CN108531583A - Primer combination for Non-invasive detection MITF gene mutations and detection method - Google Patents
Primer combination for Non-invasive detection MITF gene mutations and detection method Download PDFInfo
- Publication number
- CN108531583A CN108531583A CN201810480505.0A CN201810480505A CN108531583A CN 108531583 A CN108531583 A CN 108531583A CN 201810480505 A CN201810480505 A CN 201810480505A CN 108531583 A CN108531583 A CN 108531583A
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna
- mitf
- primer
- artificial sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention relates to genetic test fields, and in particular to the primer combination for Non-invasive detection MITF gene mutations and detection method.The primer combination includes nucleotide sequence 20 pairs of primers as shown in Seq ID No.1 40, is used for the different zones of specific amplification MITF genes, to detect the variation of MITF genes simultaneously.Wherein it is used to expand a region in MITF genes per pair of primers, the UMI molecular labels sequence for including between primer pair is different, for ensureing that the UMI molecular label sequences in the DNA cloning segment of the same area are identical, the UMI molecular label sequences in the DNA cloning segment of different zones are different from each other.The detection method of the present invention expands the different zones of MITF genes in sample using 20 pairs of primer specificities, noise reduction is carried out to two generation sequencing datas of amplified production using UMI, to accurately detect that low copy number makes a variation.
Description
Technical field
The present invention relates to genetic test fields, and in particular to primer combination and inspection for Non-invasive detection MITF gene mutations
Survey method.
Background technology
The detection of gene mutation all has important value for many kinds of lesion detections, fetus genetic state-detection.Mesh
The preceding gene mutation for screening for fetus is based primarily upon multiple plateform systems such as SNP array, and full base is carried out to fetus and parent
It is expensive because of a group snp analysis；And routine relies on being sequenced in synthesis for polymerase and is difficult to ensure base accuracy, generation
Base mistake causes sequencing noise, therefore conventional libraries capture and high-flux sequence cannot solve the change as caused by amplification and sequencing
Different detection error；And newer cycle monomolecular amplification and weight sequencing technologies (cSMART) are by its cyclisation library efficiency and back-to-back
The influence of the design of primer sites.
The discovery of the dissociative DNA of fetal origin in maternal blood, being provided for Non-invaive examination fetus genetic state can
Energy.Maternal blood cfDNA is derived from mother and fetus, and fetus dissociative DNA (cffDNA) derives from placental trophoblasts, accounts for about
The 10-20% of total cfDNA, fragment length are 140-180bp or so.CffDNA is identified still from the DNA in mother source
It is so current technology difficult point, the allele ratio in particular how detected in female blood blood plasma caused by cffDNA is uneven.
Allele-specific diagnostic PCR, MALDI-TOF mass spectrographies, digital pcr and high throughput are mainly passed through to the research of cffDNA in the world at present
The methods of sequencing carries out.
The noninvasive antenatal detection method of mainstream is based on the detection of fetus variant sites and haplotype detection at present：By to mother
CfDNA carries out site primer in blood blood plasma, and relative variability dosage (RMD) and relative monomer type dosage (RHDO) is then utilized to analyze
The relative amount of fetal DNA in maternal plasma variant sites and haplotype.By the way that there is only the SNP in father to have derived father source part
Fetal genome, then SNP homozygous using father but mother's heterozygosis is derived for the Fetal genome part in mother source.
Papasavva etc. analyzes female blood cfDNA using this method, successfully divides its cffDNA genotype and variant sites
Analysis.Therefore using the detection to variant sites in cffDNA and haplotype, the diagnosis that can effectively improve fetus Disease-causing gene is accurate
Exactness.
MITF (Microphthalmia-associtated transcription factor) gene (NCBI：MRNA sequences
Row number is NM_00248) overall length 4490bp, wherein ORF coded sequences are 1260bp, share 9 exons.It encodes albumen
Microphthalmia associated transcription factor plays an important role in the development, differentiation and function point analysis of melanocyte, while also joining
With the development and differentiation of mast cell, osteoclast and pigment epithelium of eye cell.MITF gene mutations can clinically cause
Syndromic is deaf, is mainly shown as sensorineural deafness and pigment anomaly, the latter include heterochromia iridis, white forelock, hair color,
Hypopigmentation of skin or freckle are calm；Other performances also have in the middle part of endocanthion dystopy, the high wide nasion, hirsutism, synophrys or eyebrow
Flush etc..Using genetic test early detection, early intervention, to reach it is anti-it is residual subtract residual, to improve the health of the people purpose, to subtracting
The burden of light patient home and society is significant.
Therefore, it is necessary to for a kind of more convenient and reliable suitable Non-invasive detection low-copy base of MITF Data minings
Because of the technology of mutation.
Invention content
According to demand existing for above-mentioned field, inventor has developed a kind of method of Non-invasive detection MITF gene mutations,
On the basis of conventional multiplex amplification, UMI (Unique Molecular Identifier) molecule mark is introduced into amplimer
Label carry out noise reduction using UMI pairs of two generation sequencing datas, to accurately detection low copy number variation.
