CN106701726A

CN106701726A - Rapeseed protein having anti-imidazolone weedicide activity, and coding gene and application thereof

Info

Publication number: CN106701726A
Application number: CN201710069290.9A
Authority: CN
Inventors: 方军; 朴钟泽; 万常照; 白建江; 杨瑞芳
Original assignee: Shanghai Academy of Agricultural Sciences
Current assignee: Shanghai Academy of Agricultural Sciences
Priority date: 2017-02-08
Filing date: 2017-02-08
Publication date: 2017-05-24

Abstract

The invention relates to a rapeseed protein having an anti-imidazolone weedicide activity, and a coding gene and application thereof. The rapeseed protein is a mutant protein of rapeseed acetohydroxyacid synthase; the amino acid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.3; and the protein derives from expression of ahas1 gene in a rapeseed genome and is obtained by performing in-vitro mutation on the rapeseed acetohydroxyacid synthase through artificial modification. The amino acid sequence has the following characteristics: compared with wild type rapeseed acetohydroxyacid synthase, the amino acid on the Ser638 site is deleted, so that the mutant protein is resistant to imidazolone weedicide, and a plant transformed by the coding gene has an anti-imidazolone weedicide activity.

Description

With anti-imidazolinone herbicide activity rape protein, its encoding gene and Using

Technical field

The invention belongs to herbicide resistant protein matter field, and in particular to it is a kind of with anti-imidazolinone herbicide activity Rape protein, its encoding gene and application.

Background technology

Rape is one of the big main oil crops of China four (other are soybean, peanut, sunflower), is China's sown area Maximum, is distributed most wide oil crops.

Due to the popularization of mechanization direct-sowing rape, influence of the weeds to yield of rape is increasing.The generation of weeds is to oil The general underproduction 20%~30% of dish yield, up to more than 50% when serious, No kernels or seeds are gathered, as in a year of scarcity for the field of most serious.Ruderal species in Rapeseed Field Class is complicated, and a class is the grassy weeds such as amur foxtail, caput grass, and another kind of is the broad leaved weeds such as chickweed, clearvers.Prevent and kill off simultaneously This two classes weeds is related to herbicide mixture problem.But, it is technical very strong that mixe herbicide needs, due to herbicide tool There are high selectivity and strong lethality, it is careless slightly to easily cause poisoning or even damage crop.And plant Atrazine resistant Brassica napus This problem can then be avoided.

The endogenous antiweed Acetohydroxyacid synthase of rape (acetohydroxy acid synthase, referred to as AHAS) protein is produced by ahas gene mutations, and it is special that expression antiweed AHAS protein can make plant obtain antiweed Property, solve the weed problem in field.AHAS protein is mainly distributed in microorganism and plant, is hardly deposited in animal Suppress herbicide to person poultry harmless in, AHAS.Therefore, excavate and study the rape AHAS protein with antiweed activity and have There is good novelty and economic worth.

At present, the method for cultivating anti-AHAS suppression herbicide rape is with rape seed or plant as material carries out chemistry Or physical mutagenesis, carry out genome mutation in plant.The test period of this method acquisition Atrazine resistant Brassica napus is long (to be more than 3 years), obtain new mutant it is difficult (mutation result is the replacement that the single base change of nucleotides causes single amino acids, easily with Mutation through existing is repeated), and chance of success is small (generally mutation success rate is less than hundred a ten thousandths), and many laboratories are carried out Research and development more than 5 years cannot obtain new mutant.

The content of the invention

It is an object of the invention to provide a kind of rape protein with anti-imidazolinone herbicide activity, its coding Gene and application, it is rape Acetohydroxyacid synthase (i.e. AHAS) mutein, and the protein has anti-imidazoline The activity of type herbicides, the plant of its encoding gene conversion has the characteristic of anti-imidazolinone herbicide.

Different from the acid substitution mutations body for being obtained by vivo mutations at present, the present invention uses amino acid deletion plan Slightly, it is mutated by outside genosome, transforms rape AHAS protein, obtain rape AHAS muteins, makes it have anti-removing Careless agent characteristic.

In order to achieve the above object, the present invention provides following technical scheme：

Rape protein with anti-imidazolinone herbicide activity, it is the mutation of rape Acetohydroxyacid synthase Body protein, its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.3.

The active protein of anti-imidazolinone herbicide of its amino acid sequence of the invention as shown in SEQ ID No.1 is Precursor full length protein, turns into mature protein, amino acid sequence such as SEQ ID after the precursor full length protein erasure signal peptide Shown in No.3.

Gene with anti-imidazolinone herbicide activity, it is that coding is described lives with anti-imidazolinone herbicide The nucleotide sequence of the rape protein of property.

Further, the nucleotide sequence is as shown in SEQ ID No.2 or SEQ ID No.4.

