CN104232740A - Primers and method for detecting campylobacter 23S rRNA gene mutation site - Google Patents
Primers and method for detecting campylobacter 23S rRNA gene mutation site Download PDFInfo
- Publication number
- CN104232740A CN104232740A CN201310222703.4A CN201310222703A CN104232740A CN 104232740 A CN104232740 A CN 104232740A CN 201310222703 A CN201310222703 A CN 201310222703A CN 104232740 A CN104232740 A CN 104232740A
- Authority
- CN
- China
- Prior art keywords
- rrna gene
- primer
- campylobacter spp
- campylobacter
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primers and a method for detecting a campylobacter 23SrRNA gene mutation site. The invention provides the primer group for detecting or assistantly detecting the campylobacter 23S rRNA gene mutation site. The primer group comprises a specific fragment amplification primer pair and a sequencing primer. The specific fragment amplification primer pair comprises a single-chain DNA molecule shown in the formula 1 in the sequence table and a single-chain DNA molecule shown in the formula 2 in the sequence table. The sequencing primer is a single-chain DNA molecule shown in the formula 2 in the sequence table. An experiment proves that the primers and method for pyrophosphoric acid sequencing can be used simply, have a fast reaction rate and can determine if the bacterial strain to be detected can resist erythromycin by the direct sequencing result mutation.
Description
Technical field
The present invention relates to biological technical field, particularly relate to a kind of primer and the method that detect Campylobacter spp 23S rRNA gene mutation site.
Background technology
Thermophilic Campylobacter spp is one of most important food-borne pathogens causing people's acute gastroenteritis, and the Campylobacter spp enteritis of more than 95% is all caused by campylobacter jejuni and Campylobacter Coli clinically.Jejunum/Campylobacter Coli is propagated to people by food chain, and the poultry of pollution, milk and tap water are all main routes of transmission.Erythromycin is typical Macrocyclolactone lactone kind medicine, also be clinically for the first-line treatment medicine of campylobacter infection simultaneously, and the appearance of resistance Campylobacter spp causes campylobacteriosis course of disease protracted course of disease and Endodontic failure clinically, great threat human health, Resistant strain also causes the problems such as treatment cost increase, causes huge financial loss.Campylobacter spp mainly mediated by the active centre transgenation of rrna 23S rRNA peptidy transeferace erythromycin performance resistance.Because Campylobacter spp contains the rrna 23S rRNA of 3 copies, be therefore necessary the 2075 site detection by quantitative to the Campylobacter spp of resistance to erythromycin rrna 23S rRNA gene.
Traditional medicament sensitivity test method and genotype mutations detection method is mainly contained at present for the method detecting Campylobacter spp resistance, genotype mutations detection method mainly contains polymerase chain reaction Line probe assay, polymerase chain reaction restriction fragment length polymorphism analysis method, mispairing amplification Polymerase chain reation method, and the method such as fluorescent quantitative poly chain reaction method.Traditional Campylobacter spp medicament sensitivity test needs to carry out Campylobacter spp cultivation, requires higher culture condition, requires a great deal of time, and does not meet the urgent Prevention and cure of epidemic situation requirements of one's work of acute infectious disease; Other genotype mutations detection method costs based on polymerase chain reaction are higher, are not suitable for detecting a large amount of sample, and are only qualitative tests, cannot carry out the quantitative test of mutation gene copy number.
Pyrosequencing techniques is that the one that developed recently gets up relies on noclilucence to carry out deoxynucleotide (DNA) sequential analysis new technology, it is the mutation detection techniques uniquely obtaining Quantitative Sequence result at present, the object of the sequence of the real time measure DNA can be reached, this technology does not need fluorescently-labeled primer or nucleic acid probe, there is the accuracy that analytical results is quick, accurate and high, circulation ratio is good, and the feature of automatization.A kind of universal technology platform, diverse in function, Application Areas is extensive, have the feature of high-throughput, low cost, polymerase chain reaction (PCR) product can be directly used in order-checking, does not need to carry out product secondary treatment, easy and simple to handle, the feature that required sample size is little.Detect at Manganic pyrophosphate complex initiation in the process of sudden change, object fragment well to be increased and the determination for the treatment of location point is the key of whole experiment.
Summary of the invention
An object of the present invention is to provide the primer sets of detection or auxiliary detection Campylobacter spp 23S rRNA gene mutation site.