The claimed technical solution of the present invention is as follows：
Primer for Non-invasive detection MITF gene mutations combines, it is characterised in that：Including nucleotide sequence such as Seq
20 pairs of primers shown in IDNo.1-40 are used for the different zones of specific amplification MITF genes, to detect MITF genes simultaneously
Variation and its close on SNP site.
Preferably, the primer combination further includes nucleotide sequence 2 pairs of primers as shown in Seq ID No.41-44.
A kind of method of Non-invasive detection MITF gene mutations, it is characterised in that：Include the following steps：
(1) using subject's plasma dna as template；
(2) PCR is carried out to expand in advance；
(3) Index PCR amplifications are carried out to pre- amplified production；
(4) it after carrying out library Quality Control to Index pcr amplification products, is carried out on Illumina NextSeq sequenators
150bp both-ends are sequenced；
(5) sequence information of sequencing is removed into jointing, a primary template sequence is spliced into, by primary template sequence
It compares with the canonical sequence of MITF genes, and by comparing the UMI molecular label sequences of primary template sequence, counts unique
Template sequence；Using unique template sequence, genome covering is calculated, for assessing library specificities, sequence is mutated by calculating
The ration statistics of row and canonical sequence go out body cell MITF gene mutation rates；
In the pre- amplification, using nucleotide sequence 20 pairs of primers as shown in Seq ID No.1-40 mixture simultaneously
The different zones of specific amplification MITF genes, to detect the variation of MITF genes and its close on SNP site；
Per a region in a pair of primer amplification MITF genes；The UMI molecular labels sequence for including between primer pair is not
Together, it is used to ensure that the UMI molecular label sequences in the DNA cloning segment of the same area are identical, and from not same district
UMI molecular label sequences in the DNA cloning segment in domain are differing from each other；
In the Index PCR amplifications, using nucleotide sequence forward and reverse primer as shown in Seq ID No.45 and 46.
Preferably, in the pre- amplification, 22 primer is mixed as shown in Seq ID No.1-44 using nucleotide sequence
Object is closed to be expanded.
Preferably, it before carrying out the Index PCR amplifications, expands gained DNA in advance to PCR and carries out magnetic beads for purifying.
Preferably, after carrying out the Index PCR amplifications, it is pure that magnetic bead is carried out to DNA obtained by Index PCR amplifications
Change.
Primer for detecting MITF gene mutations combines, it is characterised in that：Including nucleotide sequence such as Seq ID
20 pairs of primers shown in No.47-86 are used for the different zones of specific amplification MITF genes, to detect the change of MITF genes
It is different and its close on SNP site.
Preferably, the primer combination further includes nucleotide sequence 2 pairs of primers as shown in Seq ID No.87-90.
In clinical research, there is an urgent need to a kind of methods fast and efficiently detecting MITF gene mutations and genotype.Invention
People is when studying the detection of piece segment DNA, it was found that a kind of detection method of new DNA fragmentation, i.e.,：It is added in amplimer
Then UMI (Unique Molecular Identifier) molecular label sequence carries out PCR amplification and by the to DNA fragmentation
Two generation high throughput sequencing technologies are sequenced, and noise reduction is carried out using UMI molecular labels sequence pair two generations sequencing data, low to detect
Copy number variation.
The present invention designs according to MITF gene orders and filters out nucleotide sequence 20 as shown in Seq ID No.47-86
To specific primer, the different zones for expanding MITF genes have the advantages of high specificity, high sensitivity.
Further, to meet the needs of high-throughput detection, UMI is added at 5 ' ends of designed specific primer sequence
Molecular label sequence and joint sequence obtain nucleotide sequence 20 pairs of pre- amplimers as shown in Seq ID No.1-40.Institute
It states in pre- amplimer, all forward primers are followed successively by from 5 ' ends to 3 ' ends containing joint sequence A, UMI molecular label sequence
With the specific primer sequence of MITF gene different zones；All reverse primers are followed successively by from 5 ' ends to 3 ' ends containing connector sequence
Arrange the specific primer sequence of B, UMI molecular label sequence and MITF gene different zones；Joint sequence A in all primer pairs
Mutually the same, joint sequence B is mutually the same, and joint sequence A and joint sequence B are differing from each other；Primer in same primer pair
With identical UMI molecular labels sequence, the primer of different primers pair carries different UMI molecular label sequences.The UMI points
Subtab sequence is the nucleotide sequence of Random Design.3 ' terminal sequences of forward and reverse primer for Index PCR amplifications are distinguished
For the 5 ' terminal sequences of joint sequence A and joint sequence B.
In addition, the present invention also provides 2 pairs of primers shown in Seq ID No.87-90.Wherein, the institutes of Seq ID No.87 and 88
C.627C the forward and reverse primer (MITF mutation-F/R) shown is for detecting MITF genes>The variation in the sites A, clinical research
It was found that the variation in this site may lead to deafness, therefore, the detection for the site contributes to analysis fetus to suffer from deafness
Probability.Forward and reverse primer (Amelo-F/R) shown in Seq ID No.89 and 90 is used to detect the sex chromosome of fetus, by grinding
Study carefully fetus dissociative DNA dissociative DNA ratio in female blood, the ratio of auxiliary judgment fetus dissociative DNA.Similarly, to meet high pass
The needs for measuring detection add UMI molecular labels sequence and joint sequence at 5 ' ends of primer, have obtained Seq ID No.41-44
Shown in 2 pairs of pre- amplimers.
