CN114622030A

CN114622030A - Primer group and kit for detecting imidazolone herbicide-resistant sunflower and application of primer group and kit

Info

Publication number: CN114622030A
Application number: CN202210258325.4A
Authority: CN
Inventors: 谢心悦; 唐顺学; 田冰川; 雷雨婷
Original assignee: Huazhi Biotechnology Co ltd
Current assignee: Huazhi Biotechnology Co ltd
Priority date: 2022-03-16
Filing date: 2022-03-16
Publication date: 2022-06-14

Abstract

The invention discloses a primer group, a kit and application thereof for detecting imidazolone herbicide-resistant sunflower, wherein the primer group is AHAS1-HT3.1 and/or AHAS1-HT 3.2. The invention combines the KASP mark detection method, and adopts a detection mode with high flux, high automation and low cost to obviously improve the detection efficiency and detection universality of the plant resistant to the imidazolinone herbicide. Can quickly and effectively identify the sunflower which is resistant to the imidazolinone herbicide, has good stability and high flux, and has important significance in the breeding and auxiliary breeding processes of the sunflower.

Description

Primer group and kit for detecting imidazolone herbicide-resistant sunflower and application of primer group and kit

Technical Field

The invention relates to the field of sunflower breeding, in particular to a primer group and a kit for detecting imidazolone herbicide-resistant sunflower and application thereof.

Background

Sunflower (Helianthus annuus L.) is an important oil and commercial crop. The sunflower mainly comprises three types of edible sunflower, oil sunflower and ornamental sunflower, and with the continuous improvement of the living standard of people, no matter the sunflower oil or the leisure food sunflower seeds, the daily demand of people is more and more, and the planting area of the sunflower also shows a steady rising trend. The occurrence of field weeds in the sunflowers is one of the important factors influencing the yield and the quality of the sunflowers.

Sunflower weed is an important factor which severely restricts the production of the sunflower, weeds can graze the growth resources of the sunflower, and a plurality of weeds are common hosts of diseases and pests, so that the damage degree of the diseases and the pests can be obviously increased. In all methods for preventing and controlling weeds, the herbicide is low in cost and quick in effect, and the weed control aspect mainly depends on the strong herbicide in the current sunflower planting. Herbicides that inhibit acetohydroxy acid synthase (AHAS), also known as Acetolactate Synthase (ASL), are a class of broad spectrum herbicides that include 5 classes of different chemical structures, primarily Sulfonylureas (Sulfonylureas), Imidazolinones (Imidazolinones), Triazolopyrimidines (triazolidines), pyrimidinethiobenzoates (Pyrimidinylthiobenzoates) and sulfonamidocarbonyltriazolinones, and are the fastest growing, most diverse, and large market herbicides.

Because the imidazolinone herbicide is continuously used in a large area, herbicide residues in soil are easy to cause phytotoxicity to sensitive crops, the phytotoxicity is particularly obvious in succeeding crops of crop rotation, the problem is solved along with the successful breeding of resistant crops, and the residual hazard of the herbicide can be avoided when planting the resistant crops. Related Art the first commercial imidazolinone herbicide tolerance trait of sunflower was found in 1996 to be called "Imisun", the inheritance of which is controlled by two genes, one of which is the partial dominant allele Ahasl1-1 and the other is a modifier or enhancer.

Resistance to AHAS-type herbicides in sunflower is caused by point mutations at key sites encoding the AHAS gene, AHAS1, AHAS2 and AHAS3, which reduce the sensitivity of acetohydroxyacid synthase (AHAS) to herbicide inhibition, for the three genes encoding the AHAS catalytic subunit of sunflower, AHAS1 and AHAS2, respectively, with 92% nucleotide sequence homology and 73% for AHAS3 and 72% for AHAS1 and 73% for AHAS 2. Related art 48 Single Nucleotide Polymorphisms (SNPs) were found in sunflower AHAS1, wherein herbicide resistance was obtained in sunflower by mutation of 8 amino acids Ala122, Pro197, Ala205, Asp376, Arg377, Trp574, Ser653, Gly654 (calculated from AHAS amino acid positions of the model plant arabidopsis thaliana), wherein mutation of Ala122, Ala205, Ser653, Gly654 confers high imidazolinone herbicide resistance to plants; pro197 makes plants show higher resistance to sulfonylurea herbicides, while also making plants more resistant to triazolopyrimidine and/or imidazolinone herbicides; therefore, the cloning and expression of the sunflower AHAS1 gene have important significance not only in theoretical research but also in application.

