert acetyl-CoA to CoA is encoded by the gltA gene of SEQ ID NO: 3 Isocitrate dehydrogenase for converting isocitrate to α-ketoglutarate is E. coli MG1655 variant E. coli, characterized in that encoded by the icdA gene of SEQ ID NO: 11.

Images