The primer sets of detection provided by the invention or auxiliary detection Campylobacter spp 23S rRNA gene mutation site, is made up of with sequencing primer specific fragment amplimer;
Described specific fragment amplimer is to the primer pair containing the fragment of described Campylobacter spp 23S rRNA gene mutation site for energy specific amplified;
Described sequencing primer is the single strand dna be made up of 15 Nucleotide, and 3-10 the Nucleotide that 5 ' of described single strand dna is held is identical or complementary with 3-10 Nucleotide before described Campylobacter spp 23S rRNA gene mutation site.
In above-mentioned primer sets, described specific fragment amplimer forms by the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table;
Described sequencing primer is the single strand dna shown in sequence in sequence table 3.
In above-mentioned primer sets, 5 ' end mark vitamin H of the single strand dna shown in sequence 2 in the sequence table of described specific fragment amplimer centering;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A;
Described Campylobacter spp is campylobacter jejuni or Campylobacter Coli.
Another object of the present invention is to provide PCR reagent or the PCR kit of detection or auxiliary detection Campylobacter spp 23S rRNA gene mutation site.
PCR reagent provided by the invention, is made up of PCR reagent A and PCR reagent B; Described PCR reagent A is made up of, pcr amplification buffer A and water the specific fragment amplimer in above-mentioned primer sets;
Above-mentioned pcr amplification buffer A is the Premix Ex Taq of TAKARA company
tM(article No. is D336A to Version2.0 for Loading dye mix, TAKARA company;
Described PCR reagent B is made up of the sequencing primer in above-mentioned primer sets, pcr amplification buffer B and water;
The final concentration of each bar primer in described PCR reagent A of the specific fragment amplimer centering in described primer sets is 10pM-1 μM, and the final concentration of each bar primer in described PCR reagent A of the specific fragment amplimer centering in described primer sets is all specially 10pM;
Above-mentioned pcr amplification buffer B is annealing buffer(BIOTAGE company, Ref40-0036lot610018).
PCR kit provided by the invention, comprises above-mentioned primer sets or described PCR reagent;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A;
Described Campylobacter spp is campylobacter jejuni or Campylobacter Coli.
Above-mentioned primer sets or above-mentioned PCR reagent or test kit to detect and/or application in auxiliary detection Campylobacter spp 23S to be measured rRNA gene mutation site product is also the scope of protection of the invention in preparation;
Or above-mentioned primer sets or above-mentioned PCR reagent or test kit to detect and/or application in auxiliary detection Campylobacter spp resistance to be measured is also the scope of protection of the invention in preparation;
Described 23S rRNA gene mutation site is specially the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is specially mutating alkali yl G or wild-type base A; Described resistance is specially resistance to erythromycin; Described Campylobacter spp is specially campylobacter jejuni or Campylobacter Coli.
The said products is test kit.
3rd object of the present invention is to provide a kind of method detecting Campylobacter spp 23S rRNA gene mutation site to be measured.
The method of detection provided by the invention Campylobacter spp 23S to be measured rRNA gene mutation site, comprises the steps:
1) carrying out pcr amplification with the described specific fragment amplimer in above-mentioned primer sets or above-mentioned PCR reagent or test kit to treating lateral bending aspergillus, obtaining biotin labeled PCR primer;
2) the sepharose magnetic bead of described biotin labeled PCR primer and avidin (exists with the solution form of the sepharose magnetic bead of avidin, every 50ul solution is the mixing solutions of the sepharose magnetic bead of 3 μ L avidins and the binding buffer of 47ul) (volume ratio is 1:1 in concussion mixing, 25 DEG C) under concussion mixing 10min), obtain mix products; Capture the PCR primer in conjunction with agarose magnetic bead in described mix products, then carry out sex change (placing in the Tris-acetic acid of the NaOH aqueous solution of 70% dehydrated alcohol, 0.2M, 10mM successively), obtain Manganic pyrophosphate complex initiation single-stranded template;
3) described Manganic pyrophosphate complex initiation single-stranded template and sequencing primer are mixed checking order in damping fluid, cool after 80 DEG C of reaction 2min, single-stranded template is combined with sequencing primer, setting reaction sequence is that AGACGATCGATCGATC checks order, obtain the product that checks order, realize detecting Campylobacter spp 23S rRNA gene mutation site to be measured;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A.
4th object of the present invention is to provide a kind of method of detection and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured.
The method of detection provided by the invention and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured, comprises the steps:
1) treat lateral bending aspergillus 23S rRNA gene mutation site by the method detecting Campylobacter spp 23S rRNA gene mutation site to be measured to check order, obtain the product that checks order;
2) detect order-checking product, if the 2075th bit base of 23S rRNA gene is mutating alkali yl G in described order-checking product, then described Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of the 23S rRNA gene in described order-checking product is wild-type base A, then described Campylobacter spp to be measured be not or candidate for resistance to erythromycin.