The DNA molecular marking method is a direct reaction of DNA level genetic variation, plays a very important auxiliary role in the genetic breeding aspect of sunflower, and mainly comprises AFLP, RAPD, SSR, SNP and the like. Compared with SNP markers, RAPD and AFLP are dominant markers, and sensitivity, resolution, accuracy, repeatability and stability are relatively low. Compared with an SSR labeling method, the SNP labeling method has the advantages of simpler technology, easy automation, high detection flux and high speed; the detection cost of the unit data point is low. The SNP marker is codominant, has the characteristics of high genetic stability, high throughput, easy automatic analysis and quick detection, and becomes an important tool in the research of sunflower molecular breeding.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the primer group for detecting the imidazolone herbicide-resistant sunflower can quickly and effectively distinguish whether the sunflower has the imidazolone herbicide resistance.

The invention also provides a kit.

The invention also provides a gene chip.

The invention also provides an application of the primer, the kit or the gene chip.

In a first aspect of the invention, a primer set is provided, said primer set being AHAS1-HT3.1 and/or AHAS1-HT 3.2;

the AHAS1-HT3.1 comprises a specific Primer Allole X1, a specific Primer Allole Y1 and a universal Primer 1, wherein the nucleotide sequence of the specific Primer Allole X1 is shown as SEQ ID NO.2, the nucleotide sequence of the specific Primer Allole Y1 is shown as SEQ ID NO.3, and the nucleotide sequence of the universal Primer 1 is shown as SEQ ID NO. 4;

the AHAS1-HT3.2 comprises a specific Primer Allole X2, a specific Primer Allole Y2 and a universal Primer 2, wherein the nucleotide sequence of the specific Primer Allole X2 is shown as SEQ ID NO.5, the nucleotide sequence of the specific Primer Allole Y2 is shown as SEQ ID NO.6, and the nucleotide sequence of the universal Primer 2 is shown as SEQ ID NO. 7.

In some embodiments of the invention, the primer set is used for detecting resistance of sunflower to imidazolone herbicides through a SNP molecular marker, the SNP molecular marker is AHAS1-HT3, the nucleotide sequence of AHAS1-HT3 is shown in SEQ ID NO.1, the SNP site is located at position 250, and the polymorphism is C or T.

In some embodiments of the invention, the primer set is a KASP primer set.

In some embodiments of the invention, the 5' end of the specific Primer Allole X1 and the specific Primer Allole Y1 carry sequence tag A and sequence tag B, respectively, the nucleotide sequences of the sequence tag A and the sequence tag B are different from each other and are homologous to a sunflower genomic sequence;

the 5' end of the specific Primer Allole X2 and the specific Primer Allole Y2 respectively carry a sequence tag A and a sequence tag B, and the nucleotide sequences of the sequence tag A and the sequence tag B are different from each other and are different from the sunflower genome sequence.

In some embodiments of the invention, the sequence tag a is GAAGGTGACCAAGTTCATGCT (SEQ ID No. 8);

the sequence tag B is GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 9).

In a second aspect of the invention, a kit is provided, which comprises the above primer.

In some embodiments of the invention, the kit further comprises a PCR premix comprising fluorescent probe a, fluorescent probe B, quenching probe a, and quenching probe B;

the nucleotide sequence of the fluorescent probe A is consistent with that of the sequence tag A, and the 5' end of the fluorescent probe A is connected with a fluorescent group A; the nucleotide sequence of the quenching probe A is reversely complementary with the nucleotide sequence of the sequence tag A, and the 3' end of the quenching probe A is connected with a quenching group;

the nucleotide sequence of the fluorescent probe B is consistent with that of the sequence label B, and the 5' end of the fluorescent probe B is connected with a fluorescent group B; the nucleotide sequence of the quenching probe B is reversely complementary with the nucleotide sequence of the sequence label B, and the 3' end of the quenching probe A is connected with a quenching group.

In some embodiments of the invention, the fluorophore A and the fluorophore B are different from each other.

In a third aspect of the present invention, a gene chip is provided, which comprises the above primer.

In a fourth aspect of the invention there is provided any one of the following uses of the above KASP primers, kits or gene chips:

(1) the application in identifying or assisting in identifying imidazolinone herbicide-resistant sunflowers;

(2) the application of the sunflower in preparing products for identifying or assisting in identifying imidazolinone herbicide-resistant sunflowers;

(3) the application in breeding sunflowers with imidazolinone herbicide resistance;

(4) the application in the preparation and breeding of sunflower products with imidazolinone herbicide resistance;

(5) the application in sunflower breeding;

(6) application in the preparation of sunflower breeding products.

A detection method for sunflower imidazolinone herbicide resistance, which comprises the following steps:

s1, extracting genome DNA of the sunflower to be detected;

s2, using the genomic DNA extracted in the step S1 as a template, and using KASP labeled primers and/or a kit to carry out KASP reaction detection to obtain the genotype data of the sunflower to be detected;

s3, judging the resistance of the sunflower to the imidazolinone herbicides according to the genotype data of the step S2.

In some embodiments of the invention, if it is detected that the genotypes of AHAS1-HT3.1 and AHAS1-HT3.2 are both "C: C", the sunflower to be tested is determined to be an imidazolinone herbicide-intolerant sunflower; and if the genotypes of the AHAS1-HT3.1 and the AHAS1-HT3.2 are detected to be T: T and/or C: T, judging that the sunflower to be detected is the imidazolinone herbicide-resistant Imisun sunflower.

In some embodiments of the present invention, preferably, in step S1, the simplified CTAB method (cetyltrimethylammonium bromide method) is used for extracting genomic DNA from sunflower.

In some embodiments of the present invention, preferably, in step S2, the SNP molecular marker is detected by KASP (competitive allele specific PCR) technique.

In some embodiments of the invention, the variety of sunflower to be tested comprises oil sunflower, food sunflower and ornamental sunflower.

A sunflower breeding method comprises the following steps: according to the detection method, the sunflowers which are tolerant to the imidazolinone herbicide are selected for subsequent breeding.

It is known that three genes encoding the sunflower AHAS catalytic subunit are AHAS1 gene, AHAS2 gene and AHAS3 gene, which have high homology, wherein nucleotide sequence homology of AHAS1 and AHAS2 is 92%, nucleotide sequence homology of AHAS3 and AHAS1 is 72%, and nucleotide sequence homology of AHAS3 and AHAS2 is 73%, and the higher homology of the non-specific amplification sequence is, the easier the primer is combined with the non-specific amplification sequence, so that a non-specific fragment is amplified, and the effect of molecular marking is directly influenced. Due to their high degree of homology, it has been difficult to effectively distinguish between AHAS1, AHAS2, and AHAS 3. The primer with high specificity and single copy is designed at the difference of three nucleotide sequences of AHAS1, AHAS2 and AHAS3, the AHSH1 subunit can be distinguished specifically, and the imidazolinone herbicide-resistant Imisun plant can be identified accurately, quickly and efficiently.

In some embodiments of the invention, at least the following benefits are achieved: the KASP marker primer for detecting SNP mutation of sunflower AHAS1 gene can quickly and effectively distinguish the tolerance of sunflower to imidazolinone herbicides, and has good specificity and high detection rate. The invention combines the KASP mark detection method, and adopts a detection mode with high flux, high automation and low cost to obviously improve the detection efficiency and detection universality of the imidazolinone herbicide-resistant plants. Can quickly and effectively identify the sunflower which is resistant to the imidazolinone herbicide, has good stability and high flux, and has important significance in the breeding and auxiliary breeding processes of the sunflower.

Drawings

The invention is further described with reference to the following figures and examples, in which:

FIG. 1 is a flowchart of SNP molecular marker development in example 1 of the present invention;

FIG. 2 is a typing chart of the molecular marker AHAS1-HT3.1 in the test example of the present invention;

FIG. 3 is a typing chart of the molecular marker AHAS1-HT3.2 in the test example of the present invention;

FIG. 4 is a typing chart of the molecular marker AHAS1-HT3.1a according to the test example of the present invention;

FIG. 5 is a typing chart of the molecular marker AHAS1-HT3.1b of the test example of the present invention;

FIG. 6 is a typing chart of the molecular marker AHAS1-HT3.1c according to the test example of the present invention;

FIG. 7 is a typing chart of the molecular marker AHAS1-HT3.1d according to the test example of the present invention;

FIG. 8 is a typing chart of the molecular marker AHAS1-HT3.2a according to the test example of the present invention;

FIG. 9 is a typing chart of the molecular marker AHAS1-HT3.2b in the test example of the present invention;

FIG. 10 is a chart of the molecular markers AHAS1-HT3.2c according to the test example of the present invention;

FIG. 11 is a chart showing the typing of AHAS1-HT3.2d as a molecular marker in a test example of the present invention.

Detailed Description

The concept and technical effects of the present invention will be clearly and completely described below in conjunction with the embodiments to fully understand the objects, features and effects of the present invention. It is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments, and other embodiments obtained by those skilled in the art without inventive efforts are within the protection scope of the present invention based on the embodiments of the present invention.

In embodiments where specific techniques or conditions are not indicated, such techniques or conditions are in accordance with the description in the literature of the art or in accordance with the specifications for the product. The reagents and apparatus used are conventional products not indicated by the manufacturer and commercially available from normal sources.

Example 1 primer set for detecting imidazolone herbicide-resistant sunflower

The embodiment provides a primer group for detecting imidazolone herbicide-resistant sunflower, and the specific preparation and detection methods are as follows:

1. determination of SNP mutation sites

The design process of the molecular marker is shown in figure 1, the physical position is determined by cloned target gene AHAS1, SNP locus and flanking sequence are extracted, the marker is screened and verified by designing and synthesizing the primer sequence of the marker. AHAS1 is the main candidate gene for herbicide resistance in two wild populations of sunflower (ANN-PUR and ANN-KAN). The mutation at Ala205 (calculated as the AHAS amino acid position of the model plant arabidopsis thaliana) found in AHAS1 gene studies has been shown to confer imidazolinone (IMI) herbicide resistance in sunflower. The mutation was obtained by mutation of alanine (GCG) to valine (GTG) at codon 205 of AHAS1 gene. The SNP marker is developed aiming at codon 205 of AHAS1 gene, sunflower reference genome HanXRQr v2.0, variation site is positioned at sunflower Chr09, physical position is 180619420, and specific site information is shown in Table 1.

Table 1 SNP molecular marker locus information for sunflower AHAS1 resistance gene detection.

2. Primer design

The SNP marker is developed aiming at 205 codons of the AHAS1 gene, and the molecular marker designed based on the KASP reaction principle and the single base difference of the anti-susceptible material is utilized, so that the AHAS1 resistance gene detection can be carried out on the sunflower material in high flux.

Extracting 150bp flanking sequences before and after marking SNP locus AHAS1-HT3, and comparing three AHAS homologous genes: the differential sequences of AHSH1, AHSH2 and AHSH2 are used for positioning the variation regions of AHSH1, AHSH2 and AHSH2, primers with high specificity and single copy are designed at the differential positions, the target SNP site is subjected to primer design by using BatchPrimer3 software (http:// probes. pw. usda. gov/BatchPrimer3/), and a set of KASP markers are respectively designed on the sense strand and the antisense strand of the SNP site. AHAS1-HT3.1 represents a tag on the sense strand; AHAS1-HT3.2 represents a marker on the antisense strand.

Each KASP marker consists of three primers, including two allele-specific primers X (Primer _ X) and Y (Primer _ Y) and one universal Primer C (Primer _ C), wherein the 5' ends of the specific primers are respectively connected with the specific fluorescent groups FAM and HEX of KASP reaction of LGC company. If only FAM fluorescence is detected in the sample, the genotype of the sample is homozygous Allele X (Allele _ X), and the sample is judged to be sunflower (C: C) which is not resistant to the imidazolinone herbicide; if only HEX fluorescence is detected, the genotype of the sample is homozygous Allele Y (Allele _ Y), and the sample is judged to be imidazolinone herbicide-resistant Imisun sunflower (T: T); if FAM and HEX fluorescence is detected simultaneously, the genotype of the sample is heterozygous (carrying alleles X and Y simultaneously), and the sample is judged to be resistant to the imidazolinone herbicide Imisun sunflower (C: T). The allelic and primer sequences of the KASP marker used for sunflower AHAS1 resistance gene detection are shown in table 2.

TABLE 2

3. Sample detection

Extracting DNA of sunflower: a simplified CTAB method is adopted to extract genome DNA from sunflower leaves, and the method specifically comprises the following steps:

(1) taking about 30mg leaves to 1.3ml 96-well plate, placing in a freeze dryer, and vacuumizing for 12h or more; after the vacuum pumping is finished, adding two steel balls into each hole by using a bead separator, covering a silica gel film, grinding for 1min in a high-flux grinder, instantly separating in a deep-hole plate centrifuge after grinding, and centrifuging the ground tissues to the bottom of the hole.

(2) Adding 700 μ L CTAB extractive solution into each well with a pipetting workstation TECAN, shaking, mixing, placing in 65 deg.C water bath, warm bathing for 1-1.5h, and taking 1.3ml 96-well plate out of the vortex oscillator every 20min, and shaking for several times.

(3) After the completion of the warm bath, 1.3ml of a 96-well plate was taken out and placed in a deep-well plate refrigerated centrifuge and centrifuged at 4000rpm for 10 min.

(4) Transferring 380 mu L of supernatant per well into a new 1.3ml 96-well plate by using a liquid transfer workstation TECAN, adding equal volume of chloroform, reversing, uniformly mixing, standing for 2min, placing in a deep-well plate refrigerated centrifuge, centrifuging at 4000rpm for 10min, after centrifuging, extracting 250 mu L of supernatant into a 0.8ml 96-well plate added with 250 mu L of isopropanol in advance by using the liquid transfer workstation TECAN, carrying out vortex oscillation, uniformly mixing, and placing in a refrigerator at-20 ℃ for precipitation for 1h or more.

(5) Taking out 0.8ml 96-well plate, placing in a deep-well plate refrigerated centrifuge, centrifuging at 4000rpm for 15 min; discarding the supernatant, adding 250 μ L70% ethanol into each well with a pipetting workstation TECAN, oscillating several times on a vortex oscillator at 5000rpm, and centrifuging for 15 min; the supernatant was discarded and placed in an oven at 65 ℃ for 30min to dry it.

(6) Adding 200 μ L of sterilized ultrapure water into each well, standing at room temperature for overnight dissolution, and extracting DNA with quantity and quality required for PCR amplificationObtaining the ultraviolet light absorbance OD of the DNA solution, i.e., no degradation of the DNA₂₆₀And OD₂₈₀The ratio of the DNA concentration is preferably between 1.70 and 2.0, the concentration of the DNA is more than 30 ng/mu L, the total amount of the DNA is at least 2 mu g, the DNA of each seed is uniformly diluted to 30 ng/mu L after extraction is finished, and the DNA is stored at 4 ℃ for later use.

KaSP labeled sequencing reactions were performed using the Array Tape system of Douglas Scientific. The Array Tape genotyping platform comprises NEXAR for PCR amplification system assembly, sollex for PCR amplification, ARAYA for fluorescent signal scanning, and INTELLICS for data analysis.

Using the DNA extracted in this example as a template, the above-mentioned KASP-labeled primer mixture and PCR premix (KASP Master Mix) were added, and the following Table 3 shows the following PCR reaction system for KASP-labeled genotyping by automatically assembling the PCR amplification system using the NEXAR system of the Array Tape genotyping platform.

TABLE 3

Wherein, the 5' ends of the specific Primer _ X and the specific Primer _ Y are respectively added with a sequence label A and a sequence label B:

sequence tag A: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 8);

sequence tag B: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 9).

And (3) PCR amplification: PCR amplification was performed by SOELLEX under the following conditions: 15 minutes at 94 ℃; 94 ℃ for 20 seconds, 65 ℃ to 57 ℃ (0.8 ℃ reduction of annealing temperature per cycle) for 60 seconds, 10 cycles; 94 ℃ for 20 seconds, 57 ℃ for 60 seconds, 30 cycles.

Signal scanning and genotyping: after the PCR reaction is finished, carrying out fluorescent signal scanning on the reaction system by using ARAYA; genotyping and data analysis were then performed with INTELLICS.

Comparative example 1

The comparative example provides a labeled primer for detecting SNP mutation of sunflower AHAS1 gene, which comprises the following steps: flanking sequences of 150bp before and after 205 codons of AHAS1 gene are extracted, variation regions of AHSH1, AHSH2 and AHSH3 are positioned, primer design is carried out on target SNP sites by using BatchPrimer3 software (http:// probes. pw. usda. gov/BatchPrimer3/), and marker primer groups AHAS 1-3.1a and AHAS1-HT3.2a for detecting SNP mutation of sunflower AHAS1 gene are respectively designed on a sense strand and an antisense strand of the SNP sites.

Comparative example 2

The comparative example provides a marker primer for detecting SNP mutation of sunflower AHAS1 gene, which comprises the following steps: flanking sequences of 150bp before and after 205 codons of AHAS1 gene are extracted, variation regions of AHSH1, AHSH2 and AHSH3 are positioned, primer design is carried out on target SNP sites by using BatchPrimer3 software (http:// probes. pw. usda. gov/BatchPrimer3/), and marker primer groups AHAS 1-3.1b and AHAS1-HT3.2b for detecting SNP mutation of sunflower AHAS1 gene are respectively designed on a sense strand and an antisense strand of the SNP sites.

Comparative example 3

The comparative example provides a marker primer for detecting SNP mutation of sunflower AHAS1 gene, which comprises the following steps: flanking sequences of 150bp before and after 205 codons of AHAS1 gene are extracted, variation regions of AHSH1, AHSH2 and AHSH3 are positioned, primer design is carried out on target SNP sites by using BatchPrimer3 software (http:// probes. pw. usda. gov/BatchPrimer3/), and marker primer groups AHAS1-HT3.1c and AHAS1-HT3.1c for detecting SNP mutation of sunflower AHAS1 gene are respectively designed on a sense strand and an antisense strand of the SNP sites.

Comparative example 4

The comparative example provides a labeled primer for detecting SNP mutation of sunflower AHAS1 gene, which comprises the following steps: flanking sequences of 150bp before and after 205 codons of AHAS1 gene are extracted, variation regions of AHSH1, AHSH2 and AHSH3 are positioned, primer design is carried out on target SNP sites by using BatchPrimer3 software (http:// probes. pw. usda. gov/BatchPrimer3/), and marker primer groups AHAS 1-3.1d and AHAS1-HT3.1d for detecting SNP mutation of sunflower AHAS1 gene are respectively designed on a sense strand and an antisense strand of the SNP sites.

The nucleotide sequences of the labeled primers prepared in the comparative examples are shown in Table 4.

TABLE 4

Test example

1. Genotyping

The above KASP marker primers were verified by using the marker primer set for SNP mutation detection of sunflower AHAS1 gene provided in examples, AHAS1-HT3.1 and AHAS1-HT3.2, and AHAS1-HT3.1a, AHAS1-HT3.2a, AHAS1-HT3.1b, AHAS1-HT3.2b, AHAS1-HT3.1c, AHAS1-HT3.2c, AHAS1-HT3.1d, and AHAS1-HT3.2d, in which the total of resistant materials was 44 parts and the total of non-resistant materials was 24 parts, and by using 1 plate composed of 68 sunflower diversity materials having resistance to imidazolinone herbicide Imisun provided in comparative examples 1 to 4.

Typical typing results of KASP marker genotypes are shown in FIGS. 2-3 for 68 diversity of example marker AHAS1-HT3.1 and AHAS1-HT3.2, FIG. 2 for 68 diversity of marker AHAS1-HT3.1, FIG. 2 for 68 diversity of material, FIG. 3 for 68 diversity of marker AHAS1-HT3.2, and all have distinct 3 cluster structures, consistent with the expectations of the test, in the KASP marker genotyping test, the genotypes of the sample are divided into 3 clusters, X, Y and heterozygous. Wherein X cluster indicates that the sample contains a homozygous X allele at the KASP marker locus (red in the typing map, at the top left of the graph), Y cluster indicates that the sample contains a homozygous Y allele at the KASP marker locus (blue in the typing map, at the bottom right of the graph), and heterozygous genotype cluster indicates that the sample contains X and Y heterozygous alleles at the KASP marker locus (purple in the typing map). The results show that AHAS1-HT3.1 and AHAS1-HT3.2 can realize accurate typing, have high specificity, and can accurately and efficiently identify whether sunflower materials have imidazolinone herbicide resistance.

AHAS1-HT3.1a, AHAS 1-HT3.2a; AHAS1-HT3.1b, AHAS 1-HT3.2b; AHAS1-HT3.1c, AHAS 1-HT3.2c; the detection results of AHAS1-HT3.1d and AHAS1-HT3.2d are shown in FIGS. 4-11, and the markers AHAS1-HT3.1a, AHAS1-HT3.1b, AHAS1-HT3.1c, AHAS1-HT3.1d, AHAS1-HT3.2a, AHAS1-HT3.2b, AHAS1-HT3.2c and AHAS1-HT3.2d are in dispersion type, and have no obvious 3-cluster structure, so that the drug-resistant/sensitive material of the imidazolinone herbicide cannot be verified.