Rape protein with anti-imidazolinone herbicide activity of the present invention is used to cultivate anti-imidazolone type Herbicide plant.

A kind of method for obtaining anti-imidazolinone herbicide plant, including, by the rape AHAS muteins Encoding gene be transformed into plant, make plant produce with anti-imidazolinone herbicide activity rape AHAS mutant eggs White matter.

Further, the nucleotide sequence of the encoding gene is as shown in SEQ ID No.2 or SEQ ID No.4.

Further, the imidazolinone herbicide is not imazethapyr, imazamox or imazapic, but not It is limited to this several imidazolinone herbicide.

Further, the plant is rape, corn or cotton, but is not limited to this several plant.

The rape protein of antiweed of the present invention activity, it is by artificial reconstructed AHAS mutant proteins in rape Matter, comes from the expression of ahas1 genes in rape, by rape AHAS by external mutation, obtains AHAS muteins, its ammonia The characteristics of base acid sequence is：Compared with wild type rape AHAS protein, Ser638 site amino acids, the mutant protein are lacked Confrontation imidazolinone herbicide is resistant.

The encoding gene of the AHAS muteins that the present invention is obtained is transformed into plant, and table is carried out in plant Reach, make to contain rape AHAS muteins in plant, can make plant that there is the characteristic of anti-imidazolinone herbicide.

The nucleotide sequence of the encoding gene of rape AHAS muteins of the invention is not limited to rape endogenous sequence, It can be the artificial synthesized nucleotide sequence for expressing the protein.

Rape AHAS mutant is expressed in rape, corn or cotton, transgene rape R-RA1M6, transgenosis is obtained Corn M-RA1M6, transgene cotton C-RA1M6, spray anti-imidazolone type and remove in genetically modified plants and wild-type plant seedling stage Careless agent, wild-type plant plant is all dead, and genetically modified plants all survive.Illustrate expression AHAS muteins of the present invention Plant there is the characteristic of anti-imidazolinone herbicide.

Compared with prior art, the present invention has the advantages that：

1) present invention uses amino acid deletion strategy, and rite-directed mutagenesis is carried out to amino acid, can be prominent after amino acid to deleting Variant proteins carry out external antiweed determination of activity, are provided to develop more new antiweed AHAS muteins Basis, with simple to operate, screening process is simple, strong innovation the advantages of.

2) AHAS muteins of the invention are obtained by external mutation, and external mutation has designability By force, the incomparable advantage of vivo mutations such as short, strong innovation of test period, obtained the mutant time less than 2 months, meanwhile, Designed by specific mutation, it is to avoid repeated with AHAS muteins have been reported.

3) after the encoding gene of AHSA muteins of the present invention is expressed, the AHAS total length muteins of acquisition With the characteristic that AHAS no signal peptide Ripening Mutant protein is respectively provided with anti-imidazolinone herbicide.

Brief description of the drawings

Fig. 1 is the AHAS protein PAGE electrophoretograms in the embodiment of the present invention 1 after purification；

Wherein, swimming lane 1：RA1WS protein after purification；Swimming lane 2：RA1M6S protein after purification；Mk：Protein Marker, molecular weight is marked on the diagram.

Fig. 2 and Fig. 3 is RA1M6S in the embodiment of the present invention 2 and its control RA1WS to imidazolinone herbicide (imidazoles second Nicotinic acid and imazamox) resistance curve map.

Specific embodiment

Below in conjunction with specific embodiment, the invention will be further described.

In following examples, unless otherwise specified for《Molecular Cloning:A Laboratory guide》(Science Press, 2002) is remembered Support method.

Primer synthesizes and sequencing student on commission's work Shanghai bioengineering limited company is carried out, and reagent, bacterial strain, carrier etc. are real Articles for use are tested to be bought from Hangzhou biotech company of Sigma.

Imidazoles cigarette acetic acid herbicide is " beans agree " that Shandong first reaches company, and diluted concentration is 200 times of dilution.Methyl miaow grass Cigarette herbicide is " hundred ridges lead to " of BASF Aktiengesellschaft, and diluted concentration is 1000 times of dilution.Imazamox herbicide is U.S. " the golden beans " of cyanamide company of state, diluted concentration is 100 times of dilution.

Embodiment 1 obtains the endogenous acetolactate synthestase mutein of rape, comprises the following steps：

1. the ahas1 genes for deleting Ser638 site amino acids are built

1) by the method for many Polymerization chain reactions (PCR), from rape because amplifying ahas1 genes (NCBI sequences in group Number：Z11524).

Wherein, entering the performing PCR primer that uses of reaction is：

BN A1F：5’ctaaccatggcggcggcaacatcgtc；

BN A1EcoR：5’gaattctcagtacttagtgcgaccatcccctt.

PCR reaction systems are：The μ l of 2 × exo+ polymerase premixed liquid 50, the μ l of primer BN A1F (10 μM) 4, primer BN The μ l of A1EcoR (10 μM) 4, the μ l of wild type rapeseed gene group DNA 1 and the μ l of deionized water 41, cumulative volume are 100 μ l.

PCR programs：A) 95 DEG C, 10 minutes；B) 95 DEG C, 40 seconds；C) 52 DEG C, 40 seconds；D) 68 DEG C, 2 minutes；E) circulation step 2-4,25 times；F) 68 DEG C, 10 minutes；G) 16 DEG C, preserve.

2) separated by agarose electrophoresis, be purified into step 1) PCR primer, i.e. PCR primer carries out T by ahas1 genes Clone (pGEMT, Promega companies of the U.S.), obtains clone T-RA1W.

3) with T-RA1W as template, enter performing PCR using primer TA A1629SF and TA A1629SR and react, by PCR primer T clones are carried out, the mutant clone T-RA1M6 for deleting Ser638 amino acid is obtained.

Wherein, in PCR reaction systems and program, other conditions and step 1 outside removing template and primer) it is identical.

The particular sequence of primer is：

TA A1629SF：5’cacgtgctgcctatgatcccaggtggtgcttttaaggacatg；

TA A1629SR：5’catgtccttaaaagcaccacctgggatcataggcagcacgtg.

Wherein, as shown in SEQ ID NO.2, amino acid sequence is as shown in SEQ ID NO.1 for the DNA sequence dna of RA1M6.

2. express, purify the AHAS mature proteins of erasure signal peptide

(1) with T-RA1W as template, enter performing PCR using primer BN A1BamF and BN A1EcoR and react, PCR primer is entered Row T is cloned, and obtains the wild type T-RA1WS of erasure signal peptide.

Wherein, in PCR reaction systems and program, other conditions and above-mentioned steps 1 outside removing template and primer) identical, primer Particular sequence be：

BN A1BamF：5’ggatccacaatgactttcgtctcccgctacgctc；

BN A1EcoR：5’gaattctcagtacttagtgcgaccatcccctt.

(2) protein expression vector is built, RA1WS is cloned into pGEX4T2 (GE Life Sciences of the U.S.), obtain table Up to the carrier 4T2-RA1WS of the AHAS wild-type proteins of no signal peptide.

(3) carrier for expressing the AHAS wild-type proteins of no signal peptide is transferred in expression bacterial strain Rosetta, culture, Centrifugation is obtained supernatant by GST posts by harvesting, ultrasonic disruption cell, cleans GST posts, and final wash-out obtains ripe Wild-type protein RA1WS.

Similarly, using with above-mentioned steps (1) to the same method of step (3), to delete the T- of Ser638 site amino acids RA1M6 genes are template, with primer BN A1Bam and BN A1EcoR as primer, enter performing PCR reaction, T clones, construction expression load Body 4T2-RA1M6S, expression vector 4T2-RA1M6S is transferred in expression bacterial strain Rosetta and is expressed, obtain no signal peptide and And delete Ser638 amino acid ripe AHAS muteins RA1M6S, its amino acid sequence as shown in SEQ ID NO.3, DNA sequence dna is as shown in SEQ ID NO.4.

The AHAS muteins RA1M6S of the wild-type protein RA1WS of acquisition and maturation is carried out into SDS-PAGE electricity Swimming detection, protein adhesive is referring to Fig. 1.

As seen from Figure 1, the RA1M6S protein in the RA1WS and swimming lane 2 in swimming lane 1 has obvious bar in 90kDa positions Band, this position is consistent with the theoretical size of protein.Additionally, the protein band accounts for master in the protein band of whole swimming lane Ratio is wanted, illustrates to obtain the rape AHAS mutant proteins of the ripe rape AHAS wild-type proteins of high-purity and maturation Matter.

Embodiment 2 detects the resistance of AHAS mutant protein confrontation herbicides

The wild-type protein RA1WS and mutein RA1M6S for being obtained with embodiment 1 respectively are detection main body, water Be blank treatment, with concentration 0-100 μM different cultivars herbicide (imidazoles cigarette acetic acid and imazamox) for influence Factor, carries out antiweed biologicall test.

Solution reaction system is configured in the centrifuge tube of 2mL：450 μ l AHAS determination of activity buffer solutions, 10 μ lAHAS albumen Matter (RA1WS or RA1M6S, 0.5 μ g/ μ l), 40 μ l influence factors solution (being blank treatment with water), the μ l of cumulative volume 500.

AHAS determination of activity buffer solutions：100mM Sodium Pyruvates, 10mM magnesium chlorides, 1mM TPP, 50 μM of FAD, 50mM phosphoric acid Salt, pH7.4.

Response procedures：Centrifuge tube containing different affecting factors reaction system is placed in into 37 DEG C to react 1 hour；20μl 30% sulfuric acid terminating reaction.60 DEG C are reacted 0.5 hour；Add the alpha-Naphthols of 250 μ l 1.7%, 0.17% creatine, 60 DEG C of colour developings 0.5 Hour.200 μ l are taken out from centrifuge tube, solution of the detection containing different affecting factors is in 525nm absorbances.

Testing result：Take herbicide concentration as the wild-type protein RA1WS treatment of 0 (influence factor solution is compareed for water) 525nm absorbances be 100% activity, calculate activity under the conditions of different affecting factors of wild type and mutein Ratio, draws curve map, as a result referring to Fig. 2-Fig. 3.

From Fig. 2-Fig. 3, with the increase of imidazolinone herbicide, RA1WS activity is reduced to 0；And RA1M6S lives Property still remained close in high concentration herbicide 100% activity.

Therefore, the RA1M6S that the present invention is obtained is resistant to imidazolinone herbicide.

Conversion and expression of the rape ahas1 mutant genes of embodiment 3 in plant

1. the Expression element of AHAS muteins is built

In order to express AHAS muteins in unifacial leaf and dicotyledon, with pCambia1300 carriers (referred to as 1300) it is carrier, AHAS Expression elements is built with capsicum mottle virus 35S (abbreviation 35S) promoter and terminator, 35S starts The DNA sequence dna of son and terminator is shown in http://www.snapgene.com/resources/plasmid_files/plant_ Vectors/pCAMBIA1300/, comprises the following steps that：

(1) with embodiment 1 obtain T-RA1M6 as template, using primer BN A1BamF and BN A1SacR, by PCR With BamH1/Sac1 double digestions, ahas1 mutant fragments RA1M6T is obtained；

Wherein, primer sequence is：

BN A1BamF：5’ggatccacaatgactttcgtctcccgctacgctc；

BN A1SacR：5’gagctctcagtacttagtgcgaccatcccctt.

(2) it is template with 1300 carriers, it is double by PCR and BamH1/Hind3 using primer 35S-Hind and 35S-Bam Digestion, obtains promoter fragment 35S；

Wherein, primer sequence is：

35S-Hind：5’gcgaagcttcatggagtcaaagattcaaa；

35S-Bam：5’gtgggatccagtcccccgtgttctctccaaatgaa.

(3) it is template with 1300 carriers, using primer ter-Sac and ter-Kpn, by the double enzymes of PCR and BamH1/Hind3 Cut, obtain and terminate sub-piece ter；

Wherein, primer sequence is：

ter-Sac：5’gtggagctcagtagatgccgaccggatctgt；

ter-Kpn：5’cagggtacccgccgaattaattcggggga.

(4) HindIII/SacI double digestions are carried out by 1300, obtains fragment 1300HS, be attached with 35S and RA1M6T, Clone, obtains 1300-35S-RA1M6.

(5) 1300-35S-RA1M6 is carried out into SacI/KpnI double digestions, is connected with ter, cloned, obtain expression rape The carrier 1300-RA1M6 of AHAS mutant.

(6) carrier 1300-RA1M6 is transferred in agrobacterium strains LBA4044, obtains expression AHAS muteins Plant transformation Agrobacterium.

2. the plant of expression AHAS muteins is obtained

The preparation method of genetically modified plants is existing mature technology, and genetically modified plants preparation commission Shanghai is rich to pray biotechnology Co., Ltd is carried out.

Carrier 1300-RA1M6 is transferred in rape, corn and cotton respectively using agrobacterium-mediated transformation, obtains transgenosis Rape R-RA1M6, transgenic corns M-RA1M6, transgene cotton C-RA1M6.

In the genetically modified plants transgene rape R-RA1M6, transgenic corns M-RA1M6, the transgene cotton C- that obtain The seedling stage spray herbicide of RA1M6 and correspondence wild-type plant, after ten days, counts the death rate, as a result referring to table 1.

Table 1

As shown in Table 1, wild-type plant plant is all dead, and genetically modified plants all survive, and illustrates the expression present invention The plant of rape AHAS muteins has anti-imidazolinone herbicide activity.

<110>Academy of Agricultural Sciences, Shanghai City

<120>Rape protein, its encoding gene and application with anti-imidazolinone herbicide activity

<130> 1711036

<160> 4

<170> PatentIn version 3.5

<210> SEQ ID NO.1

<211> 654

<212> PRT

<213>Rape（Brassica napus）

<400> 1

Met Ala Ala Ala Thr Ser Ser Ser Pro Ile Ser Leu Thr Ala Lys Pro

1 5 10 15

Ser Ser Lys Ser Pro Leu Pro Ile Ser Arg Phe Ser Leu Pro Phe Ser

20 25 30

Leu Thr Pro Gln Lys Asp Ser Ser Arg Leu His Arg Pro Leu Ala Ile

35 40 45

Ser Ala Val Leu Asn Ser Pro Val Asn Val Ala Pro Pro Ser Pro Glu

50 55 60

Lys Thr Asp Lys Asn Lys Thr Phe Val Ser Arg Tyr Ala Pro Asp Glu

65 70 75 80

Pro Arg Lys Gly Ala Asp Ile Leu Val Glu Ala Leu Glu Arg Gln Gly

85 90 95

Val Glu Thr Val Phe Ala Tyr Pro Gly Gly Ala Ser Met Glu Ile His

100 105 110

Gln Ala Leu Thr Arg Ser Ser Thr Ile Arg Asn Val Leu Pro Arg His

115 120 125

Glu Gln Gly Gly Val Phe Ala Ala Glu Gly Tyr Ala Arg Ser Ser Gly

130 135 140

Lys Pro Gly Ile Cys Ile Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu

145 150 155 160

Val Ser Gly Leu Ala Asp Ala Met Leu Asp Ser Val Pro Leu Val Ala

165 170 175

Ile Thr Gly Gln Val Pro Arg Arg Met Ile Gly Thr Asp Ala Phe Gln

180 185 190

Glu Thr Pro Ile Val Glu Val Thr Arg Ser Ile Thr Lys His Asn Tyr

195 200 205

Leu Val Met Asp Val Asp Asp Ile Pro Arg Ile Val Gln Glu Ala Phe

210 215 220

Phe Leu Ala Thr Ser Gly Arg Pro Gly Pro Val Leu Val Asp Val Pro

225 230 235 240

Lys Asp Ile Gln Gln Gln Leu Ala Ile Pro Asn Trp Asp Gln Pro Met

245 250 255

Arg Leu Pro Gly Tyr Met Ser Arg Leu Pro Gln Pro Pro Glu Val Ser

260 265 270

Gln Leu Gly Gln Ile Val Arg Leu Ile Ser Glu Ser Lys Arg Pro Val

275 280 285

Leu Tyr Val Gly Gly Gly Ser Leu Asn Ser Ser Glu Glu Leu Gly Arg

290 295 300

Phe Val Glu Leu Thr Gly Ile Pro Val Ala Ser Thr Leu Met Gly Leu

305 310 315 320

Gly Ser Tyr Pro Cys Asn Asp Glu Leu Ser Leu Gln Met Leu Gly Met

325 330 335

His Gly Thr Val Tyr Ala Asn Tyr Ala Val Glu His Ser Asp Leu Leu

340 345 350

Leu Ala Phe Gly Val Arg Phe Asp Asp Arg Val Thr Gly Lys Leu Glu

355 360 365

Ala Phe Ala Ser Arg Ala Lys Ile Val His Ile Asp Ile Asp Ser Ala

370 375 380

Glu Ile Gly Lys Asn Lys Thr Pro His Val Ser Val Cys Gly Asp Val

385 390 395 400

Lys Leu Ala Leu Gln Gly Met Asn Lys Val Leu Glu Asn Arg Ala Glu

405 410 415

Glu Leu Lys Leu Asp Phe Gly Val Trp Arg Ser Glu Leu Ser Glu Gln

420 425 430

Lys Gln Lys Phe Pro Leu Ser Phe Lys Thr Phe Gly Glu Ala Ile Pro

435 440 445

Pro Gln Tyr Ala Ile Gln Ile Leu Asp Glu Leu Thr Glu Gly Lys Ala

450 455 460

Ile Ile Ser Thr Gly Val Gly Gln His Gln Met Trp Ala Ala Gln Phe

465 470 475 480

Tyr Lys Tyr Arg Lys Pro Arg Gln Trp Leu Ser Ser Ser Gly Leu Gly

485 490 495

Ala Met Gly Phe Gly Leu Pro Ala Ala Ile Gly Ala Ser Val Ala Asn

500 505 510

Pro Asp Ala Ile Val Val Asp Ile Asp Gly Asp Gly Ser Phe Ile Met

515 520 525

Asn Val Gln Glu Leu Ala Thr Ile Arg Val Glu Asn Leu Pro Val Lys

530 535 540

Ile Leu Leu Leu Asn Asn Gln His Leu Gly Met Val Met Gln Trp Glu

545 550 555 560

Asp Arg Phe Tyr Lys Ala Asn Arg Ala His Thr Tyr Leu Gly Asp Pro

565 570 575

Ala Arg Glu Asn Glu Ile Phe Pro Asn Met Leu Gln Phe Ala Gly Ala

580 585 590

Cys Gly Ile Pro Ala Ala Arg Val Thr Lys Lys Glu Glu Leu Arg Glu

595 600 605

Ala Ile Gln Thr Met Leu Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val

610 615 620

Ile Cys Pro His Gln Glu His Val Leu Pro Met Ile Pro Gly Gly Thr

625 630 635 640

Phe Lys Asp Val Ile Thr Glu Gly Asp Gly Arg Thr Lys Tyr

645 650

<210> SEQ ID NO.2

<211> 1965

<212> DNA

<213>Rape（Brassica napus）

<400> 2

atggcggcgg caacatcgtc ttctccgatc tccttaaccg ctaaaccttc ttccaaatcc 60

cctctaccca tttccagatt ctcccttccc ttctccttaa ccccacagaa agactcctcc 120

cgtctccacc gtcctctcgc catctccgcc gttctcaact cacccgtcaa tgtcgcacct 180

ccttcccctg aaaaaaccga caagaacaag actttcgtct cccgctacgc tcccgacgag 240

ccccgcaagg gtgctgatat cctcgtcgaa gccctcgagc gtcaaggcgt cgaaaccgtc 300

tttgcttatc ccggaggtgc ttccatggag atccaccaag ccttgactcg ctcctccacc 360

atccgtaacg tccttccccg tcacgaacaa ggaggagtct tcgccgccga gggttacgct 420

cgttcctccg gcaaaccggg aatctgcata gccacttcgg gtcccggagc taccaacctc 480

gtcagcgggt tagcagacgc gatgcttgac agtgttcctc ttgtcgccat tacaggacag 540

gtccctcgcc ggatgatcgg tactgacgcc ttccaagaga caccaatcgt tgaggtaacg 600

aggtctatta cgaaacataa ctatttggtg atggatgttg atgacatacc taggatcgtt 660

caagaagctt tctttctagc tacttccggt agacccggac cggttttggt tgatgttcct 720

aaggatattc agcagcagct tgcgattcct aactgggatc aacctatgcg cttacctggc 780

tacatgtcta ggttgcctca gcctccggaa gtttctcagt taggtcagat cgttaggttg 840

atctcggagt ctaagaggcc tgttttgtac gttggtggtg gaagcttgaa ctcgagtgaa 900

gaactgggga gatttgtcga gcttactggg atccccgttg cgagtacttt gatggggctt 960

ggctcttatc cttgtaacga tgagttgtcc ctgcagatgc ttggcatgca cgggactgtg 1020

tatgctaact acgctgtgga gcatagtgat ttgttgctgg cgtttggtgt taggtttgat 1080

gaccgtgtca cgggaaagct cgaggctttc gctagcaggg ctaaaattgt gcacatagac 1140

attgattctg ctgagattgg gaagaataag acacctcacg tgtctgtgtg tggtgatgta 1200

aagctggctt tgcaagggat gaacaaggtt cttgagaacc gggcggagga gctcaagctt 1260

gatttcggtg tttggaggag tgagttgagc gagcagaaac agaagttccc tttgagcttc 1320

aaaacgtttg gagaagccat tcctccgcag tacgcgattc agatcctcga cgagctaacc 1380

gaagggaagg caattatcag tactggtgtt ggacagcatc agatgtgggc ggcgcagttt 1440

tacaagtaca ggaagccgag acagtggctg tcgtcatcag gcctcggagc tatgggtttt 1500

ggacttcctg ctgcgattgg agcgtctgtg gcgaaccctg atgcgattgt tgtggatatt 1560

gacggtgatg gaagcttcat aatgaacgtt caagagctgg ccacaatccg tgtagagaat 1620

cttcctgtga agatactctt gttaaacaac cagcatcttg ggatggtcat gcaatgggaa 1680

gatcggttct acaaagctaa cagagctcac acttatctcg gggacccggc aagggagaac 1740

gagatcttcc ctaacatgct gcagtttgca ggagcttgcg ggattccagc tgcgagagtg 1800

acgaagaaag aagaactccg agaagctatt cagacaatgc tggatacacc aggaccatac 1860

ctgttggatg tgatatgtcc gcaccaagaa catgtgttac cgatgatccc aggtggcact 1920

ttcaaagatg taataacaga aggggatggt cgcactaagt actga 1965

<210> SEQ ID NO.3

<211> 584

<212> PRT

<213>Rape（Brassica napus）

<400> 3

Thr Phe Val Ser Arg Tyr Ala Pro Asp Glu Pro Arg Lys Gly Ala Asp

1 5 10 15

Ile Leu Val Glu Ala Leu Glu Arg Gln Gly Val Glu Thr Val Phe Ala

20 25 30

Tyr Pro Gly Gly Ala Ser Met Glu Ile His Gln Ala Leu Thr Arg Ser

35 40 45

Ser Thr Ile Arg Asn Val Leu Pro Arg His Glu Gln Gly Gly Val Phe

50 55 60

Ala Ala Glu Gly Tyr Ala Arg Ser Ser Gly Lys Pro Gly Ile Cys Ile

65 70 75 80

Ala Thr Ser Gly Pro Gly Ala Thr Asn Leu Val Ser Gly Leu Ala Asp

85 90 95

Ala Met Leu Asp Ser Val Pro Leu Val Ala Ile Thr Gly Gln Val Pro

100 105 110

Arg Arg Met Ile Gly Thr Asp Ala Phe Gln Glu Thr Pro Ile Val Glu

115 120 125

Val Thr Arg Ser Ile Thr Lys His Asn Tyr Leu Val Met Asp Val Asp

130 135 140

Asp Ile Pro Arg Ile Val Gln Glu Ala Phe Phe Leu Ala Thr Ser Gly

145 150 155 160

Arg Pro Gly Pro Val Leu Val Asp Val Pro Lys Asp Ile Gln Gln Gln

165 170 175

Leu Ala Ile Pro Asn Trp Asp Gln Pro Met Arg Leu Pro Gly Tyr Met

180 185 190

Ser Arg Leu Pro Gln Pro Pro Glu Val Ser Gln Leu Gly Gln Ile Val

195 200 205

Arg Leu Ile Ser Glu Ser Lys Arg Pro Val Leu Tyr Val Gly Gly Gly

210 215 220

Ser Leu Asn Ser Ser Glu Glu Leu Gly Arg Phe Val Glu Leu Thr Gly

225 230 235 240

Ile Pro Val Ala Ser Thr Leu Met Gly Leu Gly Ser Tyr Pro Cys Asn

245 250 255

Asp Glu Leu Ser Leu Gln Met Leu Gly Met His Gly Thr Val Tyr Ala

260 265 270

Asn Tyr Ala Val Glu His Ser Asp Leu Leu Leu Ala Phe Gly Val Arg

275 280 285

Phe Asp Asp Arg Val Thr Gly Lys Leu Glu Ala Phe Ala Ser Arg Ala

290 295 300

Lys Ile Val His Ile Asp Ile Asp Ser Ala Glu Ile Gly Lys Asn Lys

305 310 315 320

Thr Pro His Val Ser Val Cys Gly Asp Val Lys Leu Ala Leu Gln Gly

325 330 335

Met Asn Lys Val Leu Glu Asn Arg Ala Glu Glu Leu Lys Leu Asp Phe

340 345 350

Gly Val Trp Arg Ser Glu Leu Ser Glu Gln Lys Gln Lys Phe Pro Leu

355 360 365

Ser Phe Lys Thr Phe Gly Glu Ala Ile Pro Pro Gln Tyr Ala Ile Gln

370 375 380

Ile Leu Asp Glu Leu Thr Glu Gly Lys Ala Ile Ile Ser Thr Gly Val

385 390 395 400

Gly Gln His Gln Met Trp Ala Ala Gln Phe Tyr Lys Tyr Arg Lys Pro

405 410 415

Arg Gln Trp Leu Ser Ser Ser Gly Leu Gly Ala Met Gly Phe Gly Leu

420 425 430

Pro Ala Ala Ile Gly Ala Ser Val Ala Asn Pro Asp Ala Ile Val Val

435 440 445

Asp Ile Asp Gly Asp Gly Ser Phe Ile Met Asn Val Gln Glu Leu Ala

450 455 460

Thr Ile Arg Val Glu Asn Leu Pro Val Lys Ile Leu Leu Leu Asn Asn

465 470 475 480

Gln His Leu Gly Met Val Met Gln Trp Glu Asp Arg Phe Tyr Lys Ala

485 490 495

Asn Arg Ala His Thr Tyr Leu Gly Asp Pro Ala Arg Glu Asn Glu Ile

500 505 510

Phe Pro Asn Met Leu Gln Phe Ala Gly Ala Cys Gly Ile Pro Ala Ala

515 520 525

Arg Val Thr Lys Lys Glu Glu Leu Arg Glu Ala Ile Gln Thr Met Leu

530 535 540

Asp Thr Pro Gly Pro Tyr Leu Leu Asp Val Ile Cys Pro His Gln Glu

545 550 555 560

His Val Leu Pro Met Ile Pro Gly Gly Thr Phe Lys Asp Val Ile Thr

565 570 575

Glu Gly Asp Gly Arg Thr Lys Tyr

580

<210> SEQ ID NO.4

<211> 1755

<212> DNA

<213>Rape（Brassica napus）

<400> 4

actttcgtct cccgctacgc tcccgacgag ccccgcaagg gtgctgatat cctcgtcgaa 60

gccctcgagc gtcaaggcgt cgaaaccgtc tttgcttatc ccggaggtgc ttccatggag 120

atccaccaag ccttgactcg ctcctccacc atccgtaacg tccttccccg tcacgaacaa 180

ggaggagtct tcgccgccga gggttacgct cgttcctccg gcaaaccggg aatctgcata 240

gccacttcgg gtcccggagc taccaacctc gtcagcgggt tagcagacgc gatgcttgac 300

agtgttcctc ttgtcgccat tacaggacag gtccctcgcc ggatgatcgg tactgacgcc 360

ttccaagaga caccaatcgt tgaggtaacg aggtctatta cgaaacataa ctatttggtg 420