5th object of the present invention is to provide a kind of method of detection and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured.
The method of detection provided by the invention and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured, comprises the steps:
1) treat lateral bending aspergillus 23S rRNA gene mutation site by the method detecting Campylobacter spp 23S rRNA gene mutation site to be measured to check order, obtain the product that checks order;
2) if the 2075th bit base of at least one the 23S rRNA gene copy in described order-checking product is mutating alkali yl G, then described Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of 3 23S rRNA gene copies in described order-checking product is wild-type base A, then described Campylobacter spp to be measured be not or candidate for resistance to erythromycin;
Containing 3 23S rRNA gene copies in described Campylobacter spp to be measured.
In above-mentioned each method, described Campylobacter spp to be measured is campylobacter jejuni or Campylobacter Coli;
In step 1), the template of described PCR primer is genomic dna.
6th object of the present invention is to provide a kind of primer pair.
Primer pair provided by the invention, is made up of the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table.
Experiment of the present invention proves, primer sets provided by the invention and method, advantage specific as follows:
1, the object band brightness of special primer to amplification is high, band is single, without non-specific binding, illustrate that PCR primer amplification efficiency provided by the invention is high, high specificity;
2, as can be seen from sequencing result, sequencing primer provided by the invention can well detect mutational site to be measured, highly sensitive, and single nucleotide mutation can detect;
3, the Manganic pyrophosphate complex initiation method that the present invention applies detects the Campylobacter spp of resistance to erythromycin rrna 23S rRNA transgenation, and polymerase chain reaction (PCR) product can be directly used in order-checking, and do not need to carry out product secondary treatment, required sample size is little; Can find out from sequencer map, the pyrosequencing method of the present invention's application detects mutational site, directly can obtain the quantitative analytical data of mutant copies number.
In a word, primer sets provided by the invention and method, application is simple, whether reaction fast, and can have sudden change by direct Sequencing result and judge the whether resistance to erythromycin of test strains.
Accompanying drawing explanation
Fig. 1 is the 23S rRNA gene amplification collection of illustrative plates to Campylobacter spp sample
Fig. 2 is the 2075 site Manganic pyrophosphate complex initiation results to Campylobacter spp standard sensitive strain sample 23S rRNA gene
Fig. 3 is the 2075 site mutation Manganic pyrophosphate complex initiation results to Campylobacter spp clinical separate red mycin Resistant strain sample 23S rRNA gene
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
To achieve these goals, cardinal principle of the present invention utilizes PCR to prepare to treat sequencing template, and one of primer of PCR is with biotin labeled.When the sepharose magnetic bead of PCR primer and coupling avidin is hatched, DNA double chain warp alkaline denaturation separately.Purifying obtains waiting containing biotin labeled the strand that checks order, and sequencing primer combines with single-stranded template of waiting to check order.Then by itself and archaeal dna polymerase, adenosine triphyosphate (ATP) sulfurylase, luciferase and apyrase, and substrate adenosine-5'-phosphosulfate(APS) (APS) and fluorescein are hatched together.Four kinds of triphosphoric acid base deoxynucleotide dNTP(dATP, dTTP, dCTP, dGTP) one of be added into reaction system, as matched with template (A-T, C-G), the end of this dNTP and primer forms covalent linkage, and the tetra-sodium group (PPi) of dNTP discharges.And the amount of the PPi discharged with and the amount of dNTP that is combined of template be directly proportional.Sulfurylase catalysis APS and PPi forms the conversion of fluorescein to oxyluciferin that ATP, ATP drive luciferase mediation, and oxyluciferin sends measures to ATP the visible light signal be directly proportional.Optical signals ccd video camera detects and reacts for peak.The peak height of each optical signal is directly proportional to the nucleotide number mixed in reaction.ATP and uncorporated dNTP is degraded by apyrase, cancellation optical signal, and regeneration reaction system.Then lower a kind of dNTP is added.Finally treat 2075 site mutations of the 23S of resistance to erythromycin rRNA gene in sample and the copy number of sudden change generation, can read from the fignal center of reaction light intensity.
Embodiment 1, for detecting in Campylobacter spp standard sensitive strain sample the acquisition of the primer sets whether containing 23S rRNA gene 2075 site mutation
1, Specific PCR primers and design
By at US National Bioinformatics Institute (NCBI), query and search Campylobacter spp announces sequence, and with PSQ assay design program software design for Campylobacter spp 23S rRNA gene (sequence 4) Auele Specific Primer, amplification object fragment length is 227bp.
