CN106011154B - A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application - Google Patents
A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application Download PDFInfo
- Publication number
- CN106011154B CN106011154B CN201610669762.XA CN201610669762A CN106011154B CN 106011154 B CN106011154 B CN 106011154B CN 201610669762 A CN201610669762 A CN 201610669762A CN 106011154 B CN106011154 B CN 106011154B
- Authority
- CN
- China
- Prior art keywords
- hepatapostema
- klebsiella pneumoniae
- cause
- pago
- luxr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its applications, and the present invention provides cause hepatapostema Klebsiella Pneumoniae gene specific sequencepagOWithluxR, the two gene specifics be present in cause hepatapostema Klebsiella Pneumoniae in, can be used as the diagnostic marker of Klebsiella Pneumoniae hepatapostema.Primer based on the design of the two genes, which can be used for preparing, causes hepatapostema Klebsiella Pneumoniae molecular detection kit, can be used for the diagnosis or its early diagnosis of Klebsiella Pneumoniae hepatapostema, has great commercial development value.
Description
Technical field
The present invention relates to medical diagnosis on disease fields, and in particular to a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit
And its application.
Background technique
Klebsiella Pneumoniae (K.pneumoniae subsp.pneumonia), belongs to enterobacteriaceae lactobacteriaceae.Often parasitize
Human skin, pharynx nasalis and enteron aisle etc. are conditioned pathogen.Clinically, pneumonia and urinary tract infections etc. can be caused
(Podschun R,Ullmann U.Klebsiella spp.as nosocomial pathogens:epidemiology,
taxonomy,typing methods,and pathogenicity factors.Clinical microbiology
reviews.1998；11(4):589-603).1980 to nineteen ninety, Taiwan Liu et al. people reported 7 by high poison for the first time
Serious hepatapostema is with entophthamia case (Liu Y, Cheng D, Lin C.Klebsiella caused by power Klebsiella Pneumoniae
pneumoniae liver abscess associated with septic endophthalmitis.Arch Intern
Med 1986；146:1913–16).Hereafter, Klebsiella Pneumoniae hepatapostema starts Global prevalence, especially in Asia.With it is common
Klebsiella Pneumoniae compare, cause that hepatapostema Klebsiella Pneumoniae invasiveness is strong, lethality is high.In addition to leading to hepatapostema, liver is caused
Abscess Klebsiella Pneumoniae can also cause serious meningitis, entophthamia and pulmonary abscess etc. (Siu LK, Yeh KM, Lin JC,
Fung CP,Chang FY.Klebsiella pneumoniae liver abscess:a new invasive
syndrome.The Lancet Infectious diseases.2012；12(11):881-7).For the lung of virulence high in this way
Scorching Klebsiella infection, diagnoses as early as possible, treats in time, the generation to severe complication is reduced, and improving prognosis has important face
Bed value.But it is used to cause the Testing and appraisal of hepatapostema Klebsiella Pneumoniae currently without a kind of fast and convenient method.
As what the increase and cause hepatapostema Klebsiella Pneumoniae of Klebsiella Pneumoniae hepatapostema Case report were studied gos deep into,
Several phenotypes relevant to hepatapostema Klebsiella Pneumoniae is caused are put forward one after another, including bacterium colony high viscosity phenotype and capsular polysaccharide blood
Clear type K1 type/K2 type etc..Klebsiella Pneumoniae can secrete polysaccharose substance in cell surface, so that bacterium colony be made to generate high viscosity table
Type, to resist the phagocytosis of macrophage and neutrophil leucocyte.But recently the study found that only 50% less than cause hepatapostema lung
Scorching klebsiella shows as bacterium colony high viscosity (Qu TT, Zhou JC, Jiang Y, Shi KR, Li B, Shen P, et
al.Clinical and microbiological characteristics of Klebsiella pneumoniae
liver abscess in East China.BMC infectious diseases.2015；15:161).Capsular polysaccharide serotypes
Antigen K1 type and K2 type are the predominant serotypes for causing hepatapostema Klebsiella Pneumoniae, but still have 20% or more cause hepatapostema pneumonia
Klebsiella is not belonging to K1/K2 serotype.In addition, serotype K1 type or K2 type are also found to be present in pneumonia klebsiella
(Sun Y,Wu H,Shen D.Clinical and Molecular Analysis of Klebsiella pneumoniae
Causing Liver Abscess in China.Journal of molecular microbiology and
biotechnology.2016；26(4):245-51).Therefore, in order to which in molecular level, more rapidly effectively identification causes liver
Abscess Klebsiella Pneumoniae, we pass through to the genome ratio for causing hepatapostema Klebsiella Pneumoniae and pneumonia klebsiella
Compared with analysis, the specific gene sequences for causing hepatapostema Klebsiella Pneumoniae are found.Using these specific sequences, by simple
PCR method, can rapidly identify cause hepatapostema Klebsiella Pneumoniae, be the infection as caused by the pathogen it is timely diagnosis with
Treatment improves patient's prognosis offer basis.
Summary of the invention
The object of the present invention is to provide cause hepatapostema Klebsiella Pneumoniae gene specific sequence pagO, the base
Because specific sequence pagO is shown in SEQ ID NO.1.
It is another object of the present invention to provide based on cause hepatapostema Klebsiella Pneumoniae gene specific sequence
The primer of pagO design, primer are as follows: pagO_F:TGCTCTTGAAACTATCCCTCC, pagO_R:GGCAATAACTCCCGTCCA.
It is also an object of the present invention to provide cause hepatapostema Klebsiella Pneumoniae gene specific sequence luxR, institutes
The gene specific sequence luxR stated is shown in SEQ ID NO.2.
It is also an object of the present invention to provide based on cause hepatapostema Klebsiella Pneumoniae gene specific sequence
The primer of luxR design, primer are as follows: luxR_F:CTTTGCCGGCATGGAACATA, luxR_R:
TGAGCCAAATGTATGCCAAGGA。
It is also an object of the present invention to provide cause hepatapostema Klebsiella Pneumoniae gene specific sequence pagO or
Primer based on pagO design causes the application in hepatapostema Klebsiella Pneumoniae detection kit in preparation, including is used to prepare lung
Application in scorching klebsiella hepatapostema early diagnosis kit.
It is also an object of the present invention to provide cause hepatapostema Klebsiella Pneumoniae gene specific sequence luxR or
Primer based on luxR design causes the application in hepatapostema Klebsiella Pneumoniae detection kit in preparation, including is used to prepare lung
Application in scorching klebsiella hepatapostema early diagnosis kit.
Final object of the present invention is the provision of a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit,
The kit includes primer:
PagO_F:TGCTCTTGAAACTATCCCTCC
PagO_R:GGCAATAACTCCCGTCCA
LuxR_F:CTTTGCCGGCATGGAACATA
LuxR_R:TGAGCCAAATGTATGCCAAGGA.
To achieve the goals above, the present invention uses following technical measures:
Causing hepatapostema Klebsiella Pneumoniae gene specific sequence pagO, the gene specific sequence pagO is SEQ
Shown in ID NO.1.
Primer based on pagO sequence design is protection scope of the present invention, it is preferred that the primer of pagO are as follows: pagO_
F:TGCTCTTGAAACTATCCCTCC；PagO_R:GGCAATAACTCCCGTCCA.
Causing hepatapostema Klebsiella Pneumoniae gene specific sequence luxR, the gene specific sequence luxR is SEQ
Shown in ID NO.2.
Primer based on luxR sequence design is protection scope of the present invention, it is preferred that the primer of luxR are as follows: luxR's
Primer are as follows: luxR_F:CTTTGCCGGCATGGAACATA；LuxR_R:TGAGCCAAATGTATGCCAAGGA.
Protection scope of the present invention further includes causing hepatapostema Klebsiella Pneumoniae gene specific sequence pagO or being based on
The primer of pagO design causes the application in hepatapostema Klebsiella Pneumoniae detection kit in preparation, including prepares kerekou pneumonia primary
Bacterium hepatapostema early diagnosis kit.
Protection scope of the present invention further includes causing hepatapostema Klebsiella Pneumoniae gene specific sequence luxR or being based on
The primer of luxR design causes the application in hepatapostema Klebsiella Pneumoniae detection kit in preparation, including prepares kerekou pneumonia primary
Bacterium hepatapostema early diagnosis kit.
A kind of cause hepatapostema Klebsiella Pneumoniae detection kit, comprising:
PagO_F:TGCTCTTGAAACTATCCCTCC
PagO_R:GGCAATAACTCCCGTCCA
LuxR_F:CTTTGCCGGCATGGAACATA
LuxR_R:TGAGCCAAATGTATGCCAAGGA.
Compared with prior art, the invention has the characteristics that:
1. there is no the molecular marker well for causing hepatapostema Klebsiella Pneumoniae to identify at present, the present invention passes through survey
2 plants of the sequence cause hepatapostema Klebsiella Pneumoniaes for being isolated from China's Mainland and 1 plant of non-cause hepatapostema Klebsiella Pneumoniae, joint are online
45 plants announced cause hepatapostema Klebsiella Pneumoniae and 103 plants of non-full-length genome data for causing hepatapostema Klebsiella Pneumoniae, lead to
Comparison analysis is crossed, two sections of sequences for the high special in causing hepatapostema Klebsiella Pneumoniae have been obtained.
2. the 2 sections provided by the invention sequences for causing hepatapostema Klebsiella Pneumoniae special can be used as preparation and cause hepatapostema
Klebsiella Pneumoniae detection kit
3. the 2 sections provided by the invention sequences for causing hepatapostema Klebsiella Pneumoniae special, can be used as molecular marker, use
In the early diagnosis of Klebsiella Pneumoniae hepatapostema.Especially in the Bacteria culturing result of other body fluid source samples such as blood
Before reporting out, using blood samples of patients sample or liver vomica fester, is detected using quick PCR method and cause hepatapostema kerekou pneumonia
The presence or absence of primary bacterium specific gene pagO or/and luxR can be quickly to pneumonia in conjunction with patients with clinical manifestations and imaging data
Klebsiella hepatapostema makes diagnosis, improves the success rate of Klebsiella Pneumoniae hepatapostema.
Specific embodiment
The invention will be further described for specific embodiment.Technical solution of the present invention is if not otherwise specified this
The conventional scheme in field.
Embodiment 1:
The exploitation and verifying of specific sequence:
The screening process combination second generation sequencing technologies (Next-Generation of specific gene sequences
Sequencing, NGS), comparative genomics (Comparative Genomics) and bioinformatics
(Bioinformatics) method, and using the statistical method of science, to sequence in multiple Klebsiella Pneumoniae genomes
The specificity of distribution is tested, and in isolated cause hepatapostema Klebsiella Pneumoniae and non-cause hepatapostema Klebsiella Pneumoniae
Middle progress PCR verifying, to determine that sequence is causing the specificity in hepatapostema Klebsiella Pneumoniae.Specific implementation process is as follows:
Choose 2 plants of cause hepatapostema Klebsiella Pneumoniaes for being isolated from China's Mainland and 1 plant of non-cause hepatapostema kerekou pneumonia primary
Bacterium is used for genome sequencing, and sequencing result spliced with SPAdes (v3.5) software, with PATRIC on-line analysis platform into
Row predictive genes and functional annotation.Obtained sequencing result joint US National Bioinformatics Institute (National Center
For Bi otechnology Information, NCBI) announce 45 plants of cause hepatapostema Klebsiella Pneumoniaes and 103 plants of non-causes
The full-length genome data of hepatapostema Klebsiella Pneumoniae are analyzed by comparing, and screening, which exists only in, causes hepatapostema kerekou pneumonia primary
Gene in bacterium genome has obtained sequence pagO (the SEQ ID of two sections of high specials in causing hepatapostema Klebsiella Pneumoniae
Shown in NO.1) and luxR (shown in SEQ ID NO.2) based on this two sections of special primers, exploitation obtains a set of be used for
Identification causes the primer of hepatapostema Klebsiella Pneumoniae:
The primer of pagO are as follows:
PagO_F:TGCTCTTGAAACTATCCCTCC
PagO_R:GGCAATAACTCCCGTCCA
The primer of luxR are as follows:
LuxR_F:CTTTGCCGGCATGGAACATA
LuxR_R:TGAGCCAAATGTATGCCAAGGA.
Embodiment 2:
Gene specific verifying:
PagO and luxR causes verifying of the hepatapostema Klebsiella Pneumoniae specific gene in Clinical isolation, specific
Step is:
1. the cause hepatapostema being clinically separated and non-cause hepatapostema Klebsiella Pneumoniae bacterial strain are selected, for detecting pagO (SEQ
ID N O.1 shown in) and luxR (shown in SEQ ID NO.2) cause hepatapostema Klebsiella Pneumoniae in specificity.Select liver purulence
The 40 plants of Klebsiella Pneumoniaes separated in swollen patient's vomica are as detection group (causing hepatapostema group), alternative negated Klebsiella Pneumoniae
36 plants of the Klebsiella Pneumoniae separated in hepatapostema patient are used as negative control group (non-cause hepatapostema group).It also has chosen and faces simultaneously
Other the common pathogenic bacteria (other pathogenic bacteria groups) separated on bed are causing hepatapostema kerekou pneumonia further to verify these factors
Specificity in primary bacterium: including staphylococcus aureus, escherichia coli, Acinetobacter bauamnnii, enterococcus faecium, enterococcus faecalis.
2. the design of 2 predicted gene specific primers: for pagO and luxR specific sequence design primer such as
Under:
The primer of pagO are as follows:
PagO_F:TGCTCTTGAAACTATCCCTCC
PagO_R:GGCAATAACTCCCGTCCA
The primer of luxR are as follows:
LuxR_F:CTTTGCCGGCATGGAACATA
LuxR_R:TGAGCCAAATGTATGCCAAGGA
3. the extraction of bacterial genomes: 76 plants of Klebsiella Pneumoniaes of selection are extracted DNA in a conventional manner.
4.PCR detects pagO and luxR gene and (causes hepatapostema group, non-cause hepatapostema group and other pathogenic bacteria in three groups of bacterium
Group) in there are situations: PCR reaction use Premix TaqVersion 2.0 (TaKaRa, Code:D331A) kit.Root
Illustrate according to kit, the PCR reaction system of setting is 25ul, wherein Premix Taq 12.5ul, genomic DNA template 1ul
(about 100ng), upstream and downstream primer 0.5ul (10uM), adds deionized water 10.5ul to be supplemented to total volume 25ul.
PCR condition are as follows: 94 DEG C of denaturation 5min；95 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, 30 circulations；72℃7min；Reaction
After respectively take 5ul reaction product for DNA agarose gel electrophoresis, running gel ethidium bromide (Ethi dium
Bromid after) dyeing 5min, the photographic analysis on U.S. Bole (Bio-Rad) gel image analyser.
It the results are shown in Table 1, as shown in table 1, pagO and luxR are causing the detection positive rate in hepatapostema Klebsiella Pneumoniae point
Not Wei 100%, and it is non-cause hepatapostema Klebsiella Pneumoniae in be all 2.78%.In other pathogenic bacteria groups, including it is golden yellow
Color staphylococcus, escherichia coli, Acinetobacter bauamnnii, enterococcus faecium, enterococcus faecalis are feminine gender.
Result above it can be proved that pagO or luxR cause hepatapostema Klebsiella Pneumoniae in have very high specificity,
Respectively or the molecular marked compound of diagnosis of pneumonia klebsiella hepatapostema can be combined as.
The result of PCR detection of table 1 pagO and luxR in clinical strains
Embodiment 3:
PagO and luxR sequence is preparing Klebsiella Pneumoniae hepatapostema diagnostic reagent based on the primer of its sequence design
Application in box:
This experimental design thinking is as follows: the blood culture sample that clinic obtains being divided into blood culture with positive bacteria group and Healthy People is negative
Group, wherein blood culture with positive bacteria group refers to the sample that bacterium is turned out in all blood, is not limited solely to turn out kerekou pneumonia in blood
Primary bacterium, the sample including turning out other pathogenic bacteria.It is detected with PCR special in positive blood culture sample and negative blood culture sample
Sex factor (i.e. pagO and luxR) there are situations, finally PCR result and the final clinical diagnosis correspondence analysis of patient, come with this
Judge method provided by the invention to the recall rate of Klebsiella Pneumoniae hepatapostema.
1. the collection of clinical blood culture sample: collecting 2 groups of blood culture samples, 69 bottles of blood culture with positive bacteria group, Healthy People blood altogether
Negative 40 bottles of the group of culture.
2.PCR detect pagO and luxR in blood culture sample there are situations:
The preparation of 2.1 templates: aseptically, the blood in 3ml culture bottle is extracted, 8000rpm is centrifuged 2min.It abandons
Supernatant is removed, precipitating is mixed into suspension with the piping and druming of 200ul distilled water.Suspension boils 10min at 100 DEG C, then uses 13000rpm, from
Heart 5min, the template that supernatant is detected as PCR.
2.2PCR detect pagO and luxR gene order marker and combinations thereof in two groups of blood culture samples there are feelings
Condition: PCR reaction uses Premix TaqVersion2.0 (TaKaRa, Code:D331A) kit.Illustrated according to kit, if
The PCR reaction system set is 25ul, wherein Premix Taq 12.5ul, genomic DNA template 2ul, upstream and downstream primer 0.5ul
(10uM) adds deionized water 10.5ul to be supplemented to total volume 25ul.PCR reaction condition are as follows: 94 DEG C of denaturation 5min；95 DEG C of 30s, 55
DEG C 30s, 72 DEG C of 30s, 30 circulations；72℃7min；Ago-Gel of the 5ul reaction product for DNA is respectively taken after reaction
Electrophoresis, after running gel dyes 5min with ethidium bromide (Ethidium bromid), Bole (Bio-Rad) gel imaging in the U.S.
Photographic analysis on analyzer.
The primer of pagO are as follows:
PagO_F:TGCTCTTGAAACTATCCCTCC
PagO_R:GGCAATAACTCCCGTCCA
The primer of luxR are as follows:
LuxR_F:CTTTGCCGGCATGGAACATA
LuxR_R:TGAGCCAAATGTATGCCAAGGA
PCR testing result and final patient's confirmed result are shown in Table 2 in blood culture with positive bacteria group.In regulation, pagO and luxR only
It is the positive that want an amplification, which be positive i.e. sample,.Healthy People blood culture feminine gender group is expanded without any band, is feminine gender,
Therefore result is not shown in table 2 and table 3." confirmed result " column "+" indicates that the last diagnostic of patient is kerekou pneumonia primary in table 2
Bacterium hepatapostema, "-" indicate that patient excludes the diagnosis of Klebsiella Pneumoniae hepatapostema, are other diseases.Atopen column (i.e. " pa
GO ", " luxR ", " pagO+luxR ") in "+" indicate that >=1 marker amplification is the positive, "-" indicates the factor detected
It is complete negative.
The final confirmed result of 2 blood culture with positive bacteria group patient of table and PCR amplification result
Wherein in table 2, atopen PCR result in the blood culture sample of No. 10 cases is all positive, but at the beginning
No. 10 cases clinically and have not been diagnosed as Klebsiella Pneumoniae hepatapostema, and applicant suspects that false positive occurs in the factor；But two
Zhou Hou, with disease progression, Finding case hepatapostema is diagnosed as Klebsiella Pneumoniae hepatapostema, thus eliminate it is specific because
Sub- false positive results；This case also illustrates that atopen has the function of early diagnosing Klebsiella Pneumoniae hepatapostema.
The positive rate and false positive rate of each marker in 3 blood culture with positive bacteria group of table
PagO PCR positive rate in the blood culture sample of Klebsiella Pneumoniae hepatapostema patient is 97.37%, in non-pneumonia
Positive rate in klebsiella hepatapostema patient's blood culture sample is only 0%, is 0% in the positive rate of blood culture feminine gender group；
LuxR PCR positive rate in the blood culture sample of Klebsiella Pneumoniae hepatapostema patient is 92.11%, in non-Klebsiella Pneumoniae
Positive rate in hepatapostema patient's blood culture sample is 0%, is 0% in the positive rate of blood culture feminine gender group；PagO+luxR is in lung
PCR positive rate is 97.37% in the blood culture sample of scorching klebsiella hepatapostema patient, in non-Klebsiella Pneumoniae hepatapostema
Positive rate in patient's blood culture sample is only 0%, is 0% in the positive rate of blood culture feminine gender group.These results suggest that pagO
With luxR there is very high specificity in Klebsiella Pneumoniae hepatapostema patient's blood culture with positive bacteria sample, can distinguish or combines
Molecular marker as Klebsiella Pneumoniae hepatapostema quick diagnosis.
SEQUENCE LISTING
<110>Nanjing No.1 Hospital
<120>a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application
<130>a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application
<160> 6
<170> PatentIn version 3.1
<210> 1
<211> 903
<212> DNA
<213>artificial sequence
<400> 1
atgcgtagaa ttactatatt tatattattc ctgttagttg ctgtaacttg gggaaccacg 60
tggttagcta tgaagattgc tcttgaaact atccctccag tctttgctac cgggatgaga 120
tttttatttt ccgctccatt attaatcatt atcgcatggg taaaaaaaat accaatttta 180
tttcctgttg gccagcgtct atttcaactt gcaattagta tgttttattt tgccattcct 240
ttctctctaa tgatttatgg tgaggtttat gtaaacccag gacttgccgc tattatattt 300
gcaaatatgc cggtggctat tttaatagca tcatttttat ttttgaatga aaaaacaaac 360
tcaatacaga ttactggact aattatcgca ttagcttcac tttcgttcat cctcatcacg 420
gaggcgcggg aaaggacaga aagccagtgg acgggagtta ttgccctttc ttctgcagta 480
ataattcatg ccatagtata tactcaatgt aaaaaaagat gctgtaaagt ctctgttata 540
tcgtttaatg cgttaccgtg ttttatagct ggggttattc tttcgctggt ggggagtatc 600
tttgagaggc cacaattatc agctttatct ttacactcta cattagcaac aatgtattta 660
ggctgttttg ctggagtttt tgggatactg tgctattttt ctctgcagaa aagggctagc 720
gctttccagg cttcgctcgt atttctcatc ttccctctaa ttgcagtaag cttggaaagt 780
tatatatatg ggaaaaccat atcaacatac tcaatcttac tgattatccc cctcgtcatt 840
ggaatactta tcacacttat ccccaaaaaa actgtcgttg ataaaaacaa aatgaatagc 900
tga 903
<210> 2
<211> 552
<212> DNA
<213>artificial sequence
<400> 2
atgaaattgt gtgtcgttac aaataataat tatttctttg ccggcatgga acatattttc 60
tcagaggttc aatgctgtct ttgtagaata tcgagttatg atgtatatgc atgcactcct 120
aattcaaacg taatcatttt attggatggt gtgaatcaca aagtttcgat aaaagagtat 180
agctatctaa aaaaaatagg tttacctgtt ttttttattc tgaacacaaa ctgtaatgtt 240
aattccaccc tcatcggaat taacatcatt aacgcacgcg aggctatcac tattttaaaa 300
gatagaatga tttctctctt taatgggggg gggcagcttg attataaacc aataaatttg 360
acaaagaagg agtcttttat tcttagatta tatatagatg gattatcatt aacacagata 420
agtgaaaaaa cagccattag aaaaaaaaca cttataactc acacacgaaa tattcttaat 480
aagaccggtg taaaacacca taatcacctt aatattttaa aaaacatcct tggcatacat 540
ttggctcatt aa 552
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
tgctcttgaa actatccctc c 21
<210> 4
<211> 18
<212> DNA
<213>artificial sequence
<400> 4
ggcaataact cccgtcca 18
<210> 5
<211> 20
<212> DNA
<213>artificial sequence
<400> 5
ctttgccggc atggaacata 20
<210> 6
<211> 22
<212> DNA
<213>artificial sequence
<400> 6
tgagccaaat gtatgccaag ga 22
Claims (3)
- Nucleotide sequence shown in 1.SEQ ID NO.1 or drawing for the design of nucleotide sequence shown in SEQ ID NO.1 Object causes the application in hepatapostema Klebsiella Pneumoniae detection kit in preparation.
- 2. application according to claim 1, it is characterised in that: the primer are as follows: pagO_F: TGCTCTTGAAACTATCCCTCC, pagO_R:GGCAATAACTCCCGTCCA.
- 3. a kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit, comprising:PagO_F:TGCTCTTGAAACTATCCCTCCPagO_R:GGCAATAACTCCCGTCCALuxR_F:CTTTGCCGGCATGGAACATALuxR_R:TGAGCCAAATGTATGCCAAGGA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610669762.XA CN106011154B (en) | 2016-08-15 | 2016-08-15 | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610669762.XA CN106011154B (en) | 2016-08-15 | 2016-08-15 | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011154A CN106011154A (en) | 2016-10-12 |
| CN106011154B true CN106011154B (en) | 2019-05-31 |
Family
ID=57134844
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610669762.XA Active CN106011154B (en) | 2016-08-15 | 2016-08-15 | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011154B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058511A (en) * | 2017-03-01 | 2017-08-18 | 深圳市宝安区沙井人民医院 | One kind sets up the triple qPCR methods of Klebsiella Pneumoniae in quick detection respiratory tract sample |
| CN110669852A (en) * | 2019-11-04 | 2020-01-10 | 深圳市人民医院 | Kit for detecting high-toxicity non-mucus Klebsiella pneumoniae |
| CN116808163A (en) * | 2023-06-16 | 2023-09-29 | 南京市中医院 | Traditional Chinese medicine composition for clearing lung and toxin, preparation method thereof and traditional Chinese medicine and western medicine composition containing same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160574A (en) * | 2011-12-09 | 2013-06-19 | 中山大学达安基因股份有限公司 | Klebsiella pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TW201142037A (en) * | 2010-05-18 | 2011-12-01 | Nat Defense Medical Ct | Rapid test reagent for detecting Klebsiella pneumoniae serotypes K1 and used thereof |
-
2016
- 2016-08-15 CN CN201610669762.XA patent/CN106011154B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160574A (en) * | 2011-12-09 | 2013-06-19 | 中山大学达安基因股份有限公司 | Klebsiella pneumoniae nucleic acid detection kit (PCR-fluorescent probe method) |
Non-Patent Citations (1)
| Title |
|---|
| A Novel Virulence Gene in Klebsiella pneumoniae Strains Causing Primary Liver Abscess and Septic Metastatic Complications;Chi-Tai Fang等;《The Journal of Experimental Medicine》;20040301;第199卷(第5期);697–705 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011154A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946762B (en) | Detect the kit of Friedlander's bacillus | |
| CN103361434A (en) | Multiple fluorescence PCR detection kit and detection method for clostridium difficile toxin genes | |
| CN102230013B (en) | Target sequence, primer, probe and kit for detecting Mycoplasma pneumonia | |
| CN106011154B (en) | A kind of cause hepatapostema Klebsiella Pneumoniae molecular detection kit and its application | |
| CN108531656A (en) | A kind of the duplex PCR detection primer and kit of quick differentiation porcine circovirus 2 type and 3 types | |
| CN107502676A (en) | A kind of primer for being used to detect mycoplasma ovine pneumoniae | |
| CN105779625A (en) | Dual-fluorescence quantitative PCR (Polymerase Chain Reaction) primer, kit and method for simultaneously detecting general type and type 2 Streptococcus suis | |
| CN102242216B (en) | Fluorescent PCR (polymerase chain reaction) detection kit for vibrio cholerae and systematic identification method thereof | |
| CN107142331A (en) | A kind of primer and probe for being used to detect mycoplasma ovine pneumoniae | |
| CN105525023A (en) | Fluorescent quantitative PCR detection kit for clostridium difficile toxin A/B and detection method | |
| CN102776283A (en) | Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis | |
| CN104561277B (en) | For detecting the target sequence and detection kit of mycoplasma pneumoniae | |
| CN104946753A (en) | Specificity primer pair for cow mycoplasma detection, detection kit, as well as using method and application of detection kit | |
| CN111118182B (en) | Specific novel molecular target of serotype listeria monocytogenes and rapid detection method thereof | |
| CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
| Wang et al. | Multilocus sequence typing and virulence analysis of Haemophilus parasuis strains isolated in five provinces of China | |
| CN104846067B (en) | Listeria monocytogenes and enterococcus faecium double PCR detection kit and detection method | |
| Shaebth | Molecular identification and sequencing of Pseudomonas aeruginosa virulence genes among different isolates in Al-Diwaneyah hospital. | |
| CN103305613B (en) | Giant salamander pathogenic hydrophila gingivalis PCR diagnostic kit | |
| CN107988400A (en) | Detect the reagent set of staphylococcus haemolyticus | |
| CN103122383B (en) | Horizontal fluorescent quantitation polymerase chain reaction (PCR) detection method of streptococcus suis strain | |
| CN105886622A (en) | Primer and method for fast typing campylobacter jejuni | |
| CN108570510B (en) | LAMP primer, kit and detection method for detecting haemophilus parasuis | |
| CN111534611A (en) | Fluorescent quantitative PCR method for detecting toxigenic streptococcus suis and corresponding kit | |
| CN104611433B (en) | Target genes for detecting salmonella paratyphi, PCR primer pair as well as detection method and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |