CN106554992A - Detect the test kit of the Campylobacter spp of resistance to erythromycin - Google Patents
Detect the test kit of the Campylobacter spp of resistance to erythromycin Download PDFInfo
- Publication number
- CN106554992A CN106554992A CN201510628973.4A CN201510628973A CN106554992A CN 106554992 A CN106554992 A CN 106554992A CN 201510628973 A CN201510628973 A CN 201510628973A CN 106554992 A CN106554992 A CN 106554992A
- Authority
- CN
- China
- Prior art keywords
- erythromycin
- campylobacter spp
- resistance
- specific primer
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides the test kit of the detection Campylobacter spp of resistance to erythromycin.By carrying out erythromycin-resistant analysis to detached Campylobacter spp, 23SrDNA sequencings are carried out to the bacterial strain of MIC >=16 μ g/ml, obtain the mutational site of erythromycin-resistant bacterial strain 23SrDNA genes and the presence situation of erythromycin-resistant cognate ribosome RNA methylases gene ermB, there is provided for detecting the specific primer in the mutational site of erythromycin-resistant bacterial strain to the specific primer pair with detection ermB genes, its nucleotide sequence is respectively such as SEQ ID NO:Shown in 1-4, and then there is provided the duplex PCR method and its matched reagent box of the detection Campylobacter spp of resistance to erythromycin.The test kit of the present invention has detection accurate, and sensitivity is high, high specificity, simple and rapid advantage, with good clinical.
Description
Technical field
The present invention relates to duplex PCR detection technique field, more particularly to resistance to red for detecting
The test kit of mycin Campylobacter spp.
Background technology
Campylobacter spp is the main foodborne pathogens for causing human diseasess, causes the mankind to suffer from diarrhoea
Main pathogen.In developed countries such as America and Europes, the infection of Campylobacter spp occupies foodborne pathogens
The first place of infection, the infection rate of developing country's Campylobacter spp are 100 times of developed country.Except intestinal
Scorching outer, the infection of campylobacter jejuni can cause Guillain-Barre syndrome, give people class and bring seriously
Disease Spectrum.Research finds that the resistance problems of Campylobacter spp are increasingly severe, and infection drug resistance is curved
After aspergillosiss, Disease Spectrum is also dramatically increased.The campylobacter infection of China's treatment at present especially children's diarrhae
Choice drug be macrolide antibiotics.Erythromycin is the main medicine for treating campylobacter infection
Thing.This seminar of early stage finds China more than 50% for the antibiotics sensitivity analysis of Campylobacter spp
Bending bacteria strain to erythromycin-resistant, for erythromycin-resistant gene quick detection for red
The identification of mycin drug resistance Campylobacter spp is significant.
, in severe bacteria, condition of in vitro culture is higher for Campylobacter, while the Campylobacter spp for using at present
Antibiotic Drug Resistance Detection method, agar dilution or e-test methods experiment complex steps,
Experienced professional's operation is needed, and the time is longer, dashed forward using the detection of fast PCR
The drug resistant gene of change, can quickly obtain the drug-resistance characteristics of isolated strains.At present, the country still lacks
The resistance to erythromycin in weary substantial amounts of China source bends the sequence alignment of bacterial strain, therefore can not find suitable
Close special easy, the efficient detection method that Chinese resistance to erythromycin bends bacterial strain.
The content of the invention
It is an object of the invention to provide the specific primer for detecting the Campylobacter spp of resistance to erythromycin
To combination；It is still another object of the present invention to provide can quickly, it is easy, accurately detect red
The test kit of mycin Campylobacter spp.
For achieving the above object, carried out by 1000 plants of jejunums to collecting, Campylobacter Coli
Erythromycin-resistant is analyzed, and carries out 23SrDNA sequencings to the bacterial strain of MIC >=16 μ g/ml,
By compare, obtain Resistant strain compared with sensitive strain, 23SrDNA sequencing specificity
And mutational site, the mutational site of erythromycin-resistant bacterial strain 23SrDNA genes is located at bending
The A2075G of bacterium 23SrDNA, the method being sequenced by gene order-checking and PCR primer are obtained
Obtain the distribution characteristicss and erythromycin-resistant cognate ribosome of China's Resistant strain ermB gene
The sequence of RNA methylases gene ermB, according to 23SrDNA sequence signatures and ermB
The sequence signature of gene, Vector NTI Suite 6 use Primer Premier 5, Oligo after comparing
7, in the conserved region of the catastrophe point and ermB gene orders of specific DNA sequence, design
Duplex PCR primer.
Present invention firstly provides a kind of specific primer for detecting the Campylobacter spp of resistance to erythromycin
To combination, which is respectively directed to the A2075G bit bases mutation of Campylobacter spp 23SrDNA, and pin
To ribosomal RNA methylases gene ermB.
Preferably, the specificity being mutated for the A2075G bit bases of Campylobacter spp 23SrDNA
The nucleotides sequence of primer pair is classified as：
23SRNA-F：TTAGCTAATGTTGCCCGTACCG(SEQ ID NO.1)
23SA2075G-R：TAGTATAGGTCCACGGGGTCTC(SEQ ID NO.
2)；
For the nucleotide of the specific primer pair of ribosomal RNA methylases gene ermB
Sequence is：
ermB-F2：CGTACCTTGGATATTCACCG(SEQ ID NO.3)
ermB-R2：GGCGTGTTTCATTGCTTG(SEQ ID NO.4).
The invention provides above-mentioned specific primer is preparing the resistance to erythromycin bending of detection to combination
Application in bacterium test kit.
The protection model of the present invention is fallen within to the test kit for combining containing above-mentioned specific primer
Enclose.
Further, test kit of the invention be with above-mentioned specific primer to being combined as primer,
With bacterium DNA to be measured as template, duplex PCR is carried out, amplified production is carried out into agarose and is coagulated
Gel electrophoresis, if electrophoresis result shows purpose band for 493bp and/or 258bp, bacterium to be measured
For the Campylobacter spp of resistance to erythromycin.
25 μ l reaction systems of the duplex PCR are
The response procedures of the duplex PCR are：94 DEG C of denaturations 5min；94 DEG C of degeneration 30s,
59 DEG C of annealing 30s, 72 DEG C of extension 45s, totally 30 circulations；72℃5min.
The invention provides a kind of specific primer pair of the detection Campylobacter spp of resistance to erythromycin, its core
Nucleotide sequence respectively as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4.
The invention provides containing nucleotide sequence drawing as shown in SEQ ID NO.1-2 respectively
The test kit or diagnostic reagent of thing.
Present invention also offers containing nucleotide sequence respectively as shown in SEQ ID NO.3-4
The test kit or diagnostic reagent of primer.
The invention provides the A2075G bit bases mutation of Campylobacter spp 23SrDNA is preparing inspection
The application surveyed in the Campylobacter spp of resistance to erythromycin test kit.
The invention provides the Campylobacter spp of resistance to erythromycin ermB genes are preparing the resistance to erythromycin of detection
Application in Campylobacter spp test kit, the nucleotide sequence such as SEQ ID of the ermB genes
Shown in NO.6.
At present, not yet there is the test kit of the detection Campylobacter spp of resistance to erythromycin on domestic market, it is clinical
For the main or agar dilution or e-test methods of the Campylobacter spp of resistance to erythromycin detection.This
It is bright to have carried out the comparison of testing result in embodiment with agar dilution.Test kit of the present invention
Detection sensitivity and specificity are 100%, and accuracy is suitable with agar dilution, during detection
Between be far below agar dilution.Common laboratory is made also to carry out erythromycin-resistant Campylobacter spp
Detection.The popularization and application of test kit of the present invention are conducive to quickly and accurately detecting resistance to red mould
Plain Campylobacter spp, and can help instruct the clinical correctly taking drugs for Campylobacter spp.
Description of the drawings
Fig. 1 is ermB gene screening agarose gel electrophoresiies results, and wherein M is Trans 2K
DAN Marker, swimming lane 1-10 are the bending bacterial strain to erythromycin-resistant of different separation strains,
Swimming lane 11 is erythromycin-sensitive bacterial strain.
Fig. 2 is the electrophoresis result that duplex PCR of the present invention detects Campylobacter spp, wherein, M:marker
1:The A2075G site mutation bacterial strain SH-CCH11C333 of 23SrDNA, 2:23SrDNA
A2075G site mutation bacterial strain SH-CCH11C334,3:ErmB gene-positive strains
SH-CCD11C294,4:Not only comprising 23SrDNA A2075G site mutations but also include
ErmB gene-positive strains SH-CCD11C294,5:Erythromycin-sensitive bacterial strain.
Specific embodiment
Following examples further illustrate present disclosure, but should not be construed as to the present invention
Restriction.Without departing from the spirit and substance of the case in the present invention, to the inventive method, step
Suddenly modification or replacement that, luminous or quenching group, probe structure or condition are made, belong to
In the scope of the present invention.
If not specializing, in embodiment, technological means used are those skilled in the art institute
Well known conventional meanses.
1 erythromycin-resistant of embodiment bends bacterial strain DNA sequence feature
1st, China's sky, Campylobacter Coli erythromycin-resistant feature
Through to 1000 plants of different hosts source bacterial strain (wherein clinical diarrhea patients of isolated in China
450 plants of separation strains) erythromycin sensitive detection and analysis, 158 plants are determined for erythromycin-resistant
Strain (>=16 μ g/ml).
2nd, the resistance to erythromycin sky of China, Campylobacter Coli resistance mechanism
Resistance mechanism analysis is carried out for 158 plants of erythromycin-resistant strains：Ribosome is carried out first
The PCR amplifications of protein 23 SrDNA and sequence analysis (primer sequence is shown in Table 1), PCR are produced
Thing is by Beijing Tian Yihuiyuan Bioisystech Co., Ltd and holds up the limited public affairs of the new industry biotechnology of section
Department is sequenced, and sequencing result is compared with standard sequence；It is simultaneously resistance to all erythromycin
Medicine bacterial strain carries out macrocyclic lactone drug resistance related gene, and methylases gene ermB enters performing PCR
Examination (primer sequence is shown in Table 1).
The sequence analysis of 23SrDNA are proved, in 158 plants of erythromycin-resistant Campylobacter spps, 131
To A2075G site mutations, 27 plants (Campylobacter Colis) only contain for strain (83%) only examination
There are ermB genes (17%), 3 plants of bacterium not only containing ermB genes but also occurred 23SrDNA's
A2075G site mutations.The A2075G site mutations of ribosomal protein 23SrDNA and
The positive of ermB genes is the dominant mechanism (100%) of China's bacterial strain erythromycin-resistant.
The A2075G site mutations and ermB gene PCRs amplimer and primer sequence of 1 23SrDNA of table
3rd, the A2075G site mutations of 23SrDNA and ermB gene PCR systems：
4th, the A2075G site mutations of 23SrDNA and ermB gene PCR reaction intervals
Sequence：4 DEG C, 5min；94 DEG C, 30s, 55 DEG C, 30s, 72 DEG C, 30s, 35 circulations；
72 DEG C, 7min；4 DEG C of holdings.
5th, the A2075G site mutations sequencing sequence of 23SrDNA such as SEQ ID NO.5 institutes
Show.Wherein 26-47 positions are the sequence of 23S-F primers, the 497th generation A-G in sequence
Mutation.The sequence of ermB genes is as shown in SEQ ID NO.6.According to ermB gene screenings
As a result, in 158 plants of erythromycin-resistant Campylobacter spps, 30 plants of (18.99%) examinations to ermB
Gene.Part bacterial strain screening results electrophoretogram is shown in Fig. 1.
2 duplex PCR of embodiment detects the foundation of the Campylobacter spp of resistance to erythromycin method
1st, the A2075G site mutation design of primers of 23SrDNA：
Using the forward primer (23S-F of the sequencing primer of the 23SrDNA of embodiment 1：
Shown in 5-TTAGCTAATGTTGCCCGTACCG-3, SEQ ID NO.1), according to
The series jump feature of erythromycin-resistant strains A 2075G, designs downstream primer
(23SA2075G-R:5-TAGTATAGGTCCACGGGGTCTC-3, SEQ ID
Shown in NO.2):Primer sequence and PCR primer size are shown in Table 2.Amplified production sequence such as SEQ
Shown in ID NO.7.
The primer combination of 2 duplex PCR of table
2nd, the primer for expanding ermB genes is shown in Table 2.Amplified production sequence such as SEQ ID NO.8
It is shown.
3rd, while expanding the A2075G mutational sites of 23SrDNA and the multiplex PCR of ermB genes
Foundation and checking
4th, two are set up to (being shown in Table 2) according to 2 pairs of Specific PCR primers of above-mentioned foundation
The reaction system of weight PCR, optimizes reaction condition, obtains simultaneously examination 23SrDNA's
The duplex PCR detection method of A2075G mutational sites and ermB genes.Simultaneously for discovery
100 plants of erythromycin-resistant bacterial strains and 100 plants of erythromycin-sensitive bacterial strains carry out double primer
PCR is verified.Duplex PCR system：
5th, PCR reaction conditions：94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 59 DEG C of annealing
30s, 72 DEG C of extension 45s, totally 30 circulations；72℃5min.
6th, PCR amplifications：PCR reactions show the A2075G site mutations sun of 23SrDNA
Property bacterial strain obtain 493bp fragments, ermB gene-positive strains obtain the fragment of 258bp, and red
Mycin sensitive strain, PCR amplifications are negative, show that this detection method can detect erythromycin-resistant
Campylobacter spp.PCR electrophoresis pictures are shown in Fig. 2.
7th, the result of PCR detection method
For the inspection of 225 plants of Campylobacter spps (125 plants of erythromycin-resistants, 100 plants of erythromycin-sensitives)
Survey result and be summarized in table 3.
3 agarose dilution method of table and duplex PCR the result statistical analysiss of the present invention
The studies above result shows that the agar that this research method can substitute complex operation step is dilute
Interpretation of the law, it is quick to determine whether Campylobacter spp occurs erythromycin-resistant.
Based on the mechanism that the present invention produces drug resistance by cause of disease, the Campylobacter spp of resistance to erythromycin is obtained first
Resistance mechanism, i.e. distribution characteristicss of DNA mutation feature and specific gene, further according to mutation
DNA sequence feature, obtain the special DNA sequence feature of mutant strain, set up multiplex PCR
Screening method, for produce two PCR primers in any one or while exist 2 expansion
Increase band (258bp and/or 493bp) to can determine whether for erythromycin-resistant bacterial strain, and for amplification
Negative bacterial strain, can determine whether for erythromycin-sensitive bending bacteria strain (during actually detected,
Then bacterial strain is identified by the duplex PCR method of the present invention again firstly the need of Campylobacter spp is accredited as
Whether it is erythromycin-sensitive bending bacterial strain).The multi-PCR detection method set up using this research
Sensitivity, specificity to erythromycin-resistant Campylobacter spp Bacteria Detection is 100%.According to this
The detection Campylobacter spp of the resistance to erythromycin test kit that invention duplex PCR method is set up is simple to operate, accurately
Degree is high, greatly reduces testing cost, has saved the time.
Although above making to the present invention with a general description of the specific embodiments
Describe in detail, but on the basis of the present invention, it can be made some modifications or improvements, this
Will be apparent to those skilled in the art.Therefore, without departing from spirit of the invention
On the basis of these modifications or improvements, belong to the scope of protection of present invention.
Claims (10)
1. a kind of for detecting the specific primer of the Campylobacter spp of resistance to erythromycin to combination, its difference
It is mutated for the A2075G bit bases of Campylobacter spp 23SrDNA, and is directed to ribosomal RNA
Methylases gene ermB.
2. specific primer according to claim 1 is to combination, it is characterised in that pin
The nucleotide of the specific primer pair are mutated by the A2075G bit bases of Campylobacter spp 23SrDNA
Sequence is as shown in SEQ ID NO.1-2；
For the nucleotide of the specific primer pair of ribosomal RNA methylases gene ermB
Sequence is as shown in SEQ ID NO.3-4.
3. the arbitrary described specific primer of claim 1-2 is resistance to red in preparation detection to combination
Application in mycin Campylobacter spp test kit.
4. containing the arbitrary specific primer of claim 1-2 to combine test kit.
5. test kit as claimed in claim 4, it is characterised in that with claim 1 or
Specific primer described in 2 carries out two to being combined as primer with bacterium DNA to be measured as template
Amplified production is entered row agarose gel electrophoresis by weight PCR, if electrophoresis result shows purpose bar
Band is 493bp and/or 258bp, then bacterium to be measured is the Campylobacter spp of resistance to erythromycin.
6. test kit as claimed in claim 5, it is characterised in that the duplex PCR
25 μ l reaction systems be：
7. method according to claim 5, it is characterised in that the duplex PCR
Response procedures be：94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 59 DEG C of annealing 30s, 72
DEG C extend 45s, totally 30 circulation；72℃5min.
8. a kind of specific primer pair of the detection Campylobacter spp of resistance to erythromycin, its nucleotide sequence point
Not as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4.
9. the A2075G bit bases mutation of Campylobacter spp 23SrDNA is resistance to red mould in preparation detection
Application in plain Campylobacter spp test kit.
10. the Campylobacter spp of resistance to erythromycin ermB genes are preparing the detection Campylobacter spp of resistance to erythromycin reagent
Application in box, the nucleotide sequence of the ermB genes is as shown in SEQ ID NO.6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510628973.4A CN106554992A (en) | 2015-09-28 | 2015-09-28 | Detect the test kit of the Campylobacter spp of resistance to erythromycin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510628973.4A CN106554992A (en) | 2015-09-28 | 2015-09-28 | Detect the test kit of the Campylobacter spp of resistance to erythromycin |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106554992A true CN106554992A (en) | 2017-04-05 |
Family
ID=58415883
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510628973.4A Pending CN106554992A (en) | 2015-09-28 | 2015-09-28 | Detect the test kit of the Campylobacter spp of resistance to erythromycin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106554992A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115807013A (en) * | 2022-08-25 | 2023-03-17 | 四川大学华西医院 | PhoP gene mutant, application and verification method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102223794A (en) * | 2008-10-24 | 2011-10-19 | 森普拉制药公司 | Methods for treating resistant diseases using triazole containing macrolides |
| CN103421892A (en) * | 2013-05-24 | 2013-12-04 | 华中农业大学 | Multiple real-time fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni |
| CN103484538A (en) * | 2013-08-27 | 2014-01-01 | 中国检验检疫科学研究院 | Composition and method for detecting drug resistance of enterococci |
| CN104232740A (en) * | 2013-06-06 | 2014-12-24 | 中国农业大学 | Primers and method for detecting campylobacter 23S rRNA gene mutation site |
-
2015
- 2015-09-28 CN CN201510628973.4A patent/CN106554992A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102223794A (en) * | 2008-10-24 | 2011-10-19 | 森普拉制药公司 | Methods for treating resistant diseases using triazole containing macrolides |
| CN103421892A (en) * | 2013-05-24 | 2013-12-04 | 华中农业大学 | Multiple real-time fluorescent PCR method for identifying the drug-resistant mutation of macrolides and for identifying Campylobacter jejuni |
| CN104232740A (en) * | 2013-06-06 | 2014-12-24 | 中国农业大学 | Primers and method for detecting campylobacter 23S rRNA gene mutation site |
| CN103484538A (en) * | 2013-08-27 | 2014-01-01 | 中国检验检疫科学研究院 | Composition and method for detecting drug resistance of enterococci |
Non-Patent Citations (1)
| Title |
|---|
| YANG WANG等: "Emergence of Multidrug-Resistant Campylobacter Species Isolates with a Horizontally Acquired rRNA Methylase", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115807013A (en) * | 2022-08-25 | 2023-03-17 | 四川大学华西医院 | PhoP gene mutant, application and verification method thereof |
| CN115807013B (en) * | 2022-08-25 | 2023-11-21 | 四川大学华西医院 | PhoP gene mutant, application and verification method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898227B (en) | A kind of Nucleotide to Cronobacter sakazakii O antigen-specific and application thereof | |
| Løbersli et al. | Molecular differentiation of Shigella spp. from enteroinvasive E. coli | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN109868324A (en) | One species-specific primer and its detection method | |
| US20110287965A1 (en) | Methods and compositions to detect clostridium difficile | |
| CN104232783B (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| Bidet et al. | Identification of group A streptococcal emm types commonly associated with invasive infections and antimicrobial resistance by the use of multiplex PCR and high-resolution melting analysis | |
| CN111793704A (en) | SNP molecular marker for identifying Brucella vaccine strain S2 and wild strain and application thereof | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN108384871A (en) | Ovine Piroplasma worm detects and mirror method for distinguishing and kit | |
| CN105189781B (en) | The probability-guide of nucleotide sequence separates (PINS) | |
| CN106011154B (en) | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application | |
| CN102851383A (en) | LAMP kit for rapid detection of Salmonella | |
| Xu et al. | Comparative genomics of Mycoplasma synoviae and new targets for molecular diagnostics | |
| CN106554992A (en) | Detect the test kit of the Campylobacter spp of resistance to erythromycin | |
| CN104846067A (en) | Duplex PCR detection kit and detection method for Listeria monocytogenes and Enterococcus faecium | |
| CN109680086A (en) | A kind of primer sets detecting small micro- monad and its detection architecture and application | |
| CN113136443B (en) | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis | |
| CN109652573B (en) | For Salmonella typhimurtum or the site VNTR, detection primer group and the determination method of its single-phase bacterium mutation parting detection | |
| CN107988400A (en) | Detect the reagent set of staphylococcus haemolyticus | |
| Reinert et al. | Relationship between the original multiply resistant South African isolates of Streptococcus pneumoniae from 1977 to 1978 and contemporary international resistant clones | |
| CN105886622A (en) | Primer and method for fast typing campylobacter jejuni | |
| Silva et al. | Genomic and Phenotypic Characterization of Campylobacter fetus subsp. venerealis Strains. Microorganisms 2021, 9, 340 | |
| CN104293966A (en) | Double PCR (polymerase chain reaction) detection method for haemophilus parasuis | |
| CN110358851B (en) | Nucleic acid sequence, primer, method and kit for detecting bacillus cereus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170405 |
|
| RJ01 | Rejection of invention patent application after publication |