The method of Non-invasive detection MITF gene mutations provided by the invention, 20 pairs of pre- amplimers designed by the invention
The different zones for expanding MITF genes, can accurately detect the MITF genotype of DNA sample to be measured, both can be used for MITF bases
Because of the basic research of relevant disease, clinical disease diagnosis can be used for.Identical UMI molecules will be carried by analysis of biological information
The amplified fragments of sequence label merge, and significantly reduce and are drawn by archaeal dna polymerase amplification procedure and two generation sequencing procedures
The mistake entered realizes the accurate detection to make a variation to low copy number in sample.The verification result of embodiment 2 shows side of the invention
Method can sensitive, accurately detect the MITF gene mutation sites in sample.
In some embodiments, using the present invention method detect MITF genotype, then with the base of parent and propositus
Because type is compared, to judge the genotype of pathogenic mutation.In some embodiments, using maternal blood cfDNA as template,
The genetic state of fetus is detected using the method for the present invention.
Description of the drawings
The testing principle schematic diagram of Fig. 1 present invention：
It carries out PCR to plasma dna first to expand in advance, it is therefore an objective to locus products needed for amplification；
Then pre- amplified production DNA is purified, it is therefore an objective to the enzyme in removal system and ion；
Index PCR amplifications are carried out for pre- amplified production, are fabricated to the library that can be used for high-flux sequence；
Bioinformatic analysis finally is carried out to library, obtains gene mutation data.
Fig. 2 bioinformatic analysis process examples：
By the sequence assembling with identical molecular label at unique template sequence.
The testing result of rs9862357 is directed in Fig. 3 one embodiment of the present of invention.
Specific implementation mode
With reference to embodiment, the present invention is described in further detail, it is to be understood that following embodiments are only made
For explanation and illustration, it is not in any way limit the scope of the present invention.
Experimental method used in following embodiments is this field conventional method unless otherwise specified, be can refer to point
Sub- Cloning: A Laboratory Manual (Sambrook J＆Russell DW, Molecular cloning:A laboratory manual,
2001) or manufacturer provide specification.
The materials, reagents and the like used in the following examples can be prepared unless otherwise specified by this field conventional method
It obtains or is commercially available from commercial channels.
Embodiment 1. is used to detect the design of primers of the mutational sites MITF and genotype
1, specific primer design
From dbSNP databases (http://www.ncbi.nlm.nih.gov/SNP/) in screening MITF genes and its up and down
Trip closes on SNP site (minimum gene frequency MAF>10%).MRNA sequence based on people's MITF genes is (in ncbi database
Serial No. NM_00248), for each SNP site design primer, screen 20 pairs of specific primers, nucleotide sequence
As shown in Seq ID No.47-86.
Table 1. is used to expand the specific primer of MITF gene SNP sites
The present invention also provides for detecting MITF genes c.627C>The specific primer MITF of A Mutations
Mutation-F/R, nucleotide sequence is as shown in Seq ID No.87-88.
| Number | Mutational site | Primer | Primer sequence 5 ' -3 ' |
| 87 | c.627C>A | MITF mutation-F | AAGAGCACTGGCCAAAGAGA |
| 88 | c.627C>A | MITF mutation-R | AAACATTTTTGATATATGGGGAACA |
The present invention also provides the specific primer Amelo-F/R for judging sex of foetus, nucleotide sequence such as SeqID
No.89-90。
| Number | Primer | Primer sequence 5 ' -3 ' |
| 89 | Amelo-F | TCAACTTCAGCTATGAGGTAATTTTTC |
| 90 | Amelo-R | CCAACCATCAGAGCTTAAACTGG |
It is if amplifying the sequence come：
TCAACTTCAGCTATGAGGTAATTTTTCtctttactaattttgatcactgtttgcattagcagtcccctgggctctgt
aaagaatagtgggtggattcttcatcccaaataaagtggtttctcaagtggtcccaattttacagttcctaccatca
GcttcCCAGTTTAAGCTCTGATGGTTGG, then fetus is male；
It is if amplifying the sequence come：
TCAACTTCAGCTATGAGGTAATTTTTCtctttactaattttgaccattgtttgcgttaacaatgccctgggctctgt
aaagaatagtgtgttgattctttatcccagatgtttctcaagtggtcctgattttacagttcctaccaccagcttcC
CAGTTTAAGCTCTGATGGTTGG, then fetus is women.
2, design of primers is expanded in advance
Based on the pre- amplimer of specific primer design in step 1, nucleotide sequence such as Seq ID No.1-44 are obtained
Shown in 22 pairs of pre- amplimers.
As shown in table 2, in pre- amplimer, all forward primers are followed successively by joint sequence A, UMI from 5 ' ends to 3 ' ends
Molecular label sequence, specific primer sequence；All reverse primers are followed successively by joint sequence B, UMI molecule from 5 ' ends to 3 ' ends
Sequence label, specific primer sequence.
" NNNNNN " in every primer is a kind of A/G/C/T random sequences of synthesis, that is, UMI (unique
Molecular identifier) sequence label, it is generated at random when primer synthesizes.UMI sequence labels in each pair of primer that
This is different.5 ' terminal sequences " CCTACACGACGCTCTTCCGATCT " in forward primer are joint sequence A；Reverse primer 5 ' is held
Sequence " TCAGACGTGTGCTCTTCCGATCT " is joint sequence B.
Table 2. expands primer sets in advance
3, primer specificity is verified
DNA is extracted：Using the Upure dissociative DNA extracts kits extraction human normal plasma DNA of Biobase companies.
Target fragment expands：Using human normal plasma DNA as template, using every pair of primers listed by table 2, according to following anti-
It answers system and response procedures to carry out PCR reactions respectively, detects the specific amplification of each pair of primer.
PCR reaction systems：
| DNA | 24.8μ1 |
| Buffer 10X | 3μ1 |
| dNTP(2.5mM) | 1μ1 |
| Forward primer (10mM) | 0.5μ1 |
| Reverse primer (10mM) | 0.5μ1 |
| Taq polymerase | 0.2μ1 |
| 30μ1 |
PCR response procedures：
Agarose gel electrophoresis detects PCR product, then recycles PCR product and is sequenced, sequencing result and primer pair are answered
Target fragment be compared.The result shows that in 22 pairs of primers listed by table 2, do not occur in the amplified production of each pair of primer non-
Specific amplification band, and sequencing result is correct.
Embodiment 2. detects the known mutational sites MITF and genotype using the primer sets of the present invention
1. cell line dna：DNA sample containing heterozygosis MITF genetic mutations (is derived from into army medical university of ground force first
Affiliated hospital's DNA sample library) ultrasonication, 166 ± 10bp segments are recycled, human normal plasma DNA is mixed by preset ratio, obtains
Sample to be tested known to mutant proportion, sensitivity, specificity and stability for testing the method for the present invention.
It is calculated according to positive DNA concentration, the MITF hotspot mutation ratios expection of sample to be tested is as follows：
| Mutational site | It is expected that mutant proportion |
| c.627C>A | 5% |
| rs9862357 | 4% |
| rs1564756 | 45% |
| rs9847421 | 41% |
| rs66686363 | 17% |
| rs56336456 | 12% |
| rs1967033 | 46% |
| rs6549245 | 36% |
| rs12495615 | 50% |
| rs1491694 | 50% |
| rs7631644 | 25% |
| rs7616256 | 40% |
| rs4547664 | 0% (negative control) |
2. pre- amplimer MIX：22 pairs of primers that primer shown in Seq ID No.1-44 in table 2 is constituted mix, and obtain
To pre- amplification primer mixed liquor, it is added in 1.5ml EP pipes.
3.PCR is expanded in advance
Prepare following reaction mixture：
| DNA | 24.8μ1 |
| Buffer 10X | 3μ1 |
| dNTP(2.5mM) | 1μ1 |
| Pre- amplification primer mixed liquor (10mM) | 1μ1 |
| Taq polymerase | 0.2μ1 |
| 30μ1 |
It is reacted in PCR instrument：
Using the Agencourt AMPure XP 450mL Kit kits of Beckman Coulter companies, according to reagent
Operating method purifying recycling DNA sample described in box specification, and in the sterile dH of 25 μ 120 or elution buffer in elute,
Obtain pre- amplified production.
4.Index PCR amplifications
Index PCR primers
| Primer For | AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGC |
| Index Primer Rev | CAAGCAGAAGACGGCATACGAGATCTCTTAATTGACTGGAGTTCAGACGTGTGCT |
Wherein, 5 ' ends and the disclosure that 5 ' terminal sequences of Index Primer Rev are Illumina companies in Primer For
General sequence measuring joints；3 ' the terminal sequences " CCTACACGACGC " of Primer For, the 3 ' terminal sequences of Index Primer Rev
" TCAGACGTGTGCT " is the 5 ' terminal sequences of the joint sequence A of forward primer in table 2 and the joint sequence B of reverse primer respectively；
" CTCTTAAT " is Index sequences in reverse primer Index Primer Rev 5 ', for distinguishing different samples.
PCR is carried out according to following reaction system and response procedures：
PCR reaction systems：
PCR response procedures：
Using the Agencourt AMPure XP 450mL Kit kits of Beckman Coulter companies, according to reagent
Operating method purifying recycling DNA sample described in box specification, and eluted in the sterile dH20 or elution buffer of 25 μ 1
Obtain library.
The library made is passed through into QubitTM(according to Invitrogen companies after 4Fluorometer detectable concentration Quality Controls
Operating guidance is operated), 150bp both-ends sequencing (operating procedure foundation is carried out on Illumina NextSeq sequenators
Illumina companies operating instruction is operated).
The sequence of high-flux sequence is spliced into a sequence according to repeat region, jointing is removed, sequence is restored
Primary template sequence is returned, primary template sequence is compared with the canonical sequence of MITF genes, by comparing template sequence
Molecular label sequence counts unique template sequence.As shown in Fig. 2, by the sequence assembling Cheng Wei with identical molecular label
One template sequence.Using unique template sequence, genome covering is calculated, it is prominent by calculating for assessing library specificities
Become the ration statistics detection zone somatic mutation rate of sequence and canonical sequence.
After tradition is without the primer amplification of molecular label, sequencing can not distinguish the different sequences of its identical source.We
By introducing UMI molecular labels, the sequence with identical source UMI is merged by analysis of biological information, is greatly dropped
It is low by the introduced mistake of archaeal dna polymerase amplification procedure and two generation sequencing procedures, can be realized to low copy number by noise reduction
Variation is accurately detected.
It is as follows for MITF gene hot mutant site testing results：
Fig. 3 shows the testing result for rs9862357.It is prominent to the site using ddPCR methods for same sample
Control with changed scale is detected, as a result consistent with the method for the present invention testing result.
Finally illustrate, the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although with reference to compared with
Good embodiment describes the invention in detail, it will be understood by those of ordinary skill in the art that, it can be to the skill of the present invention
Art scheme is modified or replaced equivalently, and without departing from the objective and range of technical solution of the present invention, should all be covered at this
In the right of invention.
SEQUENCE LISTING
<110>The First Affiliated Hospital of Third Military Medical University of PLA
<120>Primer combination for Non-invasive detection MITF gene mutations and detection method
<130> P1830403CN-CN-DYF-CQ-LSH
<160> 92
<170> PatentIn version 3.3
<210> 1
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9847421-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 1
cctacacgac gctcttccga tctnnnnnng catcttagtt ccctgccata 50
<210> 2
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9847421-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 2
tcagacgtgt gctcttccga tctnnnnnna aaggagagaa aatttgggtg a 51
<210> 3
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1564756-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 3
cctacacgac gctcttccga tctnnnnnng agcacatcca actccgttt 49
<210> 4
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1564756-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 4
tcagacgtgt gctcttccga tctnnnnnng cagaacccaa cttgcaga 48
<210> 5
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9862357-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 5
cctacacgac gctcttccga tctnnnnnnc caccacactg gcctacatt 49
<210> 6
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9862357-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 6
tcagacgtgt gctcttccga tctnnnnnng caggtggaat aaacaagaag g 51
<210> 7
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs2315310-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 7
cctacacgac gctcttccga tctnnnnnnt tgatgccatg gtaaatgaaa 50
<210> 8
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs2315310-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 8
tcagacgtgt gctcttccga tctnnnnnnt cagcaagatt gcaggataca 50
<210> 9
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7610438-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 9
cctacacgac gctcttccga tctnnnnnnt ggtttcctat cttcctcctg 50
<210> 10
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7610438-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 10
tcagacgtgt gctcttccga tctnnnnnnt ccactctcac tgcctcactt 50
<210> 11
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7633580-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 11
cctacacgac gctcttccga tctnnnnnnt ttcttgggaa ataaaccttg c 51
<210> 12
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7633580-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 12
tcagacgtgt gctcttccga tctnnnnnna tgcaggtctc aggcaaaat 49
<210> 13
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs6549245-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 13
cctacacgac gctcttccga tctnnnnnnt ttcaaagcaa gacccaagc 49
<210> 14
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs6549245-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 14
tcagacgtgt gctcttccga tctnnnnnna cattttgcca ggaaacagc 49
<210> 15
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs12492592-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 15
cctacacgac gctcttccga tctnnnnnng gggaaaaaca gtacgcttc 49
<210> 16
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs12492592-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 16
tcagacgtgt gctcttccga tctnnnnnnt gagaaggtgt gttagggtgt g 51
<210> 17
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs55921103-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 17
cctacacgac gctcttccga tctnnnnnng ccttgtgtta gtgctttagc c 51
<210> 18
<211> 53
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs55921103-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 18
tcagacgtgt gctcttccga tctnnnnnnc ataggtacct tccttaactc cag 53
<210> 19
<211> 53
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs12495615-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 19
cctacacgac gctcttccga tctnnnnnnc atacatataa agcatttggc aca 53
<210> 20
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs12495615-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 20
tcagacgtgt gctcttccga tctnnnnnnc atgtactggc ctcctttgc 49
<210> 21
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1491694-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 21
cctacacgac gctcttccga tctnnnnnnt tgcaatcgtg tgatccaat 49
<210> 22
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1491694-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 22
tcagacgtgt gctcttccga tctnnnnnnc aaaaaccaat agaaagtgtg tgtg 54
<210> 23
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7631644-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 23
cctacacgac gctcttccga tctnnnnnnt gcgtgaacaa gagttttgc 49
<210> 24
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7631644-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 24
tcagacgtgt gctcttccga tctnnnnnna agggtggttc cagaggatt 49
<210> 25
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs4547664-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 25
cctacacgac gctcttccga tctnnnnnng aaccccaaat cttctgtgc 49
<210> 26
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs4547664-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 26
tcagacgtgt gctcttccga tctnnnnnng caactggggt aagagaagg 49
<210> 27
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7616256-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 27
cctacacgac gctcttccga tctnnnnnng ctcttgccaa tgtctcctc 49
<210> 28
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7616256-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 28
tcagacgtgt gctcttccga tctnnnnnng ccaaaggatt aagccaaaa 49
<210> 29
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs6800927-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 29
cctacacgac gctcttccga tctnnnnnng agcctggttt catttgtcc 49
<210> 30
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs6800927-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 30
tcagacgtgt gctcttccga tctnnnnnng gatttctttg tgagatctcc tg 52
<210> 31
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9834236-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 31
cctacacgac gctcttccga tctnnnnnnc aatgtgactt gcctgagtga 50
<210> 32
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs9834236-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 32
tcagacgtgt gctcttccga tctnnnnnnc catacatcta aatgctctga gtttg 55
<210> 33
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs66686363-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 33
cctacacgac gctcttccga tctnnnnnnt agggacaggc ctcagaaga 49
<210> 34
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs66686363-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 34
tcagacgtgt gctcttccga tctnnnnnng acgggccaca cctacag 47
<210> 35
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs56336456-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 35
cctacacgac gctcttccga tctnnnnnna cccccgaata gcctaacag 49
<210> 36
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs56336456-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 36
tcagacgtgt gctcttccga tctnnnnnng ttgctgcctg atcgtttct 49
<210> 37
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1967033-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 37
cctacacgac gctcttccga tctnnnnnnt ggtggacaga caaccaaca 49
<210> 38
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs1967033-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 38
tcagacgtgt gctcttccga tctnnnnnnt tcctcaccct aaaacagttc c 51
<210> 39
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7652451-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 39
cctacacgac gctcttccga tctnnnnnnt gcagctctcc tgccttaac 49
<210> 40
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-rs7652451-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 40
tcagacgtgt gctcttccga tctnnnnnna gcctgggcat catagtgag 49
<210> 41
<211> 49
<212> DNA
<213> Artificial Sequence
<220>
<223> N-MITF mutation-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 41
cctacacgac gctcttccga tctnnnnnna agagcactgg ccaaagaga 49
<210> 42
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> N-MITF mutation-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 42
tcagacgtgt gctcttccga tctnnnnnna aacatttttg atatatgggg aaca 54
<210> 43
<211> 56
<212> DNA
<213> Artificial Sequence
<220>
<223> N-Amelo-F
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 43
cctacacgac gctcttccga tctnnnnnnt caacttcagc tatgaggtaa tttttc 56
<210> 44
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> N-Amelo-R
<220>
<221> misc_feature
<222> (24)..(29)
<223> n is a, c, g, or t
<400> 44
tcagacgtgt gctcttccga tctnnnnnnc caaccatcag agcttaaact gg 52
<210> 45
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer For
<400> 45
aatgatacgg cgaccaccga gatctacaca cactctttcc ctacacgacg c 51
<210> 46
<211> 55
<212> DNA
<213> Artificial Sequence
<220>
<223> Index Primer Rev
<400> 46
caagcagaag acggcatacg agatctctta attgactgga gttcagacgt gtgct 55
<210> 47
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9847421-F
<400> 47
gcatcttagt tccctgccat a 21
<210> 48
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9847421-R
<400> 48
aaaggagaga aaatttgggt ga 22
<210> 49
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1564756-F
<400> 49
gagcacatcc aactccgttt 20
<210> 50
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1564756-R
<400> 50
gcagaaccca acttgcaga 19
<210> 51
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9862357-F
<400> 51
ccaccacact ggcctacatt 20
<210> 52
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9862357-R
<400> 52
gcaggtggaa taaacaagaa gg 22
<210> 53
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs2315310-F
<400> 53
ttgatgccat ggtaaatgaa a 21
<210> 54
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs2315310-R
<400> 54
tcagcaagat tgcaggatac a 21
<210> 55
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7610438-F
<400> 55
tggtttccta tcttcctcct g 21
<210> 56
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7610438-R
<400> 56
tccactctca ctgcctcact t 21
<210> 57
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7633580-F
<400> 57
tttcttggga aataaacctt gc 22
<210> 58
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7633580-R
<400> 58
atgcaggtct caggcaaaat 20
<210> 59
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6549245-F
<400> 59
tttcaaagca agacccaagc 20
<210> 60
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6549245-R
<400> 60
acattttgcc aggaaacagc 20
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs12492592-F
<400> 61
ggggaaaaac agtacgcttc 20
<210> 62
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs12492592-R
<400> 62
tgagaaggtg tgttagggtg tg 22
<210> 63
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs55921103-F
<400> 63
gccttgtgtt agtgctttag cc 22
<210> 64
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> rs55921103-R
<400> 64
cataggtacc ttccttaact ccag 24
<210> 65
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> rs12495615-F
<400> 65
catacatata aagcatttgg caca 24
<210> 66
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs12495615-R
<400> 66
catgtactgg cctcctttgc 20
<210> 67
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1491694-F
<400> 67
ttgcaatcgt gtgatccaat 20
<210> 68
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1491694-R
<400> 68
caaaaaccaa tagaaagtgt gtgtg 25
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7631644-F
<400> 69
tgcgtgaaca agagttttgc 20
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7631644-R
<400> 70
aagggtggtt ccagaggatt 20
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4547664-F
<400> 71
gaaccccaaa tcttctgtgc 20
<210> 72
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs4547664-R
<400> 72
gcaactgggg taagagaagg 20
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7616256-F
<400> 73
gctcttgcca atgtctcctc 20
<210> 74
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7616256-R
<400> 74
gccaaaggat taagccaaaa 20
<210> 75
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6800927-F
<400> 75
gagcctggtt tcatttgtcc 20
<210> 76
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> rs6800927-R
<400> 76
ggatttcttt gtgagatctc ctg 23
<210> 77
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9834236-F
<400> 77
caatgtgact tgcctgagtg a 21
<210> 78
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> rs9834236-R
<400> 78
ccatacatct aaatgctctg agtttg 26
<210> 79
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs66686363-F
<400> 79
tagggacagg cctcagaaga 20
<210> 80
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> rs66686363-R
<400> 80
gacgggccac acctacag 18
<210> 81
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs56336456-F
<400> 81
acccccgaat agcctaacag 20
<210> 82
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs56336456-R
<400> 82
gttgctgcct gatcgtttct 20
<210> 83
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1967033-F
<400> 83
tggtggacag acaaccaaca 20
<210> 84
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> rs1967033-R
<400> 84
ttcctcaccc taaaacagtt cc 22
<210> 85
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7652451-F
<400> 85
tgcagctctc ctgccttaac 20
<210> 86
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> rs7652451-R
<400> 86
agcctgggca tcatagtgag 20
<210> 87
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> MITF mutation-F
<400> 87
aagagcactg gccaaagaga 20
<210> 88
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> MITF mutation-R
<400> 88
aaacattttt gatatatggg gaaca 25
<210> 89
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Amelo-F
<400> 89
tcaacttcag ctatgaggta atttttc 27
<210> 90
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Amelo-R
<400> 90
ccaaccatca gagcttaaac tgg 23
<210> 91
<211> 182
<212> DNA
<213> Artificial Sequence
<220>
<223> Amelo male
<400> 91
tcaacttcag ctatgaggta atttttctct ttactaattt tgatcactgt ttgcattagc 60
agtcccctgg gctctgtaaa gaatagtggg tggattcttc atcccaaata aagtggtttc 120
tcaagtggtc ccaattttac agttcctacc atcagcttcc cagtttaagc tctgatggtt 180
gg 182
<210> 92
<211> 176
<212> DNA
<213> Artificial Sequence
<220>
<223> Amelo female
<400> 92
tcaacttcag ctatgaggta atttttctct ttactaattt tgaccattgt ttgcgttaac 60
aatgccctgg gctctgtaaa gaatagtgtg ttgattcttt atcccagatg tttctcaagt 120
ggtcctgatt ttacagttcc taccaccagc ttcccagttt aagctctgat ggttgg 176
Claims (8)
1. the primer for Non-invasive detection MITF gene mutations combines, it is characterised in that：Including nucleotide sequence such as Seq ID
20 pairs of primers shown in No.1-40 are used for the different zones of specific amplification MITF genes, to detect MITF genes simultaneously
It makes a variation and its closes on SNP site.
2. primer combination according to claim 1, it is characterised in that：Further include nucleotide sequence such as Seq ID No.41-
2 pairs of primers shown in 44.
3. a kind of method of Non-invasive detection MITF gene mutations, it is characterised in that：Include the following steps：
(1) using subject's plasma dna as template；
(2) PCR is carried out to expand in advance；
(3) Index PCR amplifications are carried out to pre- amplified production；
(4) after carrying out library Quality Control to Index pcr amplification products, 150bp is carried out on Illumina NextSeq sequenators
Both-end is sequenced；
(5) by the sequence information of sequencing remove jointing, be spliced into a primary template sequence, by primary template sequence with
The canonical sequence of MITF genes compares, and by comparing the UMI molecular label sequences of primary template sequence, counts unique mould
Plate sequence；Using unique template sequence, genome covering is calculated, for assessing library specificities, by calculating mutant nucleotide sequence
Go out body cell MITF gene mutation rates with the ration statistics of canonical sequence；
It is special simultaneously using the mixture of nucleotide sequence 20 pairs of primers as shown in Seq ID No.1-40 in the pre- amplification
Property amplification MITF genes different zones, to detect the variation of MITF genes and its close on SNP site；
Per a region in a pair of primer amplification MITF genes；The UMI molecular labels sequence for including between primer pair is different, uses
UMI molecular label sequences in the DNA cloning segment for ensureing to derive from the same area are identical, and from different zones
UMI molecular label sequences in DNA cloning segment are differing from each other；
In the Index PCR amplifications, using nucleotide sequence forward and reverse primer as shown in Seq ID No.45 and 46.
4. according to the method described in claim 3, it is characterized in that：In the pre- amplification, using nucleotide sequence such as Seq ID
The mixture of 22 pairs of primers shown in No.1-44 expands.
5. method according to claim 3 or 4, it is characterised in that：Before carrying out the Index PCR amplifications, to PCR
Pre- amplification gained DNA carries out magnetic beads for purifying.
6. method according to claim 3 or 4, it is characterised in that：It is right after carrying out the Index PCR amplifications
DNA obtained by Index PCR amplifications carries out magnetic beads for purifying.
7. the primer combination for detecting MITF gene mutations, it is characterised in that：Including nucleotide sequence such as Seq ID No.47-
20 pairs of primers shown in 86, be used for specific amplification MITF genes different zones, to detect MITF genes variation and its
Close on SNP site.
8. primer combination according to claim 7, it is characterised in that：Further include nucleotide sequence such as Seq ID No.87-
2 pairs of primers shown in 90.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810480505.0A CN108531583B (en) | 2018-05-18 | 2018-05-18 | Primer combination for noninvasive detection of MITF gene mutation and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810480505.0A CN108531583B (en) | 2018-05-18 | 2018-05-18 | Primer combination for noninvasive detection of MITF gene mutation and detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108531583A true CN108531583A (en) | 2018-09-14 |
| CN108531583B CN108531583B (en) | 2022-05-17 |
Family
ID=63472186
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810480505.0A Active CN108531583B (en) | 2018-05-18 | 2018-05-18 | Primer combination for noninvasive detection of MITF gene mutation and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108531583B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104294371A (en) * | 2014-09-30 | 2015-01-21 | 天津华大基因科技有限公司 | Method for constructing sequencing library and application of sequencing library |
| CN105063208A (en) * | 2015-08-10 | 2015-11-18 | 北京吉因加科技有限公司 | Low-frequency mutation enrichment sequencing method for free target DNA (deoxyribonucleic acid) in plasma |
| WO2016176091A1 (en) * | 2015-04-28 | 2016-11-03 | Illumina, Inc. | Error suppression in sequenced dna fragments using redundant reads with unique molecular indices (umis) |
| CN106399504A (en) * | 2016-09-20 | 2017-02-15 | 苏州贝康医疗器械有限公司 | Targeting-based new generation sequencing deafness gene detection set and kit, and detection method |
| CN106554955A (en) * | 2016-10-25 | 2017-04-05 | 大连晶泰生物技术有限公司 | Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof |
-
2018
- 2018-05-18 CN CN201810480505.0A patent/CN108531583B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104294371A (en) * | 2014-09-30 | 2015-01-21 | 天津华大基因科技有限公司 | Method for constructing sequencing library and application of sequencing library |
| WO2016176091A1 (en) * | 2015-04-28 | 2016-11-03 | Illumina, Inc. | Error suppression in sequenced dna fragments using redundant reads with unique molecular indices (umis) |
| CN105063208A (en) * | 2015-08-10 | 2015-11-18 | 北京吉因加科技有限公司 | Low-frequency mutation enrichment sequencing method for free target DNA (deoxyribonucleic acid) in plasma |
| CN106399504A (en) * | 2016-09-20 | 2017-02-15 | 苏州贝康医疗器械有限公司 | Targeting-based new generation sequencing deafness gene detection set and kit, and detection method |
| CN106554955A (en) * | 2016-10-25 | 2017-04-05 | 大连晶泰生物技术有限公司 | Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| YALAN LIU等: "A New Genetic Diagnostic for Enlarged Vestibular Aqueduct Based on Next-Generation Sequencing", 《PLOS ONE》 * |
| ZAC ZWIRKO等: "Multiplexed linear amplification for rapid targeted library construction", 《AGBT》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108531583B (en) | 2022-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20180123020A (en) | Use of DNA fragment size to determine copy number variation | |
| EP2758550B1 (en) | Detection of isotype profiles as signatures for disease | |
| CN106591273B (en) | One group of gene new mutation relevant to Organic acidemia and detection kit | |
| HUE030510T2 (en) | Diagnosing fetal chromosomal aneuploidy using genomic sequencing | |
| CN106319065A (en) | Kit and capture probe for human BRCA1/2 gene detection on basis of high-throughput sequencing | |
| CN111073961A (en) | High-throughput detection method for gene rare mutation | |
| CN110628891A (en) | Method for screening embryo for gene abnormality | |
| CN106939334B (en) | Method for detecting fetal DNA content in plasma of pregnant woman | |
| CN105420392B (en) | One group of gene new mutation relevant to newborn's Tendon defection phenotype and detection kit | |
| CN110564837A (en) | Genetic metabolic disease gene chip and application thereof | |
| CN108753934A (en) | A kind of detection method of gene mutation, kit and preparation method thereof | |
| CN108486230A (en) | Kit and preparation method thereof for Non-invasive detection MITF gene mutations | |
| CN110714066A (en) | DNA library for detecting and diagnosing corneal dystrophy disease-causing gene and application thereof | |
| CN113564266B (en) | SNP typing genetic marker combination, detection kit and application | |
| CN108531583A (en) | Primer combination for Non-invasive detection MITF gene mutations and detection method | |
| CN105838720A (en) | PTPRQ gene mutant and application thereof | |
| CN108642173A (en) | A kind of method and kit of Non-invasive detection SLC26A4 gene mutations | |
| CN109280697B (en) | Method for identifying fetal genotype by using plasma free DNA of pregnant woman | |
| Solomon et al. | Molecular diagnostics of non-hodgkin lymphoma | |
| CN112029833A (en) | Rapid identification method of CTNNB1 gene mutation for tumor organoid culture condition selection | |
| WO2019114473A1 (en) | Establishment and application of human immortalized b lymphocyte cell line group | |
| Byrne et al. | Single-cell long-read targeted sequencing reveals transcriptional variation in ovarian cancer | |
| CN108841946A (en) | A kind of method of Non-invasive detection GJB2 gene mutation, kit and preparation method thereof | |
| CN113481289B (en) | Primer composition for detecting sideroblastic red blood cell anemia and application thereof | |
| CN108949951A (en) | A kind of while Non-invasive detection GJB2 and SLC26A4 gene mutation method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |