CN102766697A - Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape - Google Patents
Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape Download PDFInfo
- Publication number
- CN102766697A CN102766697A CN2012102910680A CN201210291068A CN102766697A CN 102766697 A CN102766697 A CN 102766697A CN 2012102910680 A CN2012102910680 A CN 2012102910680A CN 201210291068 A CN201210291068 A CN 201210291068A CN 102766697 A CN102766697 A CN 102766697A
- Authority
- CN
- China
- Prior art keywords
- gene
- bnals1r
- ap15f
- primer
- rape
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a three-primer molecular marking method for detecting an imidazolone herbicide resisting gene of cabbage type rape and belongs to the field of plant molecular breeding. Primer pairs of AP15F/AP18R and AP15F/AP19R are added into two polymerase chain reaction (PCR) reaction systems respectively to subject cabbage type rape deoxyribonucleic acid (DNA) to amplification, and homozygote free of resistance gene BnALS1R, homozygote containing resistance gene BnALS1R and heterozygote containing resistance gene BnALS1R are distinguished. By means of the method, whether rapeseed germplasm resources or breeding population of the rape contain the imidazolone herbicide resisting gene BnALS1R or not can be rapidly and accurately detected, whether the contained herbicide gene is the homozygote or the heterozygote can be accurately distinguished, the selection efficiency of the resistance gene BnALS1R can be improved, and the breeding process of imidazolone herbicide resisting rape breeds can be accelerated.
Description
Technical field
The present invention relates to the plant molecular breeding field, exactly, relate to the anti-imidazolinone herbicide gene of a kind of detection swede type rape
BnALS1RMolecule marking method.
Background technology
Farmland weed has a strong impact on yield of rape and quality, has become one of main biological epidemics of rape production, and applying the antiweed rape is the important channel that overcomes the field crop smothering.Compare with traditional rape, the antiweed rape has three big meliority: the first, and farming is easy and simple to handle, efficient, and the grower only needs just can effectively kill weeds in field at 1～2 weedicide of seedling spraying; The second, can reduce rape production cost, additional income significantly; The 3rd, can promote to minimal till with no-tillage, help soil conservation, save the energy.Yet; China's antiweed rape is not got permission the commercialization plantation so far as yet; Mainly contain two reasons: (1) antiweed rape is generally genetically modified crops; Entering commercially produce must pass through strict safety evaluation (Cai Li etc. Science Bulletin, 2008,53 (13): 1544-1551).(2) up to now, domestic rape anti-herbicide gene is all from abroad, and resistant gene receives international intellectual property protection; In case commercialization plantation; Pay expensive patent royalty, this will increase substantially the rape production cost, run counter to plantation antiweed crop original intention (Pu Huiming etc. Acta Ecologica Sinica; 2005,25 (3): 196-203).
Imidazolinone herbicide is present world rape production application one of one type of weedicide the most widely, its broad weed-killing spectrum (comprising Gramineae and broadleaf weeds), consumption be low, to the Mammals low toxicity and environmentally friendly (Tan S,
Et al.,
Pest Manag Sci, 2005,61:246-257).But this type weedicide both can do processing soil treatment agent also cauline leaf spray, weeding ratio is high, easy to use firmly gets users' welcome.Research shows that (acetohydroxyacid synthase, AHAS), (acetolactate synthase ALS) is the target enzyme of imidazolinone herbicide to the acetohydroxy acid synthetic enzyme also to be acetolactate synthestase.Imidazolinone herbicide gets into the enzyme active sites path through forming mixture blocking-up substrate with ALS, and it is active to suppress ALS, causes the branched-chain amino acid biosynthesis block, makes plant tissue chlorosis, yellow, dead gradually at last (Jennifer A M,
Et al.,
PNAS, 2006,103:569-573).ALS is responsible for two parallel reactors of catalysis, and catalysis two molecule pyruvic acid condensations form the 2-acetylactis and emit CO
2, finally generate Xie Ansuan and leucine, catalysis a part pyruvic acid and the condensation of a part 2-oxy butyrate form the acetyl hydroxybutyric acid, finally generate Isoleucine (Ronald G D,
Et al.,
Plant Physiol Bioch, 2008,46:309-324).Abroad the als gene clone through antagonism imidazolinone herbicide plant shows; The generation of resistance crop is because mutant strain als gene dna sequence dna has produced some base site mutation; Cause the variation of proteins encoded amino-acid residue site; Thereby cause (Lee H due to the variation of weedicide and ALS combination
Et al.,
PNAS, 2011,108 (21): 8909-8913).
Adopt chemomorphosis foreign study personnel to obtain the rape two mutants P1 and the P2 of two anti-imidazolinone herbicide imazethapyrs, at present commercial anti-imidazolone rape variety all by these two two mutants transformations form (Swanson E B,
Et al.,
Theor Appl Genet, 1989,78:525-530).Domestic our unit height build the rape novel material that celery etc. reported anti-imidazolinone herbicide (Gao Jianqin etc. plant genetic resources journal, 2010,11 (3): 369-373), further obtained resistant material M9 resistant gene through the Protocols in Molecular Biology clone
BnALS1RThis gene can import other to nonresistant rape variety of imidazolinone herbicide or strain through plant conventional breeding methods such as hybridizing, backcross; Improve tolerance (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide of importing target variety or strain to imidazolinone herbicide; Chinese patent ZL201010232607.4).If after resistant gene importing recovery system, F
1True hybrid just has anti-imidazolinone herbicide characteristic, can all kill various types of pseudostationaries are disposable through herbicide spraying, has improved seed production efficiency and seed purity.But resistance trait is a dominant character; F1 is for showing as the imidazolone resistance; Separate for beginning from F2; In field breeding, need beginning herbicide spraying of per generation to identify, if the improper use of weedicide dosage or spray inhomogeneous very easily possibly cause falsely dropping or needed material dead, and the field conventional breeding seed selection cycle is long, workload is big.Simultaneously, spray the too much imidazolinone herbicide of dosage for many years continuously and possibly cause pedo relict, a following batch rotation crop is had certain influence.In addition, the material of in the anti-herbicide gene research process, need cannot not preserving anti-ly sometimes is with making comparative research.For this reason, if can find and the closely linked molecule marker of resistant gene, carry out marker assisted selection, then can keep a complete set of material, instruct field breeding, accelerate breeding process, the researchist also feels free to try.Kadaru etc. utilize single nucleotide variation of paddy rice als gene designed the PCR molecule marker detect paddy rice imidazolinone herbicide resistant gene (Kadaru S, et al., Euphytica, 2008,160:431-438).Lee etc. utilize single nucleotide variation of barley als gene designed the PCR molecule marker detect barley imidazolinone herbicide resistant gene (Lee H,
Et al.,
PNAS, 2011,108 (21): 8909-8913).
Different with barley (2n=14) with rice chromosome group (2n=24), swede type rape is that Chinese cabbage (2n=18) and Cauliflower (2n=20) merge the allotrtraploid species (2n=38) that form.In the evolutionary process genome inner height reset caused the many forms of swede type rape genes involved with gene family exist (Chen X,
Et al.,
Plant Physiol, 2011,155 (2): 851-65).Als gene is no exception, in the swede type rape genome, co-exists in 5 als genes,
BnALS1With
BnALS3Homology at nucleic acid and protein level reaches 98%,
BnALS2With
BnALS1,
BnALS3On dna sequence dna, differ greatly, the homology of nucleic acid level is 85%, and the homology of protein level is 75%,
BnALS4With
BnALS5The coding region by interrupt be afunction als gene (Rutledge R G,
Et al.,
Mol Gen Genet, 1991,229:31-40).It is quite difficult to the mutator gene that imidazolinone herbicide produces resistance that the high homology of als gene family dna sequence dna makes that the design specific molecular marker detects swede type rape.Up to now, also there be not to disclose or delivered the report of detection swede type rape both at home and abroad to the imidazolinone herbicide resistant gene.Have not though can detect resistant gene through the dna sequencing technology, this technological operation is loaded down with trivial details, expense is relatively costly.Therefore, the molecule marker of setting up a kind of PCR-based to detect quickly and accurately resistant gene
BnALS1RBe to utilize this gene to carry out the technical barrier that rape antiweed molecular breeding is needed solution badly.
Summary of the invention
Technical problem
The objective of the invention is to utilizing dna sequencing technology for detection resistant gene
BnALS1RDeficiencies such as the operation that produces is loaded down with trivial details, expensive are according to the anti-imidazolinone herbicide gene of swede type rape
BnALS1RWith als gene dna sequence dna mononucleotide difference, obtain the molecule marker chain with it, come to detect fast, accurately resistant gene through simple method
BnALS1R, the stepping row labels assisted Selection of going forward side by side.
Technical scheme
The anti-imidazolinone herbicide gene of a kind of detection swede type rape
BnALS1RThe molecule marker primer, it is characterized in that:
Forward primer sequence A P15F:5'-CTTTCGCTAGCAGGGCTAAA-3'
Reverse primer sequence A P18R:5'-CATCTTTGAAAGTGCCACAAC-3'
Reverse primer sequence A P19R:5'-CATCTTTGAAAGTGCCACAAT-3'
Utilize the anti-imidazolinone herbicide gene of above-mentioned primer rapid detection swede type rape
BnALS1RThe PCR molecule marking method be:
(1) extraction of swede type rape plant genomic dna (CTAB method), with reference to (Murray M G, et al.,
Nucleic Acids Research, 1980,8 (19): 4321-4326).
(2) AP15F/AP18R, the AP15F/AP19R with described 3 molecule marker primers adds 2 PCR reaction systems respectively, and the DNA of swede type rape germ plasm resource or breeding population plant is increased;
The PCR reaction system comprises: dna profiling 2.0 μ L (10 ng/ μ L), each 2. 0 μ L of primer (10 μ mol/L), 10 * enzyme reaction buffer solution, 2 μ L, MgC1
2(25mmol/ L) 1.2 μ L, dNTP (2.5 mmol/ L) 1.6 μ L, Taq enzyme (5 U/L) 0.1 μ L adds water to 20 μ L;
The PCR response procedures is 94
o Preparatory sex change 5 min of C, 94
oC sex change 30 s, 60
oC 30 s that anneal, 72
oC extends 1 min, totally 35 circulations; Then 72
oC extends 5min, 12
oBehind the C cooling 10min, amplified production is added a kind damping fluid termination reaction.
(3) amplified production is electrophoresis on 1.2% the sepharose than concentration in quality, through ethidium bromide staining and in gel imaging system observe down, record.
AP15F/AP19 does not have the characteristic band if primer has 828bp characteristic band to the AP15F/AP18R amplified production, then for not containing antiweed property gene
BnALS1RHomozygote; AP15F/AP19 has 828bp characteristic band if primer does not have the characteristic band to the AP15F/AP18R amplified production, then for containing antiweed property gene
BnALS1RHomozygote; If 2 primers all have 828bp characteristic band to AP15F/AP18R, AP15F/AP19 amplified production, then for containing antiweed property gene
BnALS1RHeterozygote.