atggatgttg atgacatacc taggatcgtt caagaagctt tctttctagc tacttccggt 480

agacccggac cggttttggt tgatgttcct aaggatattc agcagcagct tgcgattcct 540

aactgggatc aacctatgcg cttacctggc tacatgtcta ggttgcctca gcctccggaa 600

gtttctcagt taggtcagat cgttaggttg atctcggagt ctaagaggcc tgttttgtac 660

gttggtggtg gaagcttgaa ctcgagtgaa gaactgggga gatttgtcga gcttactggg 720

atccccgttg cgagtacttt gatggggctt ggctcttatc cttgtaacga tgagttgtcc 780

ctgcagatgc ttggcatgca cgggactgtg tatgctaact acgctgtgga gcatagtgat 840

ttgttgctgg cgtttggtgt taggtttgat gaccgtgtca cgggaaagct cgaggctttc 900

gctagcaggg ctaaaattgt gcacatagac attgattctg ctgagattgg gaagaataag 960

acacctcacg tgtctgtgtg tggtgatgta aagctggctt tgcaagggat gaacaaggtt 1020

cttgagaacc gggcggagga gctcaagctt gatttcggtg tttggaggag tgagttgagc 1080

gagcagaaac agaagttccc tttgagcttc aaaacgtttg gagaagccat tcctccgcag 1140

tacgcgattc agatcctcga cgagctaacc gaagggaagg caattatcag tactggtgtt 1200

ggacagcatc agatgtgggc ggcgcagttt tacaagtaca ggaagccgag acagtggctg 1260

tcgtcatcag gcctcggagc tatgggtttt ggacttcctg ctgcgattgg agcgtctgtg 1320

gcgaaccctg atgcgattgt tgtggatatt gacggtgatg gaagcttcat aatgaacgtt 1380

caagagctgg ccacaatccg tgtagagaat cttcctgtga agatactctt gttaaacaac 1440

cagcatcttg ggatggtcat gcaatgggaa gatcggttct acaaagctaa cagagctcac 1500

acttatctcg gggacccggc aagggagaac gagatcttcc ctaacatgct gcagtttgca 1560

ggagcttgcg ggattccagc tgcgagagtg acgaagaaag aagaactccg agaagctatt 1620

cagacaatgc tggatacacc aggaccatac ctgttggatg tgatatgtcc gcaccaagaa 1680

catgtgttac cgatgatccc aggtggcact ttcaaagatg taataacaga aggggatggt 1740

cgcactaagt actga 1755

Claims

1. there is the rape protein of anti-imidazolinone herbicide activity, it is the mutant of rape Acetohydroxyacid synthase Protein, its amino acid sequence is as shown in SEQ ID No.1 or SEQ ID No.3.

2. there is the gene of anti-imidazolinone herbicide activity, it is the nucleosides for encoding rape protein described in claim 1 Acid sequence.

3. there is the gene of anti-imidazolinone herbicide activity as claimed in claim 2, it is characterised in that the nucleotides Sequence is as shown in SEQ ID No.2 or SEQ ID No.4.

4. as the rape protein that claim 1 has anti-imidazolinone herbicide activity is removed for cultivating anti-imidazolone type Careless agent plant.

5. a kind of method for obtaining anti-imidazolinone herbicide plant, including, by the volume of rape protein described in claim 1 Code genetic transformation produces the rape acetohydroxy acid with anti-imidazolinone herbicide activity to close in plant, making the plant Into the mutein of enzyme.

6. the method for obtaining anti-imidazolinone herbicide plant according to claim 5, it is characterised in that the coding base The nucleotide sequence of cause is as shown in SEQ ID No.2 or SEQ ID No.4.

7. the method for obtaining anti-imidazolinone herbicide plant according to claim 5, it is characterised in that the imidazoline Type herbicides are at least one in imazethapyr, imazamox and imazapic.

8. the method that anti-imidazolinone herbicide plant is obtained according to claim any one of 5-7, it is characterised in that institute Plant is stated for rape, corn or cotton.