2. Specificity and utility assays

To verify the specificity and utility of the KASP-tagged primers of the present invention, two KASP-tagged primer sets AHAS1-HT3.1 and AHAS1-HT3.2 were tested using 68 sunflower diversity materials known to be resistant to the AHSH1 gene of an imidazolinone herbicide and not to the AHSH1 gene of an imidazolinone herbicide, where the total of the resistant materials was 44 parts and the total of the non-resistant materials was 24 parts. Specific material information is shown in table 5.

TABLE 5

As can be seen from Table 5, the KASP marker primer obtained by screening of the invention is used for verifying the sunflower diversity material with 68 known imidazolinone herbicide AHSH1 gene resistance and imidazolinone herbicide AHSH1 gene resistance to two KASP marker primer sets AHAS1-HT3.1 and AHAS1-HT3.2, and the identification result is consistent with the expectation, and the result shows that AHAS1-HT3.1 and AHAS1-HT3.2 can realize accurate typing, have high specificity and can accurately and efficiently identify whether the sunflower material has the imidazolinone herbicide resistance.

Sunflower contains 3 different AHAS genes (only 1 mutation has good herbicide tolerance). Because the AHAS gene is a multi-copy gene, the KASP marker is only suitable for detecting single-site SNP variation, so that the development of a KASP marker method with herbicide-tolerant copy characteristics is very difficult, molecular markers of herbicide-tolerant sunflowers in related technologies are all based on SSCP or CAPS markers of the same SNP site, and the interference of multi-copy is avoided to a certain extent, but the SSCP or CAPS markers have low flux, high cost, complex technology and time consumption, and basically, breeders rarely use the SSCP or CAPS markers for screening and directly use the herbicides for screening. The scheme of the application obtains the KASP marker primer combination with high-quality herbicide-tolerant copy characteristics only by carrying out sequence comparison on the specific sequence positions of different copies of the AHAS gene and carrying out design verification on a large number of KASP, and can distinguish the sunflower plants which are not herbicide-tolerant, have herbicide-tolerant heterozygosis and have pure herbicide tolerance.

In conclusion, the invention provides the marker primer combination for detecting the SNP mutation of the sunflower AHAS1 gene, which has the advantages of good marking quality, high sensitivity, high resolution and high specificity, can accurately and specifically identify the SNP mutation site in the sunflower AHSH1 gene, and can be used for detecting whether sunflower materials from different sources have the resistance of the imidazolinone herbicide Imisun.

The embodiments of the present invention have been described in detail with reference to the drawings, but the present invention is not limited to the embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the gist of the present invention. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.

Sequence listing

<110> Huazhi Biotechnology Ltd

<120> primer group and kit for detecting imidazolone herbicide-resistant sunflower and application of primer group and kit

<160> 29

<170> SIPOSequenceListing 1.0

<210> 1

<211> 524

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgtcaatgga gatccaccaa gctctcacgc gctcaagcac tatccgcaat gtgctccccc 60

gtcacgaaca gggcggcgtg ttcgccgccg aaggctacgc gcgcgcctcc ggtcttcccg 120

gcgtgtgtat cgccacttcc ggtcccggag ctacgaacct agttagtggt cttgctgacg 180

cgctgttaga cagtgtcccc atggtggcaa tcaccggtca agttccccgg agaatgatcg 240

gaaccgatgc gtttcaagaa accccaattg ttgaggtaac acgttcgatc actaaacata 300

attatcttgt gttggatgtt gaggatattc ccagaattgt tcgtgaggct ttttatcttg 360

cgagttcggg tcgacccggc ccggttttga tagatgtacc gaaagatata cagcaacagt 420

tagtggtgcc gaaatgggat gaaccgatga ggttaccggg ttatttgtct agaatgccga 480

agcctcaata tgatgggcat ttggaacaga ttgttaggtt ggtg 524

<210> 2

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaaggtgacc aagttcatgc tcggagaatg atcggaaccg atgt 44

<210> 3

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaaggtcgga gtcaacggat tggagaatga tcggaaccga tgc 43

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aactcgcaag ataaaaagcc tcacg 25

<210> 5

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaaggtgacc aagttcatgc tcaacaattg gggtttcttg aaaca 45

<210> 6

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gaaggtcgga gtcaacggat tcaacaattg gggtttcttg aaacg 45

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acttccggtc ccggagctac g 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaaggtgacc aagttcatgc t 21

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaaggtcgga gtcaacggat t 21

<210> 10

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaaggtgacc aagttcatgc tcggagaatg atcggaaccg atgt 44

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaactcgcaa gataaaaagc ctcac 25

<210> 12

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaaggtgacc aagttcatgc tggagaatga tcggaaccga tgt 43

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtacatctat caaaaccggg cc 22

<210> 14

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gaaggtcgga gtcaacggat tcggagaatg atcggaaccg atgc 44

<210> 15

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gctgtatatc tttcggtaca tctatcaaa 29

<210> 16

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gaaggtgacc aagttcatgc tgagaatgat cggaaccgat gt 42

<210> 17

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gaaggtcgga gtcaacggat tgagaatgat cggaaccgat gc 42

<210> 18

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ataaaaagcc tcacgaacaa ttctg 25

<210> 19

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gaaggtgacc aagttcatgc tcaacaattg gggtttcttg aaaca 45

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

tgtgtatcgc cacttccggt c 21

<210> 21

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gaaggtgacc aagttcatgc taacaattgg ggtttcttga aaca 44

<210> 22

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gaaggtcgga gtcaacggat taacaattgg ggtttcttga aacg 44

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cggcgtgtgt atcgccactt 20

<210> 24

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

gaaggtgacc aagttcatgc ttcaacaatt ggggtttctt gaaaca 46

<210> 25

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

gaaggtcgga gtcaacggat ttcaacaatt ggggtttctt gaaacg 46

<210> 26

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

ctacgaacct agttagtggt cttgct 26

<210> 27

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

gaaggtgacc aagttcatgc tacaattggg gtttcttgaa aca 43

<210> 28

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

gaaggtcgga gtcaacggat tacaattggg gtttcttgaa acg 43

<210> 29

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 29

gtcttcccgg cgtgtgtat 19

Claims

1. A primer group, wherein the primer group is AHAS1-HT3.1 and/or AHAS1-HT 3.2;

2. The Primer set of claim 1, wherein the 5' ends of the specific Primer Allole X1 and the specific Primer Allole Y1 respectively carry sequence tag A and sequence tag B, the nucleotide sequences of the sequence tag A and the sequence tag B are different from each other and are different from sunflower genome sequence;

the 5' end of the specific Primer Allole X2 and the specific Primer Allole Y2 is respectively provided with a sequence label A and a sequence label B, and the nucleotide sequences of the sequence label A and the sequence label B are different from each other and are different from the sunflower genome sequence;

preferably, the sequence tag A is GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 8);

preferably, the sequence tag B is GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 9).

3. A kit, comprising: the primer set according to claim 1 or 2.

4. The kit of claim 3, further comprising a PCR premix comprising fluorescent probe A, fluorescent probe B, quenching probe A, and quenching probe B;

the nucleotide sequence of the fluorescent probe B is consistent with that of the sequence label B, and the 5' end of the fluorescent probe B is connected with a fluorescent group B; the nucleotide sequence of the quenching probe B is reversely complementary with the nucleotide sequence of the sequence label B, and the 3' end of the quenching probe A is connected with a quenching group;

preferably, the fluorophore A and the fluorophore B are different from each other.

5. The kit according to claim 4, wherein the fluorophore A and the fluorophore B are selected from FAM and HEX.

6. A gene chip comprising the KASP marker primer of claim 1 or 2.

7. The primer set according to claim 1 or 2, the kit according to any one of claims 3 to 5 and/or the gene chip according to claim 6, for any one of the following applications:

(2) the application in the preparation of sunflower products for identifying or assisting in identifying imidazolinone herbicide-resistant sunflowers;

(5) the application in sunflower breeding;

(6) application in the preparation of sunflower breeding products.

8. A detection method for sunflower imidazolinone herbicide resistance is characterized by comprising the following steps:

s1, extracting genome DNA of the sunflower to be detected;

s2, using the genomic DNA extracted in the step S1 as a template, using the KASP marker primer of any one of claims 1-3 and the kit of claim 4 or 5 to perform KASP reaction detection, and obtaining the genotype data of the sunflower to be detected;

and S3, judging the resistance of the sunflower to the imidazolinone herbicide according to the genotype data of the step S2.

9. The detection method according to claim 8, wherein the variety of the sunflower sample to be detected comprises at least one of oil sunflower, food sunflower and ornamental sunflower.

10. A sunflower breeding method is characterized by comprising the following steps: subsequent breeding of imidazolinone herbicide-tolerant sunflowers is selected using the method of claim 8.