For increasing, object fragment PCR primer comprises:
Upstream primer: 5 ' TTAAATACCGACCTGCATGAATG3 ' (sequence 1);
Downstream primer: 5 ' TGGTATCTCAACAATGGCTCATAT3 ' (sequence 2).
5 ' end vitamin H of above-mentioned downstream primer (sequence 2) marks.
2, Pyrosequencing primer design
Choose front about 10 the bases design in erythromycin-resistant mutational site (the 2075th mutational site of Campylobacter spp 23S rRNA gene) sequencing primer, sequencing primer is as follows:
For detecting the sequencing primer in mutational site: 5 ' CTCCTACCCGCGGCA3 ' (sequence 3).
Therefore upstream primer, downstream primer and sequencing primer can form for detecting the primer sets whether containing 23S rRNA gene 2075 site mutation in Campylobacter spp standard sensitive strain sample.
Above-mentioned primer sets can be the component detecting and whether contain the test kit of 23S rRNA gene 2075 site mutation in Campylobacter spp standard sensitive strain sample.
Whether embodiment 2, primer sets are detecting in sample containing the application in 23S rRNA gene 2075 site mutation
One, whether detect in Campylobacter spp standard sensitive strain sample containing the application in 23S rRNA gene 2075 site mutation
1, the extraction of genomic dna
Extract Campylobacter spp standard sensitive strain (the not resistance to erythromycin of this Campylobacter spp standard sensitive strain of Campylobacter jejuni subsp.jejuni ATCC33560 American Type Culture Collecti, its 23S rRNA gene order is sequence 4, and the Nucleotide in 2075 sites is A, campylobacter jejuni.) genomic dna of sample.
2, pcr amplification
1), the determination of reaction system
PCR reaction system is 50 μ L:25 μ LPCR amplification buffer (the Premix Ex Taq of TAKARA company
tMversion2.0 (Loading dye mix, article No. is D336A)), each 1 μ L of the DNA profiling 1 μ L of 100ng/ μ L, upstream and downstream primer, distilled water 22 μ L, upstream primer and the upstream primer final concentration in reaction system is 1 μM, 0.1 μM respectively, 10nM, 1nM, 0.1nM and 10pM, 1 μ L genomic dna is as template.
2), PCR reaction conditions
Above-mentioned PCR reaction system is increased according to following PCR reaction conditions: 95 DEG C of 5min, 1 circulation, 95 DEG C of 1min, 60 DEG C of 45sec, 72 DEG C of 45sec, 45 circulations, 72 DEG C of 10min, 1 circulation.
Result as shown in Figure 1, M:DL2000,1-6: primer concentration is 10 times of PCR electrophoresis carrying out diluting successively, primer concentration is respectively 1 μM, 0.1 μM, 10nM, 1nM, 0.1nM and 10pM, can find out, still can obtain the very high object band of brightness at lower concentration 10pM, obtain the biotin labeled PCR primer of 227bp.
For cost and experiment effect in dual consideration, primer final concentration is selected to be 10pM.
Above-mentioned reaction system removing template is other components composition PCR reagent.
Above-mentioned PCR reagent all can be a kind of component detecting and whether contain the test kit of 23S rRNA gene 2075 site mutation in Campylobacter spp standard sensitive strain sample.
3, Manganic pyrophosphate complex initiation single-stranded template is prepared
Solution (the sepharose magnetic bead of 3 μ L avidins and the binding buffer(BIOTAGE company of 47ul of the biotin labeled PCR primer that 50 μ L above-mentioned 2 are obtained and the sepharose magnetic bead of 50ul avidins, ref40-0033lot580020) form) according to 1:1 volume concussion mixing, cumulative volume is made to reach 100ul(GE Healthcare17-5113-01) concussion mixing 10min under room temperature (25 DEG C), the sepharose magnetic bead of avidin is fully combined with vitamin H.
Capture the PCR primer in conjunction with agarose magnetic bead in described mix products:
At workstation(workstation, the integral part of instrument) in, add 180ml high purity water, 70% dehydrated alcohol, washing buffer and 120ml Denaturation buffer successively in 4 corresponding sample panel.The vacuum switch checked order by PSQ96MA on instrument reaction surface plate is placed on state, vacuum prep tool(captures 96 hole probes of magnetic bead) first in high purity water, clean 30s, being moved on to by tool afterwards completes in the mix products of concussion, capture the PCR primer in conjunction with agarose magnetic bead, earthquake terminates to complete crawl work in latter 3 minutes;
Sex change: successively vacuum prep tool is put into 70% dehydrated alcohol 10sec again; Then the NaOH aqueous solution of Denaturation buffer(0.2M, PH=13.3) middle 10sec; Move on to the Tris-acetic acid of washing buffer(10mM again, PH=7.6) middle cleaning 10sec, now obtained containing Manganic pyrophosphate complex initiation single-stranded template, this single-stranded template is adsorbed on vacuum prep tool.
4, Manganic pyrophosphate complex initiation
Vacuum prep tool with Manganic pyrophosphate complex initiation single-stranded template is placed in be equipped with 40ul check order system 96 orifice plates corresponding position directly over, 40ul order-checking system is as follows: 38.5ul annealing buffer(BIOTAGE company, Ref40-0036lot610018), 1.5ul sequencing primer (final concentration of sequencing primer in order-checking system is 0.3uM); After aligned position, then the vacuum switch of working panel is placed in off state, tool is put into order-checking system, shake gently, discharge the single stranded product in conjunction with agarose magnetic bead.
Again 96 orifice plates are placed in 80 DEG C of baking ovens, after placing 2min, more automatic cool to room temperature is let alone in taking-up.
Arrange response procedures in software, select SQA Entries after entering SQA system, in the second hurdle from left to right, setting reaction sequence is AGACGATCGATCGATC, and has added reagent cabin according to software prompt, carries out Manganic pyrophosphate complex initiation reaction.Primer strand adds extension along with different dNTP's.
Manganic pyrophosphate complex initiation the results are shown in Figure 2, the sequence read to be this fragment of AGACGGAAAGACCCCGT(be in sequence table sequence 4 from 5 ' end the 2068 to 2084 bit base), wherein 2075 sites are non-mutating alkali yl A, its position consistency corresponding with the 23S rRNA gene order that the process of this bacterial strain checks order.
Can find out, Campylobacter spp standard sensitive strain 23S rRNA gene amplification object fragment length is 227bp, and to announce responsive Campylobacter spp 23S rRNA2075 site consistent with NCBI.
Simultaneous quantitative sequencing reaction shows, and 2075 site bases are 100%, G in conjunction with A is 0%, therefore judges in this Campylobacter spp sample 23S rRNA gene 3 copy without 2075 site base mutations.
Can find out, all without 2075 site base mutations in this Campylobacter spp sample 23S rRNA gene 3 copy, therefore, the not resistance to erythromycin of this Campylobacter spp sample, this is consistent with qualification, illustrates that method of the present invention is correct.
Two, whether Manganic pyrophosphate complex initiation detects in Campylobacter spp clinical separate red mycin Resistant strain sample containing 23S rRNA gene 2075 site mutation
1, the extraction of genomic dna
Extract the Campylobacter spp of resistance to erythromycin bacterial strain campylobacter jejuni SX122(Xia Chen*, Gao-Wa Naren*, Cong-Ming Wu, Yang Wang, Lei Dai, Li-Ning Xia Peng-Jie Luo, Qi jing Zhang, Jian-Zhong Shen.Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China.Vet Microbiol144 (2010) 133 – 139. public can obtain from China Agricultural University.By medicament sensitivity test (i.e. MIC), identify the resistance to erythromycin of this bacterial strain; The nucleotides sequence of the 23S rRNA gene of this Campylobacter spp of resistance to erythromycin bacterial strain is classified as and sequence 4 the 2075th site is become G, campylobacter jejuni) genomic dna.
2, pcr amplification
According to one 2 method carry out pcr amplification.
3, Manganic pyrophosphate complex initiation single-stranded template is prepared
According to one 3 method prepare Manganic pyrophosphate complex initiation single-stranded template.
4, Manganic pyrophosphate complex initiation
According to the method Manganic pyrophosphate complex initiation of 4.
Manganic pyrophosphate complex initiation the results are shown in Figure 3, and the sequence of reading is AGACGGAGAGACCCCGT.
The 23S rRNA gene amplification object fragment length of the Campylobacter spp of resistance to erythromycin bacterial strain is 227bp, consistent with standard; Through Manganic pyrophosphate complex initiation, the sequence fragment measured shows inconsistent with the sequence that the 2075 site base pairs that 23S rRNA gene does not suddenly change are answered: be AGACGGAGAGACCCCGT(and the position consistency corresponding through the 23S rRNA gene order checked order of this bacterial strain, the 2075th site is mutating alkali yl G); Simultaneous quantitative sequencing reaction shows, and object site base is 1.4%, G in conjunction with A is 98.6%, therefore judges that in this Campylobacter spp sample 23S rRNA gene, 2075 site base A → G sudden change all occurs 3 copies.
Because 2075 sites of the Campylobacter spp rrna 23S rRNA gene of resistance to erythromycin are undergone mutation as (A → G), therefore, the resistance to erythromycin of this Campylobacter spp sample, this is consistent with qualification, illustrates that method of the present invention is correct.
As can be seen from above-mentioned experiment, can with primer sets of the present invention or PCR reagent or test kit, whether 2075 sites of the 23S rRNA gene of Campylobacter spp to be measured undergo mutation to adopt method of the present invention to identify, thus judge the whether resistance to erythromycin of this Campylobacter spp to be measured, specific as follows:
If the 2075th bit base of 23S rRNA gene is mutating alkali yl G in order-checking product, then Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of the 23S rRNA gene in order-checking product is wild-type base A, then Campylobacter spp to be measured be not or candidate for resistance to erythromycin.
In order to more accurately judge the whether resistance to erythromycin of this Campylobacter spp to be measured: containing 3 23S rRNA gene copies in Campylobacter spp to be measured; If the 2075th bit base of at least one the 23S rRNA gene copy in order-checking product is mutating alkali yl G, then Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of 3 23S rRNA gene copies in order-checking product is wild-type base A, then Campylobacter spp to be measured be not or candidate for resistance to erythromycin.
Above-mentioned Campylobacter spp to be measured can be campylobacter jejuni or Campylobacter Coli.
Whether embodiment 3, primer sets are detecting in sample containing the application in 23S rRNA gene 2075 site mutation
Choose test strains: sensitive strain is numbered PL12(Xia Chen*, Gao-Wa Naren*, Cong-Ming Wu, Yang Wang, Lei Dai, Li-Ning Xia Peng-Jie Luo, Qi jing Zhang, Jian-Zhong Shen.Prevalence and antimicrobial resistance of Campylobacter isolates in broilers from China.Vet Microbiol144 (2010) 133 – 139. public can obtain from China Agricultural University.By medicament sensitivity test (i.e. MIC), identify the not resistance to erythromycin of this bacterial strain; Campylobacter jejuni; The 23S rRNA gene order of this bacterial strain is the sequence 4 in sequence table).
1, the extraction of genomic dna: method is with 1 of embodiment 2;
2, pcr amplification: method is with 1 of embodiment 2;
3, Manganic pyrophosphate complex initiation single-stranded template is prepared: method is with 1 of embodiment 2;
4, Manganic pyrophosphate complex initiation: method is with 1 of embodiment 2;
Result is as follows: the sequence measured by PL12 bacterial strain is with ATCC33560 reference culture, and to announce responsive Campylobacter spp 23S rRNA2075 site consistent with NCBI.Simultaneous quantitative sequencing reaction shows, and 2075 site bases are 100%, G in conjunction with A is 0%, therefore judges in this Campylobacter spp sample 23S rRNA gene 3 copy without 2075 site base mutations.
Can find out, all without 2075 site base mutations in this Campylobacter spp sample 23S rRNA gene 3 copy, therefore, the not resistance to erythromycin of this Campylobacter spp sample, this is consistent with qualification, illustrates that method of the present invention is correct.
Claims (10)
1. the primer sets of detection or auxiliary detection Campylobacter spp 23S rRNA gene mutation site, is made up of with sequencing primer specific fragment amplimer;
Described specific fragment amplimer is to the primer pair containing the fragment of described Campylobacter spp 23S rRNA gene mutation site for energy specific amplified;
Described sequencing primer is the single strand dna be made up of 15 Nucleotide, and 3-10 the Nucleotide that 5 ' of described single strand dna is held is identical or complementary with 3-10 Nucleotide before described Campylobacter spp 23S rRNA gene mutation site.
2. primer sets according to claim 1, is characterized in that:
Described specific fragment amplimer forms by the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table;
Described sequencing primer is the single strand dna shown in sequence in sequence table 3.
3. primer sets according to claim 1 and 2, is characterized in that:
5 ' end mark vitamin H of the single strand dna shown in sequence 2 in the sequence table of described specific fragment amplimer centering;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A;
Described Campylobacter spp is campylobacter jejuni or Campylobacter Coli.
4. detect or the PCR reagent of auxiliary detection Campylobacter spp 23S rRNA gene mutation site or PCR kit:
Described PCR reagent, is made up of PCR reagent A and PCR reagent B; Described PCR reagent A is made up of, pcr amplification buffer A and water the specific fragment amplimer in described primer sets arbitrary in claim 1-3;
Described PCR reagent B is made up of sequencing primer, pcr amplification buffer B and the water in described primer sets arbitrary in claim 1-3;
The final concentration of each bar primer in described PCR reagent A of the specific fragment amplimer centering in described primer sets is 10pM-1 μM, and the final concentration of each bar primer in described PCR reagent A of the specific fragment amplimer centering in described primer sets is all specially 10pM;
Described PCR kit, comprises arbitrary described primer sets or described PCR reagent in claim 1-3;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A;
Described Campylobacter spp is campylobacter jejuni or Campylobacter Coli.
5. in claim 1-3, PCR reagent described in arbitrary described primer sets or claim 4 or test kit detect and/or application in auxiliary detection Campylobacter spp 23S to be measured rRNA gene mutation site product in preparation;
Or PCR reagent described in arbitrary described primer sets or claim 4 or test kit detect and/or application in auxiliary detection Campylobacter spp resistance to be measured in preparation in claim 1-3;
Described 23S rRNA gene mutation site is specially the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is specially mutating alkali yl G or wild-type base A; Described resistance is specially resistance to erythromycin; Described Campylobacter spp is specially campylobacter jejuni or Campylobacter Coli.
6. detect a method for Campylobacter spp 23S rRNA gene mutation site to be measured, comprise the steps:
1) carrying out pcr amplification with the described specific fragment amplimer in PCR reagent described in described primer sets arbitrary in claim 1-3 or claim 4 or test kit to treating lateral bending aspergillus, obtaining biotin labeled PCR primer;
2) the sepharose magnetic bead concussion mixing of described biotin labeled PCR primer and avidin, obtains mix products; Capture the PCR primer in conjunction with agarose magnetic bead in described mix products, then carry out sex change, obtain Manganic pyrophosphate complex initiation single-stranded template;
3) described Manganic pyrophosphate complex initiation single-stranded template and sequencing primer are mixed checking order in damping fluid, cool after 80 DEG C of reaction 2min, single-stranded template is combined with sequencing primer, obtain the product that checks order, realization detection Campylobacter spp 23SrRNA gene mutation site to be measured;
Described 23S rRNA gene mutation site is the 2075th bit base of 23S rRNA gene, and the 2075th bit base of described 23S rRNA gene is mutating alkali yl G or wild-type base A.
7. a method for detection and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured, comprises the steps:
1) treat lateral bending aspergillus 23S rRNA gene mutation site by the method for claim 6 to check order, obtain the product that checks order;
2) detect order-checking product, if the 2075th bit base of 23S rRNA gene is mutating alkali yl G in described order-checking product, then described Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of the 23S rRNA gene in described order-checking product is wild-type base A, then described Campylobacter spp to be measured be not or candidate for resistance to erythromycin.
8. a method for detection and/or the whether resistance to erythromycin of auxiliary detection Campylobacter spp to be measured, comprises the steps:
1) treat lateral bending aspergillus 23S rRNA gene mutation site by the method for claim 6 to check order, obtain the product that checks order;
2) if the 2075th bit base of at least one the 23S rRNA gene copy in described order-checking product is mutating alkali yl G, then described Campylobacter spp to be measured is or candidate is resistance to erythromycin; If the 2075th bit base of 3 23S rRNA gene copies in described order-checking product is wild-type base A, then described Campylobacter spp to be measured be not or candidate for resistance to erythromycin;
Containing 3 23S rRNA gene copies in described Campylobacter spp to be measured.
9. the method according to claim 6 or 7 or 8, is characterized in that:
Described Campylobacter spp to be measured is campylobacter jejuni or Campylobacter Coli;
In step 1), the template of described PCR primer is genomic dna.
10. a primer pair, is made up of the single strand dna shown in sequence 2 in the single strand dna shown in sequence in sequence table 1 and sequence table.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310222703.4A CN104232740A (en) | 2013-06-06 | 2013-06-06 | Primers and method for detecting campylobacter 23S rRNA gene mutation site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310222703.4A CN104232740A (en) | 2013-06-06 | 2013-06-06 | Primers and method for detecting campylobacter 23S rRNA gene mutation site |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104232740A true CN104232740A (en) | 2014-12-24 |
Family
ID=52221633
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310222703.4A Pending CN104232740A (en) | 2013-06-06 | 2013-06-06 | Primers and method for detecting campylobacter 23S rRNA gene mutation site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232740A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106554992A (en) * | 2015-09-28 | 2017-04-05 | 中国疾病预防控制中心传染病预防控制所 | Detect the test kit of the Campylobacter spp of resistance to erythromycin |
-
2013
- 2013-06-06 CN CN201310222703.4A patent/CN104232740A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| MARJO HAANPERA,ET AL: "Detection and Quantification of Macrolide Resistance Mutations at Detection and Quantification of Macrolide Resistance Mutations at by Pyrosequencing", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》 * |
| MARJO HAANPERA,ET AL: "Detection and Quantification of Macrolide Resistance Mutations at Detection and Quantification of Macrolide Resistance Mutations at by Pyrosequencing", 《ANTIMICROBIAL AGENTS AND CHEMOTHERAPY》, vol. 49, no. 1, 31 January 2005 (2005-01-31), pages 457 - 460 * |
| 娜仁高娃等: "大环内醋类耐药弯曲杆菌23S rRNA 2074、2075位点突变的焦磷酸测序分析", 《中国畜牧兽医学会兽医药理毒理学分会第十次研讨会论文摘要集》 * |
| 娜仁高娃等: "大环内醋类耐药弯曲杆菌23S rRNA 2074、2075位点突变的焦磷酸测序分析", 《中国畜牧兽医学会兽医药理毒理学分会第十次研讨会论文摘要集》, 1 October 2009 (2009-10-01), pages 112 - 113 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106554992A (en) * | 2015-09-28 | 2017-04-05 | 中国疾病预防控制中心传染病预防控制所 | Detect the test kit of the Campylobacter spp of resistance to erythromycin |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Seki et al. | Loop-mediated isothermal amplification method targeting the lytA gene for detection of Streptococcus pneumoniae | |
| Waites et al. | Mycoplasma and ureaplasma | |
| Oleastro et al. | Real-time PCR assay for rapid and accurate detection of point mutations conferring resistance to clarithromycin in Helicobacter pylori | |
| Kodani et al. | Application of TaqMan low-density arrays for simultaneous detection of multiple respiratory pathogens | |
| CN104164491A (en) | ARMS-qPCR detection method and kit for helicobacter pylori 23S rDNA gene mutation subtype | |
| CN102816847B (en) | LAMP primer for detecting Brucella and kit containing the same | |
| Kurupati et al. | Rapid detection of Klebsiella pneumoniae from blood culture bottles by real-time PCR | |
| CN103361434A (en) | Multiple fluorescence PCR detection kit and detection method for clostridium difficile toxin genes | |
| Shipitsyna et al. | Evaluation of polymerase chain reaction assays for the diagnosis of Trichomonas vaginalis infection in Russia | |
| CN104846097A (en) | Helicobacter pylori (HP) type and drug-resistant mutation gene detection kit | |
| CN113862393A (en) | Method for rapidly detecting cryptococcus gatherensis | |
| CN105368943A (en) | Kit and method for identifying mycobacterium strains | |
| CN106282176A (en) | One is used for identifying AGA926-928the primer combination of the ARMS-qPCR of sudden change and application thereof | |
| CN104232740A (en) | Primers and method for detecting campylobacter 23S rRNA gene mutation site | |
| CN103215362A (en) | Establishment of methodology for carrying out joint detection on bacterial genus genes and toxin genes of clostridium difficile by using TaqMan-MGB probe real-time fluorescent quantitative PCR (polymerase chain reaction) technology | |
| CN107164506B (en) | Method for detecting multiple sheep babesia and detection kit | |
| CN113801963B (en) | Primer probe combination, kit and method for detecting coronavirus | |
| CN101440400B (en) | Fluorescent detection kit and method for Streptococcus suis 2 type nucleic acid containing 89K pathogenicity island gene | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| CN112391493A (en) | RAA fluorescence detection method, primer probe and kit for citrus greening disease Asian species | |
| Pearce et al. | Using the polymerase chain reaction coupled with denaturing gradient gel electrophoresis to investigate the association between bacterial translocation and systemic inflammatory response syndrome in predicted acute severe pancreatitis | |
| CN106222264A (en) | Trivial nucleic probe fluorescent quantificationally PCR detecting kit and primer special, probe and application | |
| CN103525929B (en) | The primer sets of rapid detection campylobacter jejuni gyrA gene mutation site and application thereof | |
| CN101892313B (en) | Method for fast detecting trypanosome evansi by utilizing loop-mediated isothermal application technology | |
| CN101294224A (en) | Primer and probe sequence for testing pig parvoviral nucleotide fragment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20141224 |