Beneficial effect
The present invention provides a kind of detection swede type rape anti-imidazolinone herbicide gene
BnALS1RThe PCR molecule marking method, compared with prior art, the present invention has advantage and effect:
(1) the present invention provides PCR molecule marker for China's anti-imidazolinone herbicide rape seed selection first, and this molecule marker is not and anti-imidazolone gene
BnALS1RChain molecule marker, but, can directly reflect the resistance of plant according to the functional mark that the mutational site of gene is designed, do not exist the mistake that causes owing to the heredity exchange to identify.
(2) molecule marking method provided by the invention can be effective to anti-imidazolone gene
BnALS1RThe rape that causes is to the assistant breeding of imidazolinone herbicide resistance.The conventional breeding method is to utilize to contain
BnALS1RThe M9 of gene goes up the main breed of promoting with production and carries out a series of hybridization, and herbicide spraying identifies that final selection contains anti-imidazolone gene in each separation offspring then
BnALS1RThe resistance individual plant.Separate in offspring's weedicide qualification process at each, if the improper use of weedicide dosage or spray inhomogeneous very easily possibly cause falsely dropping or needed material dead.In addition, spray the too much imidazolinone herbicide of dosage for many years continuously and possibly cause pedo relict, a following batch rotation crop is had certain influence.Sometimes in the anti-herbicide gene research process, need to preserve not anti-material, with making comparative research.Therefore, utilize with
BnALS1RThe directly related PCR molecule marker of gene detects plant DNA; Can identify the not anti-individual plant of resistant mutation gene pure genotype individual plant and good character at rape any period; Eliminate other individual plant; So not only practice thrift the breeding cost, reduce pedo relict, and improve the selection process of anti-imidazolone rape variety greatly.
(3) do not have and compare with detect resistant gene through the dna sequencing technology, molecule marking method provided by the invention only needs 2 PCR reactions just can identify different resistant gene types, can not only effectively distinguish
BnALS1RHomozygote and heterozygote, and, therefore do not exist procedure loaded down with trivial details owing to do not relate to dna sequencing, drawbacks such as expensive, the PCR molecular mark detection method is efficient more, quick.
Description of drawings
Fig. 1-swede type rape acetolactate synthestase family gene
BnALS3Clone's electrophorogram
M, dna molecular amount standard, fragment is followed successively by 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500bp from small to large; 1, No. 16 (NY16) genomes of peaceful oil are template; 2, No. 18 (NY18) genomes of peaceful oil are template; 3, anti-imidazolinone herbicide swede type rape two mutants M9 genome is a template.
The rape acetolactate synthase gene of Fig. 2-different sources
BnALS1,
BnALS3Coding region nucleotide sequence comparison diagram and 3 primer locations, trilateral is represented wild type gene
BnALS1With the resistant mutation gene
BnALS1RMononucleotide difference (G/A), arrow represent primer location with the amplification direction.
BnALS1R.seq, swede type rape two mutants M9 acetolactate synthase gene
BnALS1The nucleic acid moiety sequence;
BnALS1-NY16.seq, the acetolactate synthase gene that No. 16, peaceful oil
BnALS1The nucleic acid moiety sequence;
BnALS1-NY18.seq, the acetolactate synthase gene that No. 18, peaceful oil
BnALS1The nucleic acid moiety sequence;
The patent that above sequence B nALS1R.seq, BnALS1-NY16.seq (being NY16.seq), BnALS1-NY18.seq (being NY18.seq) come from application before this obtains ((Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide; Chinese patent ZL201010232607.4);
Z11524.seq, Genbank download sequence (accession number: Z11524);
BnALS3-M9.seq, swede type rape two mutants M9 acetolactate synthase gene
BnALS3The nucleic acid moiety sequence;
BnALS3-NY16.seq, the acetolactate synthase gene that No. 16, peaceful oil
BnALS3The nucleic acid moiety sequence;
BnALS3-NY18.seq, the acetolactate synthase gene that No. 18, peaceful oil
BnALS3The nucleic acid moiety sequence;
Z11526.seq, Genbank download sequence (accession number: Z11526);
Fig. 3-PCR molecule marker is to resistant gene in different cabbage type rape varieties or the strain
BnALS1RDetection
M, dna molecular amount standard, fragment is followed successively by 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500bp from small to large; 1～5 with corresponding 1 '～5 ', not contain resistant gene
BnALS1RNo. 12, the peaceful oil of normal rapeseed kind, No. 14, peaceful oil, No. 16, peaceful oil, No. 18, peaceful oil, peaceful oil be template No. 20, use primer AP15F/18R, AP15F/19R amplification PCR products respectively; 6 and 6 ', with contrast H
2O is a template, with primer AP15F/18R, AP15F/19R amplification PCR products; 7～11 with corresponding 7 '～11 ', to contain resistant gene
BnALS1RAnti-imidazolone swede type rape strain M9, M9-2, M9-3, M9-11, M9-14 be template, use primer AP15F/18R, AP15F/19R amplification PCR products respectively.
Fig. 4-PCR molecule marker is to resistant gene in F2 (3075R/M9-2) colony
BnALS1RGenotype detection
M, dna molecular amount standard, fragment is followed successively by 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500bp from small to large; 1,3075R; 2, F1 (3075R/M9-2); 3, M9-2; 4～24, the F2 individual plant of part, wherein 6,11,14,17,20 for not containing resistant gene
BnALS1RHomozygous individual plant, 4,5,7～9,13,15,18,19,21～23 for containing resistant gene
BnALS1RThe heterozygous individual plant, 10,12,16,24 for containing resistant gene
BnALS1RHomozygous individual plant.
Fig. 5-PCR molecule marker is to resistant gene in BC1 [(3075R/M9-2)/3075R] colony
BnALS1RGenotype detection
M, dna molecular amount standard, fragment is followed successively by 200bp, 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500bp from small to large; 1,3075R; 2, M9-2; 3, F1 (3075R/M9-2); 4～24, the BC1 individual plant of part, wherein 4,6～8,11,13,16～18,21～22,24 for containing resistant gene
BnALS1RThe heterozygous individual plant, 5,9～10,12,14～15,19～20,23 for not containing resistant gene
BnALS1RHomozygous individual plant.
Fig. 6-PCR molecule marker is to resistant gene in BC2 [(3075R/M9-2)/M9-2] colony
BnALS1RGenotype detection
M, dna molecular amount standard, fragment is followed successively by 200bp, 500bp, 800bp, 1200bp, 2000bp from small to large; 1,3075R; 2, M9-2; 3, F1 (3075R/M9-2); 4～24, the BC2 individual plant of part, wherein 5,8,10～11,14～15,18～20,23 for containing resistant gene
BnALS1RThe heterozygous individual plant, 4,6～7,9,12～13,16～17,21～22,24 for containing resistant gene
BnALS1RHomozygous individual plant.
The DH strain of Fig. 7-PCR molecule marker antagonism imidazolone is a resistant gene
BnALS1RPCR detect electrophorogram
M, dna molecular amount standard, fragment is followed successively by 500bp, 800bp, 1200bp, 2000bp, 3000bp, 4500bp from small to large; 1, M9; 2, No. 18, peaceful oil; 5, negative control water is template; 3～4,6～24, contain resistant gene
BnALS1RHomozygous anti-imidazolone DH strain is.
Embodiment
All methods are ordinary method if no special instructions in the following enforcement, and the practical implementation step is following:
(1) test materials
No. 12, the peaceful oil of normal rapeseed kind, No. 14, peaceful oil, No. 16, peaceful oil, No. 18, peaceful oil, peaceful oil are Jiangsu Province's authorization kind No. 20; MICMS double low restorer 3075R (Pu Huiming etc., 2002, the Jiangsu agricultural sciences, 4:33-34); Anti-imidazolinone herbicide two mutants M9 (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide; Chinese patent ZL201010232607.4) and offspring choosing be M9-2, M9-3, M9-11, M9-14 (Pu Huiming etc., the heredity of the anti-imidazolone proterties of rape and using. Chinese oil crops journal, 33 (1): 15-19)
BnALS1RThe genotype segregating population: F2 colony (3075R/M9-2), 3075R are maternal, and M9-2 is that paternal hybrid, selfing obtain; BC1 colony [(3075R/M9-2)/3075R] and BC2 colony [(3075R/M9-2)/M9-2] are for maternal, respectively with 3075R, the M9-2 acquisition of backcrossing by F1 (3075R/M9-2).Anti-imidazolone DH strain is to be to obtain (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide by F1 (3075R/M9) plant pollen through microspores culture; Chinese patent ZL201010232607.4).
(2) molecular markers development
Swede type rape is that Chinese cabbage and Cauliflower merge the allotrtraploid species that form, in the evolutionary process genome inner height reset cause the many forms of swede type rape gene with gene family exist (Chen X,
Et al.,
Plant Physiol, 2011,155 (2): 851-65).Als gene is no exception, in the swede type rape genome, co-exists in 5 als genes, wherein
BnALS1With
BnALS3Homology at nucleic acid and protein level reaches 98%,
BnALS2With
BnALS1,
BnALS3On dna sequence dna, differ greatly, the homology of nucleic acid level is 85%,
BnALS4With
BnALS5Be afunction als gene (Rutledge R G,
Et al.,
Mol Gen Genet, 1991,229:31-40).In the patent of our application before this, find in No. 16, the peaceful oil of anti-imidazolinone herbicide two mutants M9 and normal rapeseed, No. 18 codings of the peaceful oil ALS family
BnALS1Nucleotide sequence have a place single nucleotide variation, the i.e. resistant gene of M9
BnALS1RGene order has been mutated into A at 1933 G of place, makes 638 Serines (AGT) residue of coding protein sequence substituted (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide by l-asparagine acid (AAT); Chinese patent ZL201010232607.4).Therefore, can locate single nucleotide variation exploitation Markers for Detection resistant gene according to this
BnALS1RBut because the high homology of als gene family nucleotide sequence, particularly
BnALS1With
BnALS3Homology in nucleic acid level reaches 98%, makes in gene coding region, to be difficult to develop primer specific amplified respectively
BnALS1With
BnALS3Gene fragment.At first must find the sequence difference of these 2 genes between No. 18, M9, No. 16, peaceful oil, peaceful oil for this reason, through
BnALS1With
BnALS3The amplification of sequence difference design primer specific
BnALS1The gene order fragment is got rid of
BnALS3Gene order is to detecting the interference of resistant gene.And in patent (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide; Chinese patent ZL201010232607.4) we have obtained M9, No. 16, peaceful oil, No. 18, peaceful oil in
BnALS1Full length gene encoding sequence (BnALS1R.seq, NY16.seq, NY18.seq).For obtaining M9, No. 16, peaceful oil, No. 18, peaceful oil
BnALS3The full length gene encoding sequence is according to known in the ncbi database
BnALS3Gene order (accession number Z11526), in genes encoding section both sides and with
BnALS1Non-homogeneous district design special primer, amplify total length
BnALS3 genes.Its forward primer F:5 ' CGCGGTACCCTCTCTCTCTCTCATCTAACCAT 3' ' and reverse primer R:5'CGCACTAGTCTCTCAGTACTTAGTGCGACC 3'.
Adopt the CTAB method extract M9, No. 16, peaceful oil, No. 18 rape seedling blade genomic dnas of peaceful oil (Murray M G, et al.,
Nucleic Acids Research, 1980,8 (19): 4321-4326), step is following:
(1) gets 0.2g left and right sides blade and be placed in the mortar, add liquid nitrogen and grind, change in the 1.5ml centrifuge tube;
(2) add 700 μ l extract damping fluid (2%CTAB, 100mM Tris pH8.0,20mM EDTA pH8.0,1.4M NaCl faces the time spent and adds 1% β-Me), mixing, 65 ℃ of water-bath 1.5h;
(3) cooled on ice, centrifugal 12000rpm, 5min;
(4) suct clearly, add RNase (final concentration 20 μ g/ml), 37 ℃ of insulation 0.5h;
(5) add phenol: chloroform: primary isoamyl alcohol (25:24:1) 600 μ l, mixings up and down;
(6) centrifugal, 12000rpm, 15min;
(7) get supernatant, add chloroform: primary isoamyl alcohol (24:1) 600 μ l, mixings up and down;
(8) centrifugal, 12000rpm, 15min;
(9) get supernatant, add the Virahol of 300 μ l-20 ℃ precoolings, mixing up and down ,-20 ℃ of 0.5h;
(10) centrifugal, 10000rpm, 10min;
(11) deposition suspends with 600 μ l, 70% ethanol and cleans twice;
(12) abandon ethanol, vacuum is drained, and DNA dissolves with 200 μ l, 1 * TE damping fluid,
(13) detect the DNA quality of putting forward with 1% agarose gel electrophoresis, sample-20 ℃ freezing preservation is subsequent use.
Rape genomic dna to extract is a template, utilizes the forward primer F and the reverse primer R of design, and pcr amplification obtains M9, No. 16, peaceful oil, No. 18, peaceful oil on MJ Research PTC-200 type PCR appearance
BnALS3The full length gene encoding sequence.The PCR system contains dna profiling 2 μ L, 10 * enzyme reaction buffer solution, 5 μ L, MgSO
4(25mmol L) 3 μ L, dNTP (2 mmol L) 5 μ L, each 5 μ L of primer (10mmol L), KOD-Plus Taq enzyme (1 U/L) 2 μ L add water to 50uL.Response procedures is 94
oPreparatory sex change 5 min of C, 94
oC sex change 30 s, 55
oC 30 s that anneal, 72
oC extends 2.5 min, totally 35 circulations.Utilizing the flat end of PCR product of the precious biotechnology of TaKaRa ltd to add A test kit (DaLian, China) carries out separating electrophoresis result such as Fig. 1 through 1.2% (V/W) agarose gel electrophoresis after the flat end of PCR product adds A.(catalog number (Cat.No.): DP209) step is carried out the recovery of PCR product purification to the plain agar sugar gel DNA recovery test kit of producing by Beijing Tiangen company, is connected on the cloning vector pEASY-T1, and heat shock transforms DH5 α.Identify through blue hickie screening and bacterium colony PCR, send the order-checking of the biological ltd of Nanjing Jin Sirui positive colony.Through information biology software analysis M9 such as DNAMAN6.0, Sequencher, DNASTAR, No. 16, peaceful oil, No. 18, peaceful oil
BnALS1With
BnALS3The difference of gene, sequence alignment result such as Fig. 2.
As can beappreciated from fig. 2,3 kinds of rapes
BnALS1With
BnALS3Only there is the single nucleic acid variation of 9 the base insertion/disappearances in 1 place and some in the dna sequence dna height homology of gene coding region.And 9 base insertion/disappearances mainly are Tumor-necrosis factor glycoproteinss, are not suitable for as primer sequence.Therefore, find in our the patent in anti-imidazolinone herbicide two mutants M9 and No. 16, peaceful oil, No. 18 codings of the peaceful oil ALS families according to application before this
BnALS1Single nucleotide variation (G/A) of existing of nucleotide sequence, primer sequence is located at
BnALS1With
BnALS3(eliminate on single nucleic acid series of variation
BnALS3Gene order is to the interference of pcr amplification), design 30 molecule marker primers (table 1) altogether.Wherein 12 forward primer AP3F～AP14F match with 3 reverse primer AP1R, AP2R, A5R respectively; Article 3, forward primer AP15F～AP17F matches with 12 reverse primer AP18R～AP29R respectively; Rape genomic dna to extract is a template; In the enterprising performing PCR amplification of MJ Research PTC-200 type PCR appearance, screen 72 pairs of molecule marker primer extension product polymorphums.Obtain 3 molecule marker primers through screening and can detect resistant gene
BnALS1RAnd sensitive gene
BnALS1, these 3 PCR molecule marker primer positions on gene order are as shown in Figure 2, and its primer sequence is:
Forward primer sequence A P15F:5'-CTTTCGCTAGCAGGGCTAAA-3'
Reverse primer sequence A P18R:5'-CATCTTTGAAAGTGCCACAAC-3'
Reverse primer sequence A P19R:5'-CATCTTTGAAAGTGCCACAAT-3'
Table 1 is designed for the molecule marker primer sequence (base mismatch is represented in the underscore overstriking, and mutating alkali yl is represented in the italic overstriking) that detects resistant gene
| Numbering | Sequence (5' is to 3') | Numbering | Sequence (5' is to 3') |
| AP1R | CGTCTGGGAACAACCAAAAGT | AP15F | CTTTCGCTAGCAGGGCTAAA |
| AP2R | GCATTGAGTCCCAAACATATGA | AP16F | ATCCTCGACGAGCTAACCG |
| A5R | CGAGTACGTCTGGGAACAA | AP17F | CTGTCGTCATCAGGCCTCG |
| AP3F | TGTGTTACCGATGATCCC C A G | AP18R | CATCTTTGAAAGTGCCAC A A C |
| AP4F | TGTGTTACCGATGATCCC C A A | AP19R | CATCTTTGAAAGTGCCAC A A T |
| AP5F | TGTGTTACCGATGATCCC T A G | AP20R | CATCTTTGAAAGTGCCAC T A C ' |
| AP6F | TGTGTTACCGATGATCCC T A A | AP21R | CATCTTTGAAAGTGCCAC T A T |
| AP7F | TGTGTTACCGATGATCCC G A G | AP22R | CATCTTTGAAAGTGCCAC G A C |
| AP8F | TGTGTTACCGATGATCCC G A A | AP23R | CATCTTTGAAAGTGCCAC G A T |
| AP9F | TGTGTTACCGATGATCC A AA G | AP24R | CATCTTTGAAAGTGCCA A CA C ' |
| AP10F | TGTGTTACCGATGATCC A AA A ' | AP25R | CATCTTTGAAAGTGCCA A CA T |
| AP11F | TGTGTTACCGATGATCC T AA G | AP26R | CATCTTTGAAAGTGCCA T CA C |
| AP12F | TGTGTTACCGATGATCC T AA A | AP27R | CATCTTTGAAAGTGCCA T CA T |
| AP13F | TGTGTTACCGATGATCC G AA G | AP28R | CATCTTTGAAAGTGCCA G CA C |
| AP14F | TGTGTTACCGATGATCC G AA A | AP29R | CATCTTTGAAAGTGCCA G CA T |
(3) molecule marker checking
Get fresh and tender blade seedling stage ,-70 ℃ of preservations are subsequent use.Extract the rape genome DNA, method is the same.Rape genomic dna to extract is a template, and the AP15F/AP18R, the AP15F/AP19R that screen 3 molecule marker primers that obtain are added 2 PCR reaction systems respectively, on MJ Research PTC-200 type PCR appearance, increases.The PCR reaction system comprises: dna profiling 2.0 μ L (10 ng/ μ L), each 2. 0 μ L of primer (10 μ mol/L), 10 * enzyme reaction buffer solution, 2 μ L, MgC1
2(25mmol/ L) 1.2 μ L, dNTP (2.5 mmol/ L) 1.6 μ L, Taq enzyme (5 U/L) 0.1 μ L adds water to 20uL; The PCR response procedures is 94
o Preparatory sex change 5 min of C, 94
oC sex change 30 s, 60
oC 30 s that anneal, 72
oC extends 1 min, totally 35 circulations; Then 72
oC extends 5min, 12
oBehind the C cooling 10min, amplified production is added a kind damping fluid termination reaction.
Amplified production is electrophoresis on 1.2% the sepharose than concentration in quality, through ethidium bromide staining and in gel imaging system observe down, record, electrophoresis result is seen Fig. 3.Primer is that the 1933rd place's Nucleotide is the loci of G on the ALS1 site to the AP15F/AP18R specific amplified, the rape wild-type of promptly not suddenling change
BnALS1Gene is to herbicide sensitive; Primer is that the 1933rd place's Nucleotide is the loci of A on the ALS1 site to the AP15F/AP19R specific amplified, i.e. the resistant gene of sudden change
BnALS1RGene has resistance to weedicide.Therefore, to contain sensitive gene
BnALS1No. 12, the peaceful oil of normal rapeseed, No. 14, peaceful oil, No. 16, peaceful oil, No. 18, peaceful oil, No. 20 primers of peaceful oil for template have 828bp characteristic band primer that AP15F/AP19 is not had the characteristic band to the AP15F/AP18R amplified production, and contain resistant gene
BnALS1RAnti-imidazolone swede type rape strain M9, M9-2, M9-3, M9-11, M9-14 be that the AP15F/AP18R amplified production of template does not have the characteristic band and AP15F/AP19 has 828bp characteristic band.Safety for the single nucleotide variation of checking PCR Markers for Detection; Treat imidazolinone herbicide 5.0% " beans Xerox " the aqua processing that the dish seedling 3-5 leaf phase produces with Shandong Cynda Chemical Co., Ltd; Concentration of treatment is 90ga.i./hm2,15d " Invest, Then Investigate " resistant phenotype.The result shows that 5 normal rapeseed 15d that do not contain resistant gene are all dead, and 5 strain growths that contain resistant gene are normal.PCR result identifies that with field resistance phenotype is consistent, shows that the PCR molecule marker of 2 pairs of primers can accurately detect anti-imidazolone gene in the rape germ plasm resource
BnALS1R
(4) molecule marker detects in segregating population
For verifying that further 2 pairs of primer PCR molecule markers are to the anti-imidazolone gene of swede type rape
BnALS1RThe detection effect of heterozygous genes type has been extracted 3 at rape seedling
BnALS1RThe genotype segregating population: F2 colony (3075R/M9-2), BC1 colony [(3075R/M9-2)/3075R], BC2 colony [(3075R/M9-2)/M9-2] plant leaf DNA, carry out pcr amplification.DNA extraction, PCR react, the product detection method is the same.Electrophoresis result presents 3 kinds of characteristic bands; Promptly do not contain resistant gene MICMS double low restorer 3075R characteristic band (the AP15F/AP18R amplified production is had characteristic band 828bp to primer and AP15F/AP19 does not have the characteristic band); The M9-2 characteristic band (the AP15F/AP18R amplified production is not had the characteristic band to primer and AP15F/AP19 has characteristic band 828bp) that contains resistant gene, the heterozygosis banding pattern (the AP15F/AP18R amplified production is had characteristic band 828bp to primer and AP15F/AP19 also has characteristic band 828bp) that has parents' banding pattern simultaneously (Fig. 4).F2 colony detects 154 individual plants altogether, has 35 of the individual plants of 3075R band, has 39 of the individual plants of M9-2 banding pattern, and has 80 of the individual plants of heterozygosis banding pattern, and 3 kinds of genotype meet 1:2:1 (χ
2=0.32,0.5<p<o.75).Simultaneously 227 individual plants of BC1 colony, 201 individual plants of BC2 colony are carried out pcr amplification, the result shows 110 of individual plants that have the 3075R band in the BC1 colony, has 117 of the individual plants (Fig. 5) of M9-2 banding pattern, and 2 kinds of genotype meet 1:1 (χ
2=0.45,0.25<p<o.50).98 of individual plants that have the 3075R band in the BC2 colony have 113 of the individual plants (Fig. 6) of M9-2 banding pattern, and 2 kinds of genotype meet 1:1 (χ
2=0.37,0.50<p<o.75).More than 3 PCR of colony detected results and seedling spraying imidazolinone herbicide " beans Xerox " identify that the phenotype result is in full accord.Therefore, the PCR molecule marker of 2 pairs of primers can effectively be distinguished the anti-imidazolone gene of rape
BnALS1RThree kinds of different genotype, the efficiency of selection of raising resistant gene is quickened breeding process.
(5) the applied molecular mark identifies that the anti-imidazolone DH strain that obtains is
For verifying the accuracy of PCR Markers for Detection once more, we have extracted anti-imidazolone DH strain in seedling stage is (Hu Maolong etc., the swede type rape mutator gene and the application thereof of anti-imidazolinone herbicide; Chinese patent ZL201010232607.4) DNA has carried out pcr amplification.The result shows that all anti-imidazolone DH strains are all to contain resistant gene
BnALS1RCharacteristic band (the AP15F/AP18R amplified production is not had the characteristic band to primer and AP15F/AP19 has 828bp characteristic band) (Fig. 7), further proves the accuracy of 2 pairs of primer PCR Markers for Detection resistant genes.
SEQUENCE LISTING
< 110>Jiangsu Province Agriculture Science Institute
< 120>a kind of molecule marking method that detects the anti-imidazolinone herbicide gene of swede type rape
<130> 0
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 20
<212> DNA
< 213>manual work
<220>
<221> AP15F
<222> (1)..(20)
<223>
<400> 1
<210> 2
<211> 21
<212> DNA
< 213>manual work
<220>
<221> AP18R
<222> (1)..(21)
<223>
<400> 2
catctttgaa agtgccacaa c 21
<210> 3
<211> 21
<212> DNA
< 213>manual work
<220>
<221> AP19R
<222> (1)..(21)
<223>
<400> 3
catctttgaa agtgccacaa t 21
Claims (2)
1. one kind is detected the anti-imidazolinone herbicide gene of swede type rape
BnALS1RThe molecule marker primer, it is characterized in that:
Forward primer sequence A P15F:5 '-CTTTCGCTAGCAGGGCTAAA-3 '
Reverse primer sequence A P18R:5 '-CATCTTTGAAAGTGCCACAAC-3 '
Reverse primer sequence A P19R:5 '-CATCTTTGAAAGTGCCACAAT-3 '.
2. the said primer of claim 1 is used to detect the anti-imidazolinone herbicide gene of swede type rape
BnALS1RMethod, it is characterized in that:
(1) extraction of swede type rape plant genomic dna,
(2) claim 1 described 3 molecule marker primer AP15F/AP18R, AP15F/AP19R are added 2 PCR reaction systems respectively, and the DNA of swede type rape germ plasm resource or breeding population plant is increased;
The PCR reaction system comprises: 10 ng/ μ L dna profilings, 2.0 μ L, each 2. 0 μ L of 10 μ mol/L primer, 10 * enzyme reaction buffer solution, 2 μ L, 25mmol/ L MgC1
21.2 μ L, 2.5 mmol/ L dNTP1.6 μ L, 5 U/L Taq enzymes, 0.1 μ L adds water to 20 μ L;
The PCR response procedures is 94
oPreparatory sex change 5 min of C, 94
oC sex change 30 s, 60
oC 30 s that anneal, 72
oC extends 1 min, totally 35 circulations; Then 72
oC extends 5 min, 12
oAfter C cools off 10 min, amplified production is added a kind damping fluid termination reaction;
(3) amplified production is electrophoresis on 1.2% the sepharose than concentration in quality, through ethidium bromide staining and in gel imaging system observe down, record:
AP15F/AP19 does not have the characteristic band if primer has 828bp characteristic band to the AP15F/AP18R amplified production, then for not containing anti-herbicide gene
BnALS1RHomozygote; AP15F/AP19 has 828bp characteristic band if primer does not have the characteristic band to the AP15F/AP18R amplified production, then for containing anti-herbicide gene
BnALS1RHomozygote; If 2 primers all have 828bp characteristic band to AP15F/AP18R, AP15F/AP19 amplified production, then for containing anti-herbicide gene
BnALS1RHeterozygote.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210291068 CN102766697B (en) | 2012-08-16 | 2012-08-16 | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210291068 CN102766697B (en) | 2012-08-16 | 2012-08-16 | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102766697A true CN102766697A (en) | 2012-11-07 |
| CN102766697B CN102766697B (en) | 2013-11-06 |
Family
ID=47094263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210291068 Active CN102766697B (en) | 2012-08-16 | 2012-08-16 | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102766697B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104789682A (en) * | 2015-04-29 | 2015-07-22 | 江苏省农业科学院 | Primers for detecting anti-sulfonylurea herbicide gene BnALS3R of cabbage type rape and application of primer |
| CN105349623A (en) * | 2014-08-13 | 2016-02-24 | 深圳市作物分子设计育种研究院 | HRM (high-resolution melt) detection method for herbicide-resistant gene OsmALS and application of method |
| CN106701726A (en) * | 2017-02-08 | 2017-05-24 | 上海市农业科学院 | Rapeseed protein having anti-imidazolone weedicide activity, and coding gene and application thereof |
| CN109880927A (en) * | 2019-03-20 | 2019-06-14 | 江苏省农业科学院 | Detect SNP marker primer and its application of rape BnALS1R gene |
| CN114622029A (en) * | 2022-03-16 | 2022-06-14 | 华智生物技术有限公司 | Primer group and kit for detecting resistance of sunflower to imidazolinone herbicides and application of primer group and kit |
| CN114622030A (en) * | 2022-03-16 | 2022-06-14 | 华智生物技术有限公司 | Primer group and kit for detecting imidazolone herbicide-resistant sunflower and application of primer group and kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688219A (en) * | 2007-05-09 | 2010-03-31 | 美国陶氏益农公司 | Novel herbicide resistance genes |
| CN101935667A (en) * | 2010-07-21 | 2011-01-05 | 江苏省农业科学院 | Brassica napus mutator gene for resisting imidazolone weedicide and application thereof |
-
2012
- 2012-08-16 CN CN 201210291068 patent/CN102766697B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688219A (en) * | 2007-05-09 | 2010-03-31 | 美国陶氏益农公司 | Novel herbicide resistance genes |
| CN101935667A (en) * | 2010-07-21 | 2011-01-05 | 江苏省农业科学院 | Brassica napus mutator gene for resisting imidazolone weedicide and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 浦惠明 等: "油菜抗咪唑啉酮性状的遗传及其应用", 《中国油料作物学报》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105349623A (en) * | 2014-08-13 | 2016-02-24 | 深圳市作物分子设计育种研究院 | HRM (high-resolution melt) detection method for herbicide-resistant gene OsmALS and application of method |
| CN104789682A (en) * | 2015-04-29 | 2015-07-22 | 江苏省农业科学院 | Primers for detecting anti-sulfonylurea herbicide gene BnALS3R of cabbage type rape and application of primer |
| CN104789682B (en) * | 2015-04-29 | 2019-05-17 | 江苏省农业科学院 | Detect primer and the application of Cabbage type rape anti-sulfonylurea herbicide gene BnALS3R |
| CN106701726A (en) * | 2017-02-08 | 2017-05-24 | 上海市农业科学院 | Rapeseed protein having anti-imidazolone weedicide activity, and coding gene and application thereof |
| CN109880927A (en) * | 2019-03-20 | 2019-06-14 | 江苏省农业科学院 | Detect SNP marker primer and its application of rape BnALS1R gene |
| CN114622029A (en) * | 2022-03-16 | 2022-06-14 | 华智生物技术有限公司 | Primer group and kit for detecting resistance of sunflower to imidazolinone herbicides and application of primer group and kit |
| CN114622030A (en) * | 2022-03-16 | 2022-06-14 | 华智生物技术有限公司 | Primer group and kit for detecting imidazolone herbicide-resistant sunflower and application of primer group and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102766697B (en) | 2013-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2716625C (en) | Corn plant event mon87460 and compositions and methods for detection thereof | |
| CA2771581C (en) | Detection of aad-1 event das-40278-9 in corn | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| CN102766697B (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| AU2017203293B2 (en) | Qtls associated with and methods for identifying whole plant field resistance to sclerotinia | |
| WO2013014241A1 (en) | Glyphosate tolerant corn event vco-ø1981-5 and kit and method for detecting the same | |
| US20240018606A1 (en) | New native clubroot resistance in rapeseed brassica napus | |
| Qing et al. | Development of molecular marker and introgression of Bph3 into elite rice cultivars by marker-assisted selection | |
| CN111961749A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance genes Ty-3 and Ty-3a and application thereof | |
| CN107385053A (en) | A kind of four primer molecule labeling methods identified rice and produce als gene mutation | |
| CN103589805B (en) | Give the main QTLS of corn Fijivirus resistance | |
| EP4077736A1 (en) | Enhanced disease resistance of maize to northern corn leaf blight by a qtl on chromosome 4 | |
| EP2102364B1 (en) | Genetic markers for orobanche resistance in sunflower | |
| CN103834647A (en) | SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof | |
| WO2014152399A1 (en) | Markers linked to reniform nematode resistance | |
| Wu et al. | Identification and Molecular Mapping of the Gene YrFL in Wheat Cultivar Flanders with Durable Resistance to Stripe Rust | |
| Lukic et al. | Identification of ACS1, ACO1 and ETR1 alleles in some indigenous apple genotypes | |
| US9534260B2 (en) | Materials and methods for detecting the aryloxyalkanoate dioxygenase gene (AAD-12) containing event pDAB4472-1606 in plants | |
| KANYANGE | SCREENING OF SUPA AROMATIC RICE (ORYZA SATIVA L.) F2 POPULATION FOR BLAST (MAGNAPORTHE ORYZAE) RESISTANCE AT IRRI-ESA BURUNDI | |
| US20150167105A1 (en) | Genetic loci associated with gray leaf spot in maize | |
| CN115948592A (en) | Resistance gene for resisting sulfonylurea herbicide flax and application thereof | |
| CN116479156A (en) | Primer for detecting peanut imidazolinone herbicide resistant gene AhALS-G1709T and application | |
| CN115232885A (en) | KASP molecular marker of leaf rust resistance gene Lr16G216 of wheat in adult stage, detection method and application | |
| CN110184281A (en) | A kind of application of rice paddy seed keeping quality gene OsGH3-2 and its molecular labeling | |
| WO2012048124A1 (en) | Endpoint taqman methods for determining zygosity of cotton comprising cry1f event 281-24-236 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |