CN106554955A - Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof - Google Patents

Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof Download PDF

Info

Publication number
CN106554955A
CN106554955A CN201610932549.3A CN201610932549A CN106554955A CN 106554955 A CN106554955 A CN 106554955A CN 201610932549 A CN201610932549 A CN 201610932549A CN 106554955 A CN106554955 A CN 106554955A
Authority
CN
China
Prior art keywords
seq
sequence
pkhd1
dna
artificial sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610932549.3A
Other languages
Chinese (zh)
Other versions
CN106554955B (en
Inventor
刘琦
赵金银
邢晓星
杨兰
许立志
于闯
李�杰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Dalian Gentalker Biotechnology Co Ltd
Original Assignee
Dalian Gentalker Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dalian Gentalker Biotechnology Co Ltd filed Critical Dalian Gentalker Biotechnology Co Ltd
Priority to CN201610932549.3A priority Critical patent/CN106554955B/en
Publication of CN106554955A publication Critical patent/CN106554955A/en
Application granted granted Critical
Publication of CN106554955B publication Critical patent/CN106554955B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Pathology (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides high throughput sequencing technologies build method and kit of the sequencing library of PKHD1 gene mutations and application thereof.The method of the sequencing library of the structure PKHD1 gene mutations of the present invention is comprised the following steps：The first round expands；Digestion primer；Second wheel amplification；Purifying reclaims all DNA bands；Sequencing；Analysis.

Description

Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof
Technical field
The present invention relates to biological technical field, specifically, is to build PKHD1 gene mutations by high throughput sequencing technologies Sequencing library method and kit and application thereof.
Background technology
Polycystic kidney disease (PKD) refers to the disease for multiple tumours occurring in kidney and causing kidney structure and function infringement Disease, this tumour involve other organs.Different according to mode of inheritance, PKD is divided into autosomal dominant polycystic kidney disease again And autosomal recessive polycystic kidney disease (ARPKD) (ADPKD).PKD patient's tumour often shows the continuous shape of continuation Into and increase.
ARPKD is a kind of recessive genetic disorder, and its incidence of disease in baby living is 1/20000.ARPKD is mainly to tire Youngster, neonate and children produce serious influence.ARPKD can cause the polycystic kindey phenotype of fetus severe, such as biliary tract defect, amniotic fluid It is very few etc..After neonate's birth of approximately half of ARPKD, because hapamnion causes pulmonary hypoplasia, respiratory insufficiency is dead Die.In the baby of survival, systemic hypertension, renal insufficiency, portal hypertension are also to cause high frequency of disease development and dead The big reason died.Research has shown that ARPKD is caused by PKHD1 genetic mutations, present invention is generally directed to autosomal recessive is lost Pass MCKD (PKHD1 genetic mutations).
PKHD1 is unique Disease-causing gene of current known mankind's autosomal recessive polycystic kidney disease.ARPKD is a kind of It is mainly in children, the single gene inheritance disease with polycystic kindey as phenotype.The Clinical signs of ARPKD have larger difference inside and outside family It is different.About 50% patient fell ill in foetal period, dead with breathing and renal dysfunction during about 30% birth.It is believed that The diversity of PKHD1 mutation is probably the multifarious reason of ARPKD Clinical signs.At present it has been reported that at least 300 kinds PKHD1 Mutation.Including 184 missense mutation, 37 nonsense mutations or lack (frameshit) mutation and 21 classical at 62 insertions Splice site is mutated.These mutation are almost distributed in whole PKHD1 genes, first between PKHD1 mutational sites and clinical symptoms Analysis shows are walked, infant of the mutation with missense mutation that coding is truncated is mostly in perinatal period and introduction stage i.e. death, and spends The mutation of at least one missense is carried the infant that neonatal period can be survived more.Due to the gene of PKHD1 be one very Big gene, has 67 extrons, and wherein protein-coding region domain exon has 66, encodes 4074 amino acid altogether.Therefore, it is right The detection of PKHD1 genes is one wastes time and energy and work that technical requirements are high.
The molecular diagnosis of ARPKD diseases have developed various methods at present, but each method has certain deficiency.
DNA family gene linkage analysis methods：It is a kind of method based on familial study.It is in using genetic marker Parting is carried out in system, recycles mathematical measure to calculate whether genetic marker is isolated with disease generation in family.Linkage analysis It is the relation using chain principle research Disease-causing gene with reference point (genetic marker).By the appropriate heredity of coverage density Label (marker), can find a certain label with Disease-causing gene close linkage, so as to obtain Disease-causing gene in dyeing Accurate location on body.The shortcoming of this method is to need sufficient amount of family member together to participate in identification, and is demonstrate,proved in the ban Person is that new sending out becomes the different time, and linkage analysis method also will be inapplicable.
DNA high pressure liquid chromatography (HPLC)s (DHPLC) method：Its general principle is that first purpose region PCR is expanded, then It is single-chain state by PCR primer heat denatured, then by the change of high pressure liquid chromatography (HPLC) technology for detection wherein base peak value, with this Occur to determine whether mutation.DHPLC method sensitivity is higher, and the recall rate to making a variation can reach 78%, but the method expense It is higher, it is not suitable for widespread adoption.
Other variation screening methods：Denaturing gradient gel electrophoresis (DGGE), single-strand conformation polymorphism analysis (SSCP), high score Distinguish that solubility curve method (HRM) also can be applicable to the detection of PKHD1 genes, but the shortcoming of these methods is directly clearly to become Ectopic sites, can only carry out examination to whetheing there is mutation.
Although traditional generation sequencing (Sanger sequencings) is still the goldstandard of diagnosing human genetic disease variation, by In this technology limitation of itself, efficiency is low for its sequencing, high cost, flux are little etc., and defect makes this technology be competent at huge gene Require with the sequencing of large sample amount, if necessary to the sequencing to whole extrons in the range of whole gene group finding new variation Gene or site, the method are even more helpless.Additionally, sanger sequencings need extremely complex preliminary preparation, entirely Experiment flow includes expanding, purifies, multiple steps such as PCR, repurity are sequenced, and not only takes time and effort, high cost, more exists and intersects Pollution and PCR expand the possibility of failure.With development and the international human genome monoploid of classification genomic sequencing technique Type collection of illustrative plates (HapMap) builds and completes, and the high throughput sequencing technologies (NGS) based on extron sequencing technologies have obtained unprecedented Development.It can not only high flux accurately identify the common change rare variation of XOR, and cost be sequenced be greatly reduced.NGS is Cause a new round to probe into the upsurge of complex inheritance disease, and had been found that within a few years time and invented in a large number and people Class proterties or the new hereditary variation of Complex Diseases association, to further appreciate that the pathogenetic molecular mechanism of human inheritance's disease is provided Important evidence.
The appearance of NGS technologies substantially reduces sequencing cost, and which has high flux, low cost, the low spy of sequencing error rate Point, is rapidly developed in recent years.Using NGS technologies, sequencing can be carried out to the nucleic acid molecules for mixing, while differentiating The sequence independent with each is measured so that large batch of target sequence sequencing can be carried out simultaneously.
Sequence capturing technology is a kind of technology that selective enrichment is carried out to specific genome area, and which passes through suitable side Target area is taken out from genome and is sequenced by method.Conventional sequence capturing method mainly has two kinds at present：PCR methods And hybrid method.PCR methods have the advantages that high sensitivity, high specific and reproducible, have very well in two generation sequencing technologies platforms Application prospect, be suitable for capture some less regions, be particularly some continuous regions.Will be notable using NGS technologies Improve detection efficiency, sensitivity and the specificity of PKHD1 gene mutations.
The content of the invention
For the deficiencies in the prior art, the present inventor has carried out research extensively and profoundly, thus completes the present invention.
It is an object of the present invention to provide a kind of method for building the sequencing library of PKHD1 gene mutations.
It is a further object to provide a kind of kit for building the sequencing library of PKHD1 gene mutations.
For achieving the above object, the present invention is reacted using PCR and respectively introduces one section of oligonucleotide sequence at product two ends, and this two Section oligonucleotide sequence D5 adapter-primers (D5adaptor) sequence and N7 adapter-primers respectively with illumina companies (N7adaptor) sequence is identical, and the oligonucleotide sequence introduced by PCR primer two ends, PCR primer can be directly as sequencings Library is applied to the sequenators such as the Nextseq500/550 of illumina companies, Hiseq 2000/2500/3000, Miseq.
The present invention combines the amplification strategy of multiplex PCR, Ke Yitong while product two ends introduce oligonucleotide sequence Shi Shixian is expanded to one or more specific extrons of the PKHD1 genes of each sample, directly obtains the PKHD1 bases of sample The sequencing library of the specific extron of one or more of cause.
The present invention introduces differentiable D5 adapter-primer sequences and N7 adapter-primer sequences respectively at the PCR primer two ends of sample Row, wherein D5 adapter-primers can serve as the different samples of follow-up differentiation with label (index) information included in N7 adapter-primers Sequence label.
In the present invention, the D5 adapter-primer sequences are by the general sequencing primer sequence in 5 ' ends, (that is, i5, is shown in sequence label Hereafter bolded section) and the general sequencing primer sequence in 3 ' ends be connected in series composition, and the N7 adapter-primer sequences are by 5 ' The general sequencing primer sequence string in the general sequencing primer sequence in end, sequence label (that is, i7, see below bolded section) and 3 ' ends Connection connection composition.
In the present invention, reacted using PCR and one section of oligonucleotide sequence, two sections of oligonucleotides are respectively introduced at product two ends Sequence is identical with D5 adapter-primer sequences and N7 adapter-primer sequences respectively, wherein, the D5 adapter-primer sequences are selected from：
D501
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:1)、
D502
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:2)、
D503
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:3)、
D504
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:4)、
D505
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:5)、
D506
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:6)、
D507
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:7) and
D508
(AATGATACGGCGACCACCGAGATCTACAC ACACTCTTTCCCTACACGACGCTCTTCCGATCT)(SEQ ID NO:8) in, and
The N7 adapter-primer sequences are selected from：
N701
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:9)、
N702
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:10)、
N703
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:11)、
N704
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:12)、
N705
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:13)、
N706
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:14)、
N707
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:15)、
N708
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:16)、
N709
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:17)、
N710
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:18)、
N711
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:19) and
N712
(CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT)(SEQ ID NO:20) in.
Therefore, on the one hand, the invention provides a kind of method of the sequencing library of structure PKHD1 gene mutations, including with Lower step：
The first round expands：Using include by with selected from one in above-mentioned D5 adapter-primer sequences and N7 adapter-primer sequences All or part (that is, the ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ of the general sequencing primer sequence in 3 ' ends ID NO:21) with GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:One of 22) full sequence Or its 3` end starts the sequence that more than 13 continuous deoxyribonucleotides are constituted, for example, CCTACACGACGCTCTTCCGATCT (SEQ ID NO:23)) the positive specificity amplification primer sequence series connection of identical sequence and PKHD1 genes each extrons connects Connect composition first round forward direction amplimer and by with selected from another one in D5 adapter-primer sequences and N7 adapter-primer sequences 3 ' the general sequencing primer sequences in end all or part (that is, ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) with GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:The other of 22) whole sequences Row or its 3` end start the sequence that more than 13 continuous deoxyribonucleotides are constituted, for example, TTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:24)) identical sequence and PKHD1 genes each extrons is reverse Specificity amplification primer sequence is connected in series the combination of the first round amplimer of the first round reverse amplimer of composition to each One or more extrons of the PKHD1 genes of sample are expanded, and what now multiplex amplification worked is each extron Specificity amplification primer sequence, the result of amplification cause the two ends of each amplified production fragment to add the general sequencing Primer sequence it is part or all of, wherein, the D5 adapter-primer sequences be selected from SEQ ID NO:1～SEQ ID NO:In 8, institute N7 adapter-primer sequences are stated selected from SEQ ID NO:9～SEQ ID NO:In 20；
Digestion primer：With remaining primer and primer dimer in single-stranded digestion enzymic digestion first round amplified production；
Second wheel amplification：Product with first round amplification as template, using by with selected from the D5 adapter-primer sequences and In N7 adapter-primer sequences one identical second take turns positive amplimer and with selected from D5 adapter-primer sequences and N7 joints In primer sequence, another one identical second takes turns combination (that is, the D5 joints of the second wheel amplimer of reverse amplimer composition The combination of primer sequence and N7 adapter-primer sequences), what now amplification was worked is the general sequencing primer sequence, amplification Result cause last amplified production and all adding can distinguish each sample corresponding to D5 adapter-primer sequences and N7 joints The sequence label of primer sequence, wherein, the D5 adapter-primer sequences are selected from SEQ ID NO:1～SEQ ID NO:It is in 8, described N7 adapter-primer sequences are selected from SEQ ID NO:9～SEQ ID NO:In 20；
Purifying reclaims all DNA bands, preferably uses purifying magnetic bead screening and reclaims all DNA between the scope of target area Band；
Sequencing：After the product of recovery is carried out quantitatively, according to sequencing data amount, the product of different labels is required into that mixing is laggard Machine sequencing on row；
Analysis：Based on the sequence label of each sample, the sequencing result for obtaining and sample are corresponded, and according to every The primer sequence of individual gene, sequence is corresponded on each gene of sample.
In the present invention, it is preferable that the extron of the PKHD1 genes can include aobvious selected from PKHD1 gene 1-67 extras One or more in son.
In the method for the sequencing library of the structure PKHD1 gene mutations of the present invention, it is preferable that the first round amplimer Combination include selected from SEQ ID NO:25～SEQ ID NO:One or more pairs of in 230, preferably described first round amplification is drawn The combination of thing includes SEQ ID NO:25～SEQ ID NO:230, the combination of more preferably described first round amplimer is by SEQ ID NO:25～SEQ ID NO:230 compositions.
In the present invention, it is preferable that the quantity of the sample can be less than 96 (8 kinds of D5 adapter-primers and 12 kinds of N7 joints Primer is combined one by one).
The library may be directly applied to the Nextseq500/550 of illumina companies, Hiseq 2000/2500/ 3000th, the sequenator such as Miseq carries out machine sequencing.Meanwhile, through the second wheel amplification, illumina companies are introduced in product and is led to D5 adapter-primer sequences and N7 adapter-primer sequences, being used directly for sequencing library carries out high-flux sequence.
On the other hand, the invention provides a kind of kit of the sequencing library of structure PKHD1 gene mutations, the reagent Box includes：
The combination of first round amplimer：Corresponding amplimer is designed according to PKHD1 genes to be measured, according to survey used The primer size scope design PCR primer length that sequence instrument and sequence measurement are suitable for, in positive amplimer and reverse amplimer 5` ends add respectively the preceding paragraph and D5 adapter-primer sequences and N7 adapter-primer sequences general sequencing primer sequence whole Or part identical sequence, the amplimer combination of the composition first round, wherein, first round forward direction amplimer by with selected from upper State 3 ' of one in the D5 adapter-primer sequences and N7 adapter-primer sequences all or part for holding general sequencing primer sequence (that is, ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:The other of 22) full sequence or its 3` end Start the sequence that more than 13 continuous deoxyribonucleotides are constituted, such as CCTACACGACGCTCTTCCGATCT (SEQ ID NO:23)) the positive specificity amplification primer sequence of each extron of identical sequence and PKHD1 genes is connected in series composition, with And first round reverse amplimer by with selected from 3 ' ends of another one in D5 adapter-primer sequences and N7 adapter-primer sequences All or part (that is, ACACTCTTTCCCTACACGACGCTCTTCCGATCT (the SEQ ID of general sequencing primer sequence NO:21) with GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:The other of 22) full sequence Or its 3` end starts the sequence that more than 13 continuous deoxyribonucleotides are constituted, for example, TTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:24)) each extron of identical sequence and PKHD1 genes is reverse Specificity amplification primer sequence is connected in series composition, wherein, the D5 adapter-primer sequences are selected from D501-D508 (SEQ ID NO:1～SEQ ID NO:8), in, the N7 adapter-primer sequences are selected from N701-N712 (SEQ ID NO:9～SEQ ID NO: 20) in；
The general sequencing primer sequence of high-flux sequence of the general sequencing primer sequence illumina company of the present invention, Hold general sequencing primer sequence in 3 ' for being corresponded on D5 adapter-primers and N7 adapter-primers respectively；
The combination of the second wheel amplimer：By with selected from one in the D5 adapter-primer sequences and N7 adapter-primer sequences Identical second takes turns positive amplimer and identical with selected from another one in D5 adapter-primer sequences and N7 adapter-primer sequences The second reverse amplimer of wheel constitute (that is, the combination of D5 adapter-primer sequences and N7 adapter-primer sequences).
The combination of the second wheel amplimer is to use different D5 adapter-primers and N7 adapter-primers according to the quantity of sample Sequence sequence label combination (sequence label be one section of sequence in D5 adapter-primers and N7 adapter-primer sequences (that is, [i5] and [i7])) so that each sample can be distinguished, using by with selected from one phase in the D5 adapter-primer sequences and N7 adapter-primer sequences With the positive amplimer of the second wheel and with selected from another one identical in D5 adapter-primer sequences and N7 adapter-primer sequences Combination (that is, D5 adapter-primer sequences and the N7 adapter-primer sequences of the second wheel amplimer of the reverse amplimer composition of the second wheel The combination of row), wherein, the D5 adapter-primer sequences are selected from D501-D508 (SEQ ID NO:1～SEQ ID NO:8) in, institute N7 adapter-primer sequences are stated selected from N701-N712 (SEQ ID NO:9～SEQ ID NO:20) in, wherein, second wheel expands The combination for increasing primer is included selected from D501～D508 (SEQ ID NO:1～SEQ ID NO:One of and N701～N712 8) (SEQ ID NO:9～SEQ ID NO:One of 20) the Tag primer sequence of composition is one or more pairs of, so that each sample can area Point.
In the kit of the sequencing library of the structure PKHD1 gene mutations of the present invention, it is preferable that the first round amplification is drawn The combination of thing is included selected from SEQ ID NO:25～SEQ ID NO:It is one or more pairs of in 230, preferably described first round amplification The combination of primer includes SEQ ID NO:25～SEQ ID NO:230, the combination of more preferably described first round amplimer is by SEQ ID NO:25～SEQ ID NO:230 compositions.
In the present invention, it is preferable that the kit further includes archaeal dna polymerase, the enzyme for being adopted is high-fidelity DNA Polymerase, thus reduces the DNA mutation rate that amplification brings.
In the present invention, it is preferable that the kit further includes single-stranded digestive ferment, single-stranded digestive ferment used is nucleic acid Excision enzyme I (Exonuclease I), the enzyme are single-stranded specific 3 ' → 5 ' exonuclease, do not decompose double-stranded DNA and RNA.
In the present invention, it is preferable that NGS technologies will significantly improve the detection efficiency of PKHD1 gene mutations, sensitivity and special Property.
In the present invention, it is highly preferred that the invention provides a kind of build the sequencing text for including PKHD1 gene extron subregions The kit in storehouse, wherein, the PKHD1 exon regions can include one or more selected from following 67 exon regions Exon region (preferably, can include following 67 exon regions；It is highly preferred that can be by following 67 exon 1s Domain constitutes), the kit includes：
First round amplimer is combined：Including the one or more pairs of of the primer in following table, it is preferable that including in following table Primer, it is highly preferred that be made up of the primer in following table,
In the present invention, what above-mentioned extron was known in the art, its sequence information for example from GenBank, PKHD1NM138694。
The combination of the second wheel amplimer, which is included selected from D501～D508 (SEQ ID NO:1～SEQ ID NO:8) One of and N701～N712 (SEQ ID NO:9～SEQ ID NO:One of 20) a pair or many of the Tag primer sequence of composition It is right, so that each sample can be distinguished：
The present invention has the advantages that：
The present invention makes first round multi-PRC reaction only carry out linear amplification by the period of optimization multi-PRC reaction, The amplification efficiency difference between multi-primerses is reduced to greatest extent, by the parallel amplification of universal primer during the second wheel amplification, The associated products amount of each extron of PKHD1 genes in multiplex amplification product is close to as far as possible, improve the effective of sequencing data Property.
In the present invention, to use the general sequencing primer sequence+PKHD1 genes of high-flux sequence each for first round amplification The mixture of the amplimer combination of the specific primer composition of individual extron, what at this time multiplex amplification worked are that each is outer aobvious The particular sequence of son, adds general sequencing primer sequence before each extron.What the second wheel amplimer was adopted It is the sequencing sequence of the joint sequence+sequence label+general of high-flux sequence, what at this time amplification was worked is general sequencing Sequence, all adds differentiable sequence label before last product again, meanwhile, product can enter directly as sequencing library Row high-flux sequence (Nextseq500/550 of illumina companies, Hiseq 2000/2500/3000, Miseq etc.).Pass through Rational design of primers and PCR are tactful above, directly add D5 adapter-primers and N7 adapter-primer sequences in the 5` ends of PCR primer Row.By differentiable sequence label being introduced to each sample, make sample when second generation high throughput sequencing technologies are detected, often The sequencing result of individual sample can be given for change by its unique sequence label, can apply to while detecting many of great amount of samples Individual different genes site, greatly reduces sequencing cost.
Specific embodiment
The present invention is described in further details in conjunction with embodiment, embodiment is only limitted to the explanation present invention, rather than to this The restriction of invention.
Equipment and reagent used in following examples is as follows：Poba gene group extracts kit (Tiangeng biochemical technology Co., Ltd), supercentrifuge SIGMA 3-30K, nucleic acid augmentative instrument ABI 9700, Illumina sequenators, multiplex amplification examination Agent GeneRead DNAseq panel PCR Kit v2 (181942), high-fidelity amplification enzyme Kapa BiosystemsHiFi HS (kk2602), exonuclease Takara (Exonuclease I (E.coli)), purifies magnetic bead Beckman Agencourt AMPure XP。
Embodiment 1
Cause 67 extron sequencings of the gene PKHD1 of autosomal recessive polycystic kidney disease, totally 15, i.e., 15 Normal human gene group DNA's sample.
1) design of primers：
Corresponding amplimer, relevant parameter are designed for 67 extrons of PKHD1 genes：58.0 DEG C -62.0 of Tm values DEG C, GC values 40.0%-60.0%, primer 22 ± 3bp of size.Distinguish at the 5` ends of positive amplimer and reverse amplimer Plus the sequencing primer sequence identical sequence that the preceding paragraph is general with 3 ' end high-flux sequences of D5 adapter-primers and N7 adapter-primers, Designed primer is as follows, and wherein underscore is general sequencing primer sequence (that is, the SEQ ID NO of the high-flux sequence for introducing: 23 and SEQ ID NO:24)：
In the present embodiment, during the Primer selection of the second wheel amplification, according to 15 samples using 15 pairs of sequence label combinations, The sequence label that can be distinguished is added to each purpose fragment of each sample in the second wheel amplification, designed primer is such as Under, wherein underscore is general sequencing sequence (that is, the universal sequence of the first round, this sequence when the second wheel amplification for introducing Row play a part of amplimer)：
Table 1：The list of 15 sample 15 pairs of labels of correspondence
D504 D505 D506 D507 D508
N703 1# 4# 7# 10# 13#
N704 2# 5# 8# 11# 14#
N705 3# 6# 9# 12# 15#
2) first round amplification：
Each pair primer individually debug it is qualified after, 103 pairs of primers are diluted to into 100 μM respectively, then mixed in equal amounts, PCR bodies System：4.4 μ L 5x PCR buffer, 2 μ L mix primers, 1.5 μ L taq (5U/ μ L), 2.5 μ L template DNAs (5ng/ μ L), ddH2O adds to 22 μ L.PCR reactions are carried out by following conditions：95 DEG C of holding 15min of template DNA denaturation.PCR reaction cycle bars Part：
20 circulations are carried out below：
1st step：95 DEG C carry out 30 seconds；
2nd step：60 DEG C carry out 4 minutes；
After the completion of 20 circulations, 72 DEG C of holding 10min are finally maintained at 4 DEG C.
3) digest primer
First round amplified production carries out digestion residual using Takara Exonuclease I and draws to first round amplified production Thing, digestion system：Exonuclease I (50U/ μ L) 0.5 μ L, 20 μ L of PCR primer,
Endonuclease reaction is carried out by following conditions：37 DEG C, 30min；
4) purifying is reclaimed：The fragment that 0.6-0.9x magnetic beads are carried out between screening 200-400bp (reduces the amplification of the second wheel Non-specific amplification)
5) the second wheel amplification
15 pairs of differentiable tag combinations are composed of respectively by Tag primer upstream and downstream, when the second wheel PCR is expanded Discernible sequence label is added respectively to 15 samples, sample two ends tag combination is shown in Table 2, PCR system：HiFiHS (kk2602) 25 μ L of 2X mix, 0.75 μ L forward direction amplimer, 0.75 μ L reverse amplimers are sieved after 5-10 μ L digestion primers The PCR primer (the pcr products institute dosage screened after digestion is between 80-120ng) of choosing, ddH2O adds to 50 μ L.PCR reacts Carry out by following conditions：98 DEG C of holding 45s of template DNA denaturation.PCR reaction cycle conditions：
8 circulations are carried out below：
1st step：98 DEG C carry out 15s；
2nd step：60 DEG C carry out 30s；
3rd step：72 DEG C carry out 30s；
After the completion of 13 circulations, 72 DEG C of holding 1min are finally maintained at 4 DEG C.
2 sample two ends tag combination table of table
D504 D505 D506 D507 D508
N703 1# 4# 7# 10# 13#
N704 2# 5# 8# 11# 14#
N705 3# 6# 9# 12# 15#
6) reclaim：Reclaim all DNA bands between 350bp-450bp scopes；
7) it is sequenced：After the product of recovery is carried out quantitatively, the product of different labels is required after mixing according to sequencing data amount The machine of carrying out sequencing (Nextseq500, PE150)；
8) analyze：The sequencing result of Illumina Nextseq500 products is a series of DNA sequence dnas, by searching sequencing As a result in, the respective differentiable sequence label of 15 samples, the sequencing result for obtaining is corresponded with sample first, Ran Hougen According to the respective primer sequence of each extron, then sequence is corresponded on each target area of sample.Each of 15 samples Extron can find corresponding data, the corresponding reads numbers of each sample (sequence bar number) such as table 3 below in sequencing result It is shown, the corresponding sequence bar number of each exon sequence (only listing the data of 1# samples) as shown in table 4 below.
The corresponding sequence bar number of each sample of table 3 and GC_ numbers
The corresponding sequence bar number of table 4PKHD1 exon region target sequences (by taking No. 1 sample as an example)
Table 3 shows by said method, successfully constructs the library for being applied to be sequenced, and each library can be corresponding Obtaining corresponding sequencing sequence proves by high throughput sequencing technologies to PKHD1 detection in Gene Mutation it is successful.
Table 4 by taking one of sample as an example lists the sequence number of 103 pairs of primers in multiplex amplification, shows multiplex amplification The primer that further illustrates for the design of 67 extrons of PKHD1 genes of validity all can use.
<110>Bioisystech Co., Ltd of big crystal stock Thailand
<120>Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof
<130> DI16-1142-XC37
<160> 230
<170> PatentIn version 3.3
<210> 1
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D501
<400> 1
aatgatacgg cgaccaccga gatctacact agatcgcaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 2
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D502
<400> 2
aatgatacgg cgaccaccga gatctacacc tctctataca ctctttccct acacgacgct 60
cttccgatct 70
<210> 3
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D503
<400> 3
aatgatacgg cgaccaccga gatctacact atcctctaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 4
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D504
<400> 4
aatgatacgg cgaccaccga gatctacaca gagtagaaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 5
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D505
<400> 5
aatgatacgg cgaccaccga gatctacacg taaggagaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 6
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D506
<400> 6
aatgatacgg cgaccaccga gatctacaca ctgcataaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 7
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D507
<400> 7
aatgatacgg cgaccaccga gatctacaca aggagtaaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 8
<211> 70
<212> DNA
<213>Artificial sequence
<220>
<223> D508
<400> 8
aatgatacgg cgaccaccga gatctacacc taagcctaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 9
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N701
<400> 9
caagcagaag acggcatacg agattaaggc gagtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 10
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N702
<400> 10
caagcagaag acggcatacg agatcgtact aggtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 11
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N703
<400> 11
caagcagaag acggcatacg agataggcag aagtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 12
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N704
<400> 12
caagcagaag acggcatacg agattcctga gcgtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 13
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N705
<400> 13
caagcagaag acggcatacg agatggactc ctgtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 14
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N706
<400> 14
caagcagaag acggcatacg agattaggca tggtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 15
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N707
<400> 15
caagcagaag acggcatacg agatctctct acgtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 16
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N708
<400> 16
caagcagaag acggcatacg agatcagaga gggtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 17
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N709
<400> 17
caagcagaag acggcatacg agatgctacg ctgtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 18
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N710
<400> 18
caagcagaag acggcatacg agatcgaggc tggtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 19
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N711
<400> 19
caagcagaag acggcatacg agataagagg cagtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 20
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223> N712
<400> 20
caagcagaag acggcatacg agatgtagag gagtgactgg agttcagacg tgtgctcttc 60
cgatct 66
<210> 21
<211> 33
<212> DNA
<213>Artificial sequence
<220>
<223>The general sequencing primer sequence in the 3' ends of D5 adapter-primer sequences
<400> 21
acactctttc cctacacgac gctcttccga tct 33
<210> 22
<211> 34
<212> DNA
<213>Artificial sequence
<220>
<223>The general sequencing primer sequence in the 3' ends of N7 adapter-primer sequences
<400> 22
gtgactggag ttcagacgtg tgctcttccg atct 34
<210> 23
<211> 23
<212> DNA
<213>Artificial sequence
<220>
<223>The part of the general sequencing primer sequence in the 3' ends of D5 adapter-primer sequences
<400> 23
cctacacgac gctcttccga tct 23
<210> 24
<211> 24
<212> DNA
<213>Artificial sequence
<220>
<223>The part of the general sequencing primer sequence in the 3' ends of N7 adapter-primer sequences
<400> 24
ttcagacgtg tgctcttccg atct 24
<210> 25
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon1-F
<400> 25
cctacacgac gctcttccga tctacctttt ttttctgttt ctgtctcc 48
<210> 26
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon2_1-F
<400> 26
cctacacgac gctcttccga tctttaaacc caaaagcaaa taccttaaca cc 52
<210> 27
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon2_2-F
<400> 27
cctacacgac gctcttccga tctacacatt ctactgacct gccaaaa 47
<210> 28
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon3-F
<400> 28
cctacacgac gctcttccga tctcccttca ggcccacttt taca 44
<210> 29
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon4-F
<400> 29
cctacacgac gctcttccga tctagataag caaaaatccc tcatcctgtc 50
<210> 30
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon5-F
<400> 30
cctacacgac gctcttccga tctctggctc atttacaatt tgcctttca 49
<210> 31
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon6-F
<400> 31
cctacacgac gctcttccga tctgaagaag ttaaattttc ccactcataa aaacca 56
<210> 32
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon7_1-F
<400> 32
cctacacgac gctcttccga tctccagttg caattacatt aacaaagttt gc 52
<210> 33
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon7_2-F
<400> 33
cctacacgac gctcttccga tctaacaaac acacacttac ctatcaatgt act 53
<210> 34
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon8-F
<400> 34
cctacacgac gctcttccga tcttgtgttg tatccatgtg gacgaa 46
<210> 35
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon9-F
<400> 35
cctacacgac gctcttccga tctttatcct catgagaacc aatcttgcaa t 51
<210> 36
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon10-F
<400> 36
cctacacgac gctcttccga tcttccgtca taaaaagata aagaaagtaa gcaaga 56
<210> 37
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon11-F
<400> 37
cctacacgac gctcttccga tctgggtgtt aatggtcatc aagaaatgg 49
<210> 38
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon12-F
<400> 38
cctacacgac gctcttccga tctcttcctc ctgcatccct catg 44
<210> 39
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon13-F
<400> 39
cctacacgac gctcttccga tctgctcact gagtaagcca gtcaaata 48
<210> 40
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon14-F
<400> 40
cctacacgac gctcttccga tcttccttat ctgtctccta gcctcac 47
<210> 41
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon15-F
<400> 41
cctacacgac gctcttccga tctacatgag agccttaact ttgattcttt ct 52
<210> 42
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon16_1-F
<400> 42
cctacacgac gctcttccga tcttgaatct ggacaccaat cctcatc 47
<210> 43
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon16_2-F
<400> 43
cctacacgac gctcttccga tctcagcaag gttataatga cccctcag 48
<210> 44
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon17-F
<400> 44
cctacacgac gctcttccga tctttgaaga agtctcccac cagatg 46
<210> 45
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon18-F
<400> 45
cctacacgac gctcttccga tcttgatgaa aaagacaatc agaatgaagc c 51
<210> 46
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon19-F
<400> 46
cctacacgac gctcttccga tctccagaga gcaataccaa tacctacc 48
<210> 47
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon20-F
<400> 47
cctacacgac gctcttccga tctactgtcc ccaaaacagt gaatcc 46
<210> 48
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon21-F
<400> 48
cctacacgac gctcttccga tctgcttgtg gaggagagag aatttgat 48
<210> 49
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon22-F
<400> 49
cctacacgac gctcttccga tctaaggcca acaagcattc ttagga 46
<210> 50
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon23-F
<400> 50
cctacacgac gctcttccga tctggatgtt gttcccttgg gaatgt 46
<210> 51
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon24-F
<400> 51
cctacacgac gctcttccga tctgcagcaa atccatgcca ctag 44
<210> 52
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon25-F
<400> 52
cctacacgac gctcttccga tctcacttag ggtggcccat tca 43
<210> 53
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon26-F
<400> 53
cctacacgac gctcttccga tctatcacca gctacatggc ctcta 45
<210> 54
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon27_1-F
<400> 54
cctacacgac gctcttccga tctagagggt ctcaccaaca tcaaga 46
<210> 55
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon27_2-F
<400> 55
cctacacgac gctcttccga tctagtaaac aaaagacagt gagtcacagt 50
<210> 56
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon28-F
<400> 56
cctacacgac gctcttccga tcttatatta acagtggtca ctcacccaga 50
<210> 57
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon29-F
<400> 57
cctacacgac gctcttccga tctttgattg ccctttttat aggaccaatg 50
<210> 58
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon30-F
<400> 58
cctacacgac gctcttccga tctccatcaa acaaatccaa aattaatgca agtg 54
<210> 59
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon31-F
<400> 59
cctacacgac gctcttccga tcttctctga cctcactggc aaattaatc 49
<210> 60
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_1-F
<400> 60
cctacacgac gctcttccga tcttgtggtt accagagaca ccca 44
<210> 61
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_2-F
<400> 61
cctacacgac gctcttccga tctttccaga agtgaaagga gctacc 46
<210> 62
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_3-F
<400> 62
cctacacgac gctcttccga tctccctaat cagcacagtg gtcag 45
<210> 63
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_4-F
<400> 63
cctacacgac gctcttccga tctcattccc tgtgggaaca atgc 44
<210> 64
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_5-F
<400> 64
cctacacgac gctcttccga tctccagaac aagcataccc atttcttg 48
<210> 65
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_6-F
<400> 65
cctacacgac gctcttccga tctaattgct ggagcaccac aga 43
<210> 66
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_7-F
<400> 66
cctacacgac gctcttccga tctaggctaa cctggcagag aatg 44
<210> 67
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_8-F
<400> 67
cctacacgac gctcttccga tctgctcgcc tccgttaagt tca 43
<210> 68
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_9-F
<400> 68
cctacacgac gctcttccga tctttgtgat ttctccttgc atggc 45
<210> 69
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon33_1-F
<400> 69
cctacacgac gctcttccga tcttaacagg tggcctcaga ttctaacta 49
<210> 70
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon33_2-F
<400> 70
cctacacgac gctcttccga tcttgtagca ttagccagga ctcg 44
<210> 71
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon34_1-F
<400> 71
cctacacgac gctcttccga tctctgccca atgatctggc aca 43
<210> 72
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon34_2-F
<400> 72
cctacacgac gctcttccga tctctgccca atgatctggc aca 43
<210> 73
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon35_1-F
<400> 73
cctacacgac gctcttccga tctagcgttt ccgtatctca gtaatcttg 49
<210> 74
<211> 55
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon35_2-F
<400> 74
cctacacgac gctcttccga tctaactatg aattcagata ttgtgcatta gacca 55
<210> 75
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon36_1-F
<400> 75
cctacacgac gctcttccga tcttgagtcc aaagaaaggc ctttca 46
<210> 76
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon36_2-F
<400> 76
cctacacgac gctcttccga tctatgcttg tgttagtgtc cagca 45
<210> 77
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon37_1-F
<400> 77
cctacacgac gctcttccga tctgatcaat tgcctcactc accgt 45
<210> 78
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon37_2-F
<400> 78
cctacacgac gctcttccga tctagcaaac aattgggaac ggtagt 46
<210> 79
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon38_1-F
<400> 79
cctacacgac gctcttccga tctttgtcaa aatgtctacc attatttaag cagaag 56
<210> 80
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon38_2-F
<400> 80
cctacacgac gctcttccga tctagtgaca atctcttcca tcggtttg 48
<210> 81
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon39-F
<400> 81
cctacacgac gctcttccga tcttgctcat tagactttcc aacaaaacac 50
<210> 82
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon40-F
<400> 82
cctacacgac gctcttccga tctagaaaga aacatgagaa agtcctaggt c 51
<210> 83
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon41-F
<400> 83
cctacacgac gctcttccga tctgtgtcct acacaagaat gcagaaattc 50
<210> 84
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon42-F
<400> 84
cctacacgac gctcttccga tctatgcaca ataaacttaa gagacctaac attttg 56
<210> 85
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon43-F
<400> 85
cctacacgac gctcttccga tctcacccct gattgagaaa gaactttatg 50
<210> 86
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon44-F
<400> 86
cctacacgac gctcttccga tctgcccaaa gtgctctcat tgtg 44
<210> 87
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon45_1-F
<400> 87
cctacacgac gctcttccga tctaaaaagc ttacctgggc acca 44
<210> 88
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon45_2-F
<400> 88
cctacacgac gctcttccga tctagaaaat gacctaaccc tggattagtg 50
<210> 89
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon46-F
<400> 89
cctacacgac gctcttccga tctgggccca gcacatgtaa ttttg 45
<210> 90
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon47-F
<400> 90
cctacacgac gctcttccga tctgccttat ttatcatctg ttctgtctat tcaaat 56
<210> 91
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon48_1-F
<400> 91
cctacacgac gctcttccga tctatgattc agcagctgtc aaaattattc c 51
<210> 92
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon48_2-F
<400> 92
cctacacgac gctcttccga tctacccgac caaagcttga attga 45
<210> 93
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon49_1-F
<400> 93
cctacacgac gctcttccga tctttgcaat gagtaggtct cttggtc 47
<210> 94
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon49_2-F
<400> 94
cctacacgac gctcttccga tctagcttat attcatctgg ccaaaatact attgaa 56
<210> 95
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon50_1-F
<400> 95
cctacacgac gctcttccga tctccataac acacagctgt ccctt 45
<210> 96
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon50_2-F
<400> 96
cctacacgac gctcttccga tctggttctg acctggtgat ggaag 45
<210> 97
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon51-F
<400> 97
cctacacgac gctcttccga tctaacagta tgacaaggtg gaatttgtag aa 52
<210> 98
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon52-F
<400> 98
cctacacgac gctcttccga tctgggttca gcctgtctgt gatt 44
<210> 99
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon53-F
<400> 99
cctacacgac gctcttccga tctagcccct tctcacagaa tataattctc a 51
<210> 100
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon54-F
<400> 100
cctacacgac gctcttccga tctacaagca cacaatacac acacatg 47
<210> 101
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon55-F
<400> 101
cctacacgac gctcttccga tcttcatatt gtaacaaaat ctcaagcaga agc 53
<210> 102
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon56-F
<400> 102
cctacacgac gctcttccga tctaggttac caaacatggt cttcctag 48
<210> 103
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon57-F
<400> 103
cctacacgac gctcttccga tcttgtccca gatgaatagg ctcca 45
<210> 104
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_1-F
<400> 104
cctacacgac gctcttccga tctccactga tttggttctg aggtgaata 49
<210> 105
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_2-F
<400> 105
cctacacgac gctcttccga tctaccattg tggctatcaa tactcagc 48
<210> 106
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_3-F
<400> 106
cctacacgac gctcttccga tctgcagaaa atacatacac tactgccaaa ag 52
<210> 107
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_4-F
<400> 107
cctacacgac gctcttccga tctggcctga ccctctaaat ctatgc 46
<210> 108
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_5-F
<400> 108
cctacacgac gctcttccga tctacattgt cagaccaaag cagttca 47
<210> 109
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon59_6-F
<400> 109
cctacacgac gctcttccga tctttaatgt accttaccat tctaagattc atttct 56
<210> 110
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon59_7-F
<400> 110
cctacacgac gctcttccga tctttatctt ttatctttag catcctggtc ctc 53
<210> 111
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon60-F
<400> 111
cctacacgac gctcttccga tctacaagca cccttgcctc tac 43
<210> 112
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_1-F
<400> 112
cctacacgac gctcttccga tctctgttgg cgaatcacca atttcaa 47
<210> 113
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_2-F
<400> 113
cctacacgac gctcttccga tctaatcagc cctcatttgg atgtgaatat 50
<210> 114
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_3-F
<400> 114
cctacacgac gctcttccga tctaagcgca aaacttgagg agtttg 46
<210> 115
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_4-F
<400> 115
cctacacgac gctcttccga tcttcctctc cttgtaggac aacataca 48
<210> 116
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_5-F
<400> 116
cctacacgac gctcttccga tcttgtcagc aatggccttt aaggt 45
<210> 117
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_6-F
<400> 117
cctacacgac gctcttccga tctaactgga tataacttct gaattgccca a 51
<210> 118
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_7-F
<400> 118
cctacacgac gctcttccga tctgaaacag tgtcttaaca agtctttcca ttt 53
<210> 119
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon62-F
<400> 119
cctacacgac gctcttccga tctaaaagat aggctgaatg ctacatgct 49
<210> 120
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon63-F
<400> 120
cctacacgac gctcttccga tctaacattt tctgtgcaga taaagtggta ac 52
<210> 121
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon64-F
<400> 121
cctacacgac gctcttccga tctgaataaa agcacactgt ataaaattac ctggag 56
<210> 122
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon65_1-F
<400> 122
cctacacgac gctcttccga tcttttagag aagctcacaa aaatttgtct ttgg 54
<210> 123
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon65_2-F
<400> 123
cctacacgac gctcttccga tctgatgatg gtcgacttct ccttcc 46
<210> 124
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon66-F
<400> 124
cctacacgac gctcttccga tctaggctca gaccatccac agt 43
<210> 125
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_1-F
<400> 125
cctacacgac gctcttccga tctctctctt cttagttgtc ccagcag 47
<210> 126
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_2-F
<400> 126
cctacacgac gctcttccga tctgcttact cagccgactt tgc 43
<210> 127
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_3-F
<400> 127
cctacacgac gctcttccga tcttgtgatg ccagtagtac cagga 45
<210> 128
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon1-R
<400> 128
ttcagacgtg tgctcttccg atcttcatta aacttaccca tggtcagg 48
<210> 129
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon2_1-R
<400> 129
ttcagacgtg tgctcttccg atctcctggc tgatctctct gatgagta 48
<210> 130
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon2_2-R
<400> 130
ttcagacgtg tgctcttccg atcttcctta atttcccagg tttcagaaca g 51
<210> 131
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon3-R
<400> 131
ttcagacgtg tgctcttccg atctttgctt aaaatattgc agaaggtagt ggt 53
<210> 132
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon4-R
<400> 132
ttcagacgtg tgctcttccg atctgtcctg tgtcaatgac aattctatgc 50
<210> 133
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon5-R
<400> 133
ttcagacgtg tgctcttccg atctcaagtg ggctgctagc tttg 44
<210> 134
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon6-R
<400> 134
ttcagacgtg tgctcttccg atctaccttc aagtaatgct gtctgagg 48
<210> 135
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon7_1-R
<400> 135
ttcagacgtg tgctcttccg atctggatta tcactggaag attggaaact tttg 54
<210> 136
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon7_2-R
<400> 136
ttcagacgtg tgctcttccg atctagtatt aattttctgg gccatgacct g 51
<210> 137
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon8-R
<400> 137
ttcagacgtg tgctcttccg atctgccatg tttcctctga gttttgtg 48
<210> 138
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon9-R
<400> 138
ttcagacgtg tgctcttccg atcttggttt tcttttgctt tctactttcc tg 52
<210> 139
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon10-R
<400> 139
ttcagacgtg tgctcttccg atcttgatat tggagtcttt gggcttatga aa 52
<210> 140
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon11-R
<400> 140
ttcagacgtg tgctcttccg atctcaatag aggttagttc ccaatcttcc ttt 53
<210> 141
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon12-R
<400> 141
ttcagacgtg tgctcttccg atcttctagg tcatattctg gtctatattt ggaagc 56
<210> 142
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon13-R
<400> 142
ttcagacgtg tgctcttccg atctcacaca cacacataca taaatttctt taattcg 57
<210> 143
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon14-R
<400> 143
ttcagacgtg tgctcttccg atctaaggtg cgccctgtaa tgt 43
<210> 144
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon15-R
<400> 144
ttcagacgtg tgctcttccg atctagggca gtcatttgtt ggttca 46
<210> 145
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon16_1-R
<400> 145
ttcagacgtg tgctcttccg atcttgtttg agaaagagat gcctggaa 48
<210> 146
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon16_2-R
<400> 146
ttcagacgtg tgctcttccg atctaagcag agcatcatgg gatagc 46
<210> 147
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon17-R
<400> 147
ttcagacgtg tgctcttccg atcttgatgc tgtgttcctc agagatttc 49
<210> 148
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon18-R
<400> 148
ttcagacgtg tgctcttccg atcttgtctc tagtcagcca atccct 46
<210> 149
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon19-R
<400> 149
ttcagacgtg tgctcttccg atctcacatg tagggaagct ctgtctttt 49
<210> 150
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon20-R
<400> 150
ttcagacgtg tgctcttccg atctgactcc tcactacgta ttgtttgaat ga 52
<210> 151
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon21-R
<400> 151
ttcagacgtg tgctcttccg atctgctcta accggagagg actg 44
<210> 152
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon22-R
<400> 152
ttcagacgtg tgctcttccg atctcacaca gcaagtctac catcttaagt 50
<210> 153
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon23-R
<400> 153
ttcagacgtg tgctcttccg atctatcctt cagacaaggt cctcct 46
<210> 154
<211> 55
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon24-R
<400> 154
ttcagacgtg tgctcttccg atctggtgga ttaattagtg tctgtgtttt ctgta 55
<210> 155
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon25-R
<400> 155
ttcagacgtg tgctcttccg atcttagctg tctgattatc tgaaacacaa tgt 53
<210> 156
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon26-R
<400> 156
ttcagacgtg tgctcttccg atctagcttg ggagcacttc acatatac 48
<210> 157
<211> 55
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon27_1-R
<400> 157
ttcagacgtg tgctcttccg atctagaggt ctctcaaatg aagtaatatc actga 55
<210> 158
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon27_2-R
<400> 158
ttcagacgtg tgctcttccg atcttgtcag acagatttgc tacctgttg 49
<210> 159
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon28-R
<400> 159
ttcagacgtg tgctcttccg atcttgtctg cctgtatggt tggtg 45
<210> 160
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon29-R
<400> 160
ttcagacgtg tgctcttccg atctagttct cttcccttaa gtcagtcct 49
<210> 161
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon30-R
<400> 161
ttcagacgtg tgctcttccg atctccacat gtcagaggct attggatt 48
<210> 162
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon31-R
<400> 162
ttcagacgtg tgctcttccg atctacagtt tgctcttctc ctcaaaatac a 51
<210> 163
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_1-R
<400> 163
ttcagacgtg tgctcttccg atctcctgac ggtgaacatc ggt 43
<210> 164
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_2-R
<400> 164
ttcagacgtg tgctcttccg atctggagct gcaaacattg acatttttat agg 53
<210> 165
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_3-R
<400> 165
ttcagacgtg tgctcttccg atctggtcct tttacttgtg tgattttgag ttt 53
<210> 166
<211> 43
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_4-R
<400> 166
ttcagacgtg tgctcttccg atctccagga ccccactacc tgt 43
<210> 167
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_5-R
<400> 167
ttcagacgtg tgctcttccg atctcatgga tgccttgtcc acaaac 46
<210> 168
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_6-R
<400> 168
ttcagacgtg tgctcttccg atcttgtatg aagcggcagc aaca 44
<210> 169
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_7-R
<400> 169
ttcagacgtg tgctcttccg atctagtacg tcagaagcag atggga 46
<210> 170
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_8-R
<400> 170
ttcagacgtg tgctcttccg atcttttcac taacacatgc cctaccttc 49
<210> 171
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon32_9-R
<400> 171
ttcagacgtg tgctcttccg atctggtact tgtgggcaat cggt 44
<210> 172
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon33_1-R
<400> 172
ttcagacgtg tgctcttccg atctggaatg tctcagctgc tgtgt 45
<210> 173
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon33_2-R
<400> 173
ttcagacgtg tgctcttccg atctgcggat tctgaggatg tgaaaaga 48
<210> 174
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon34_1-R
<400> 174
ttcagacgtg tgctcttccg atctgttctc tctgtggttc tttcctaatg g 51
<210> 175
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon34_2-R
<400> 175
ttcagacgtg tgctcttccg atctcctcta catttgcgag gaaagttc 48
<210> 176
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon35_1-R
<400> 176
ttcagacgtg tgctcttccg atctaagcta atggcttgca atgattaata agagta 56
<210> 177
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon35_2-R
<400> 177
ttcagacgtg tgctcttccg atctgagtgt gagacgccca atca 44
<210> 178
<211> 46
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon36_1-R
<400> 178
ttcagacgtg tgctcttccg atctgacaac gtcacagtgg agaatg 46
<210> 179
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon36_2-R
<400> 179
ttcagacgtg tgctcttccg atctccgccc aaaaacaatg aatgaac 47
<210> 180
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon37_1-R
<400> 180
ttcagacgtg tgctcttccg atctcaggga ctgacaattt tccctttg 48
<210> 181
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon37_2-R
<400> 181
ttcagacgtg tgctcttccg atctcctggc tgtgaggaat ggaa 44
<210> 182
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon38_1-R
<400> 182
ttcagacgtg tgctcttccg atctaagttg tcatcatcag tggaacagg 49
<210> 183
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon38_2-R
<400> 183
ttcagacgtg tgctcttccg atcttgggat tctttggcta aataacatca ca 52
<210> 184
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon39-R
<400> 184
ttcagacgtg tgctcttccg atctgtgatg tcctcagttc tatcatcctc t 51
<210> 185
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon40-R
<400> 185
ttcagacgtg tgctcttccg atctacatgc tttaggttct ctggacttta ttt 53
<210> 186
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon41-R
<400> 186
ttcagacgtg tgctcttccg atctcaacag aatctcagga gccatatcta attt 54
<210> 187
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon42-R
<400> 187
ttcagacgtg tgctcttccg atctcacacc caaagaagta gtgttgc 47
<210> 188
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon43-R
<400> 188
ttcagacgtg tgctcttccg atctgaatca agggtgttga gttgagtaca 50
<210> 189
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon44-R
<400> 189
ttcagacgtg tgctcttccg atctaacaag agtctttctt tccagcaac 49
<210> 190
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon45_1-R
<400> 190
ttcagacgtg tgctcttccg atctccatct accttcattc tccctaatac attact 56
<210> 191
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon45_2-R
<400> 191
ttcagacgtg tgctcttccg atctctgttc cagagcttca cagtttg 47
<210> 192
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon46-R
<400> 192
ttcagacgtg tgctcttccg atctagctac aggaagtccg caag 44
<210> 193
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon47-R
<400> 193
ttcagacgtg tgctcttccg atcttgtgtc cagttttctt attttgcttt catc 54
<210> 194
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon48_1-R
<400> 194
ttcagacgtg tgctcttccg atcttcttgc ttctatggaa accctttcag 50
<210> 195
<211> 55
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon48_2-R
<400> 195
ttcagacgtg tgctcttccg atctgccatt gtgtaataat ctttctgttt tccaa 55
<210> 196
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon49_1-R
<400> 196
ttcagacgtg tgctcttccg atctaattga tgaaagagga atgtattgga ttcaga 56
<210> 197
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon49_2-R
<400> 197
ttcagacgtg tgctcttccg atctctaacc ctcgtggctg gatg 44
<210> 198
<211> 42
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon50_1-R
<400> 198
ttcagacgtg tgctcttccg atctgggagt cgagtgggtc tg 42
<210> 199
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon50_2-R
<400> 199
ttcagacgtg tgctcttccg atctgttgtt ttggcagggt ggtg 44
<210> 200
<211> 58
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon51-R
<400> 200
ttcagacgtg tgctcttccg atctctgttt tgaaaattta ggcaactaga atttagca 58
<210> 201
<211> 49
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon52-R
<400> 201
ttcagacgtg tgctcttccg atctggaggt gaaaatacca ctagcatcc 49
<210> 202
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon53-R
<400> 202
ttcagacgtg tgctcttccg atctaacacg taattcttgt ttttgtgaca tatctg 56
<210> 203
<211> 56
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon54-R
<400> 203
ttcagacgtg tgctcttccg atctgcaatt tctccctctc tttcttttaa tttcaa 56
<210> 204
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon55-R
<400> 204
ttcagacgtg tgctcttccg atcttggaat gacttttact tacctggctt t 51
<210> 205
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon56-R
<400> 205
ttcagacgtg tgctcttccg atcttagatg atttgtgctg cactgttagt 50
<210> 206
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon57-R
<400> 206
ttcagacgtg tgctcttccg atctccagct agtgattttt gaaacaggtt tt 52
<210> 207
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_1-R
<400> 207
ttcagacgtg tgctcttccg atcttggaga tagagaacat tactctggta gac 53
<210> 208
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_2-R
<400> 208
ttcagacgtg tgctcttccg atctatccaa gaggaggtcg aattggta 48
<210> 209
<211> 44
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_3-R
<400> 209
ttcagacgtg tgctcttccg atcttttcac atccgaggcc acaa 44
<210> 210
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_4-R
<400> 210
ttcagacgtg tgctcttccg atctggaaag tacctgatga catgcatttg 50
<210> 211
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon58_5-R
<400> 211
ttcagacgtg tgctcttccg atctgagtac ttttaaatga caatattgtg tttggca 57
<210> 212
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon59_6-R
<400> 212
ttcagacgtg tgctcttccg atctagagaa cagtggaatt atgcaccc 48
<210> 213
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon59_7-R
<400> 213
ttcagacgtg tgctcttccg atctatcctg gatagcttta actaacttag ggt 53
<210> 214
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon60-R
<400> 214
ttcagacgtg tgctcttccg atctttcttc ttgctgctta tcatgaaatg aaag 54
<210> 215
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_1-R
<400> 215
ttcagacgtg tgctcttccg atctaaatca ggtttattca cgagatgcct 50
<210> 216
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_2-R
<400> 216
ttcagacgtg tgctcttccg atctcccaat gactgtggaa actatctcaa 50
<210> 217
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_3-R
<400> 217
ttcagacgtg tgctcttccg atctctgacc aagtggtcct aattcttgat ag 52
<210> 218
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_4-R
<400> 218
ttcagacgtg tgctcttccg atctccatca ggcaaatcac caaagtc 47
<210> 219
<211> 53
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_5-R
<400> 219
ttcagacgtg tgctcttccg atctatctat tggtgccaac tatttcaaca tca 53
<210> 220
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_6-R
<400> 220
ttcagacgtg tgctcttccg atctagttat agatgatggc aagagtgatg g 51
<210> 221
<211> 51
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon61_7-R
<400> 221
ttcagacgtg tgctcttccg atctgggtat tttcatttgg atgcaatgtg g 51
<210> 222
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon62-R
<400> 222
ttcagacgtg tgctcttccg atcttggaaa attgctacca tagggatatg tg 52
<210> 223
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon63-R
<400> 223
ttcagacgtg tgctcttccg atcttccatc ttttctaact tcacaaaatt ctcttct 57
<210> 224
<211> 50
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon64-R
<400> 224
ttcagacgtg tgctcttccg atctccttta ttgtccaaat gtctgccttc 50
<210> 225
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon65_1-R
<400> 225
ttcagacgtg tgctcttccg atctccattt gctgtcttgc ctgtg 45
<210> 226
<211> 57
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon65_2-R
<400> 226
ttcagacgtg tgctcttccg atcttgttat tgttggaatc ttgtgattct ctagaaa 57
<210> 227
<211> 47
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon66-R
<400> 227
ttcagacgtg tgctcttccg atctcctaaa tgctgatggt cccactt 47
<210> 228
<211> 48
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_1-R
<400> 228
ttcagacgtg tgctcttccg atcttatgcc cagacttcag acaagaga 48
<210> 229
<211> 45
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_2-R
<400> 229
ttcagacgtg tgctcttccg atctaggaaa gttagccgcc acatt 45
<210> 230
<211> 54
<212> DNA
<213>Artificial sequence
<220>
<223> PKHD1_exon67_3-R
<400> 230
ttcagacgtg tgctcttccg atctttgtca gaaatgctaa gtatgcaaaa tgtg 54

Claims (8)

1. a kind of method of the sequencing library of structure PKHD1 gene mutations, comprises the following steps：
The first round expands：Using include by with ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:One of 22) full sequence or its 3` end is opened The positive spy of the sequence identical sequence that more than 13 continuous deoxyribonucleotides constitute of beginning and PKHD1 genes each extrons Specific amplification primers sequence be connected in series composition the first round forward direction amplimer and by with ACACTCTTTCCCTACACGACGCTCTTCCGATCT(SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:The other of 22) full sequence or its 3` end Start more than 13 continuous deoxyribonucleotides compositions sequence identical sequence and PKHD1 genes each extrons it is reverse Specificity amplification primer sequence is connected in series the combination of the first round amplimer of the first round reverse amplimer of composition to each One or more extrons of the PKHD1 genes of sample are expanded；
Digestion primer：With remaining primer and primer dimer in single-stranded digestion enzymic digestion first round amplified production；
Second wheel amplification：Product with first round amplification as template, using by with draw selected from D5 adapter-primer sequences and N7 joints In thing sequence one identical second take turns positive amplimer and with selected from D5 adapter-primer sequences and N7 adapter-primer sequences Middle another one identical second is taken turns the combination of the second wheel amplimer of reverse amplimer composition and is expanded, wherein, it is described D5 adapter-primer sequences are selected from SEQ ID NO:1～SEQ ID NO:In 8, the N7 adapter-primer sequences are selected from SEQ ID NO: 9～SEQ ID NO:In 20, wherein, the combination of the second wheel amplimer is included selected from D501～D508 (SEQ ID NO:1～SEQ ID NO:One of and N701～N712 (SEQ ID NO 8):9～SEQ ID NO:One of 20) label of composition Primer sequence it is one or more pairs of so that each sample can be distinguished；
Purifying reclaims all DNA bands；
Sequencing：After the product of recovery is carried out quantitatively, carry out after the product of different labels is required mixing according to sequencing data amount Machine is sequenced；
Analysis：Based on the sequence label of each sample, the sequencing result for obtaining and sample are corresponded, and according to each base The primer sequence of cause, sequence is corresponded on each gene of sample.
2. the method for claim 1, wherein the first round amplification in, using include by with CCTACACGACGCTCTTCCGATCT(SEQ ID NO:23) the positive specificity amplification primer of identical sequence and each gene Sequence be connected in series composition the first round forward direction amplimer and by with TTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:24) first round that the reverse specificity amplification primer sequence of identical sequence and each gene is connected in series composition reversely expand The combination for increasing the first round amplimer of primer is expanded to one or more specific genes of each sample.
3. the method for claim 1, wherein the combination of the first round amplimer is included selected from SEQ ID NO:25 ～SEQ ID NO:One or more pairs of in 230, the combination of the preferably first round amplimer includes SEQ ID NO:25～ SEQ ID NO:230, the combination of more preferably described first round amplimer is by SEQ ID NO:25～SEQ ID NO:230 groups Into.
4. the kit of the sequencing library of a kind of structure PKHD1 gene mutations, the kit include：
The combination of first round amplimer：Including by with ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 21) with GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:One of 22) full sequence or its 3` End starts the forward direction specificity of the sequence identical sequence and each gene of more than 13 continuous deoxyribonucleotides compositions and expands Increase primer sequence be connected in series composition the first round forward direction amplimer and by with ACACTCTTTCCCTACACGACGCTCTTCCGATCT(SEQ ID NO:21) and GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:The other of 22) full sequence or its 3` end Start the reverse specific amplification of the sequence identical sequence and each gene of more than 13 continuous deoxyribonucleotides compositions Primer sequence is connected in series the combination of the first round amplimer of the first round reverse amplimer of composition one to each sample Or multiple specific genes are expanded；
The combination of the second wheel amplimer：Including with selected from one phase in the D5 adapter-primer sequences and N7 adapter-primer sequences With the positive amplimer of the second wheel and with selected from another one identical in D5 adapter-primer sequences and N7 adapter-primer sequences The reverse amplimer of second wheel, wherein, the D5 adapter-primer sequences are selected from SEQ ID NO:1～SEQID NO:It is in 8, described N7 adapter-primer sequences are selected from SEQ ID NO:9～SEQ ID NO:In 20, wherein, the combination bag of the second wheel amplimer Include selected from D501～D508 (SEQ ID NO:1～SEQ ID NO:One of and N701～N712 (SEQ ID NO 8):9～ SEQ ID NO:One of 20) the Tag primer sequence of composition is one or more pairs of, so that each sample can be distinguished.
5. kit as claimed in claim 1, wherein, the combination of the first round amplimer include by with CCTACACGACGCTCTTCCGATCT(SEQ ID NO:23) the positive specificity amplification primer of identical sequence and each gene Sequence be connected in series composition the first round forward direction amplimer and by with TTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO:24) first round that the reverse specificity amplification primer sequence of identical sequence and each gene is connected in series composition reversely expand Increase primer.
6. kit as claimed in claim 1, wherein, the combination of the first round amplimer is included selected from SEQ ID NO: 25～SEQ ID NO:One or more pairs of in 230, the combination of the preferably first round amplimer includes SEQ ID NO:25 ～SEQ ID NO:230, the combination of more preferably described first round amplimer is by SEQ ID NO:25～SEQ ID NO:230 groups Into.
7. kit as claimed in claim 1, wherein, the kit further includes archaeal dna polymerase, preferred high-fidelity Archaeal dna polymerase.
8. kit as claimed in claim 1, wherein, the kit further includes single-stranded digestive ferment, preferably single-stranded to disappear Change enzyme is exonuclease I.
CN201610932549.3A 2016-10-25 2016-10-25 Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof Active CN106554955B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610932549.3A CN106554955B (en) 2016-10-25 2016-10-25 Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610932549.3A CN106554955B (en) 2016-10-25 2016-10-25 Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

Publications (2)

Publication Number Publication Date
CN106554955A true CN106554955A (en) 2017-04-05
CN106554955B CN106554955B (en) 2020-07-14

Family

ID=58443413

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610932549.3A Active CN106554955B (en) 2016-10-25 2016-10-25 Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof

Country Status (1)

Country Link
CN (1) CN106554955B (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108486230A (en) * 2018-05-18 2018-09-04 中国人民解放军陆军军医大学第附属医院 Kit and preparation method thereof for Non-invasive detection MITF gene mutations
CN108531583A (en) * 2018-05-18 2018-09-14 中国人民解放军陆军军医大学第附属医院 Primer combination for Non-invasive detection MITF gene mutations and detection method
CN108753934A (en) * 2018-05-18 2018-11-06 中国人民解放军陆军军医大学第附属医院 A kind of detection method of gene mutation, kit and preparation method thereof
CN108949951A (en) * 2018-05-18 2018-12-07 中国人民解放军陆军军医大学第附属医院 A kind of while Non-invasive detection GJB2 and SLC26A4 gene mutation method and kit
CN109022559A (en) * 2018-08-21 2018-12-18 华中农业大学 A kind of molecular mark detection method based on two generation sequencing technologies
CN109554440A (en) * 2018-12-26 2019-04-02 山东艾克韦生物技术有限公司 Multi-primers group and the method that human T cells immune group library is constructed based on high-flux sequence using the primer sets
CN111139315A (en) * 2020-04-03 2020-05-12 杭州启棣生物技术有限公司 Method for high-throughput detection of respiratory viruses by using second-generation sequencing and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103060924A (en) * 2011-10-18 2013-04-24 深圳华大基因科技有限公司 Library preparation method of trace nucleic acid sample and application thereof
CN105524983A (en) * 2014-09-30 2016-04-27 大连晶泰生物技术有限公司 Marker based on high-throughput sequencing and method and kit for capturing one or multiple specific genes of multiple samples
CN105986015A (en) * 2015-02-05 2016-10-05 大连晶泰生物技术有限公司 Method and kit for detecting one or more target sequence of multiple samples based on high-throughput sequencing

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103060924A (en) * 2011-10-18 2013-04-24 深圳华大基因科技有限公司 Library preparation method of trace nucleic acid sample and application thereof
CN105524983A (en) * 2014-09-30 2016-04-27 大连晶泰生物技术有限公司 Marker based on high-throughput sequencing and method and kit for capturing one or multiple specific genes of multiple samples
CN105986015A (en) * 2015-02-05 2016-10-05 大连晶泰生物技术有限公司 Method and kit for detecting one or more target sequence of multiple samples based on high-throughput sequencing

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108486230A (en) * 2018-05-18 2018-09-04 中国人民解放军陆军军医大学第附属医院 Kit and preparation method thereof for Non-invasive detection MITF gene mutations
CN108531583A (en) * 2018-05-18 2018-09-14 中国人民解放军陆军军医大学第附属医院 Primer combination for Non-invasive detection MITF gene mutations and detection method
CN108753934A (en) * 2018-05-18 2018-11-06 中国人民解放军陆军军医大学第附属医院 A kind of detection method of gene mutation, kit and preparation method thereof
CN108949951A (en) * 2018-05-18 2018-12-07 中国人民解放军陆军军医大学第附属医院 A kind of while Non-invasive detection GJB2 and SLC26A4 gene mutation method and kit
CN108949951B (en) * 2018-05-18 2022-01-28 中国人民解放军陆军军医大学第一附属医院 Method and kit for simultaneously and noninvasively detecting GJB2 and SLC26A4 gene mutations
CN108486230B (en) * 2018-05-18 2022-02-08 中国人民解放军陆军军医大学第一附属医院 Kit for noninvasive detection of MITF gene mutation and preparation method thereof
CN108531583B (en) * 2018-05-18 2022-05-17 中国人民解放军陆军军医大学第一附属医院 Primer combination for noninvasive detection of MITF gene mutation and detection method
CN109022559A (en) * 2018-08-21 2018-12-18 华中农业大学 A kind of molecular mark detection method based on two generation sequencing technologies
CN109554440A (en) * 2018-12-26 2019-04-02 山东艾克韦生物技术有限公司 Multi-primers group and the method that human T cells immune group library is constructed based on high-flux sequence using the primer sets
CN111139315A (en) * 2020-04-03 2020-05-12 杭州启棣生物技术有限公司 Method for high-throughput detection of respiratory viruses by using second-generation sequencing and application

Also Published As

Publication number Publication date
CN106554955B (en) 2020-07-14

Similar Documents

Publication Publication Date Title
CN106554955A (en) Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof
CN108893466B (en) Sequencing joint, sequencing joint group and detection method of ultralow frequency mutation
AU2017381296B2 (en) Reagents and methods for the analysis of linked nucleic acids
JP6968894B2 (en) Multiple detection method for methylated DNA
CN105861700B (en) A kind of high-flux detection method for neuromuscular disease
CN106555226A (en) A kind of method and test kit for building high-throughput sequencing library
WO2019144582A1 (en) Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types
CN110760936B (en) Method for constructing DNA methylation library and application thereof
CN106957350B (en) The labeling method of 5- aldehyde radical cytimidine and its application in the sequencing of single base resolution ratio
CN106319065A (en) Kit and capture probe for human BRCA1/2 gene detection on basis of high-throughput sequencing
CN108998505A (en) A kind of gene polymorphism sites detection technique and its kit
WO2019076018A1 (en) Method for constructing amplicon library for detecting low-frequency mutation of target gene
WO2021180105A1 (en) Probe composition for detecting common cancers of both sexes
CN110004225B (en) Tumor chemotherapeutic drug individualized gene detection kit, primers and method
WO2021185274A1 (en) Probe composition for detecting 6 cancers with high incidence in china
WO2019085546A1 (en) Method for constructing microbial 16s rdna single-molecule level sequencing library
CN111424119B (en) High-flux detection primer and kit for SARS-CoV-2 virus
CN116144736A (en) Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application
CN109295500B (en) Single cell methylation sequencing technology and application thereof
CN111073964A (en) Kit for detecting human leukocyte antigen HLA-ABCCDRDQ genotyping
WO2020135347A1 (en) Method for detecting dna methylation, test kit, device and application
CN109266723A (en) Rare mutation detection method, its kit and application
WO2018229774A1 (en) Compositions and methods for detection of genomic variations
CN114774514B (en) Library construction method and kit suitable for high-throughput targeted genome methylation detection
CN109609694B (en) Kit and method for detecting hepatitis B typing and multiple drug-resistant sites based on Illumina sequencing technology

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant