CN106591273B - One group of gene new mutation relevant to Organic acidemia and detection kit - Google Patents

Abstract

The invention discloses one group of gene new mutation relevant to Organic acidemia and detection kits.The product that Organic acidemia related gene new mutation provided by the present invention obtains are as follows: D1) the obtained protein of c.1874A > C heterozygous mutant occurs for MUT gene, for the protein that p.Asp625Ala is mutated occurs；D2) c.470T > A heterozygosis protein arrived occurs for MUT gene, for the protein that p.Val157Asp is mutated occurs；D3) coding MUT gene c.1874A > DNA molecular or cDNA molecule of C heterozygous mutant protein；D4) coding MUT gene c.470T > DNA molecular or cDNA molecule of A mutein；The new hair mutation of of the invention two relevant to Organic acidemia is of great significance to the molecular diagnosis for carrying out Organic acidemia.

Description

One group of gene new mutation relevant to Organic acidemia and detection kit

Technical field

The present invention relates to field of biotechnology more particularly to one group of gene new mutations relevant to Organic acidemia And detection kit.

Background technique

Organic acidemia (Inborn errors of metabolism, IEM) refers to due to gene mutation and draws Enzyme missing, cell membrane function exception or receptor defects are played, so as to cause body biochemical metabolism disorder, cause intermediate or bypass metabolism Product accumulation or terminal metabolite lack, and cause a series of one group of disease of clinical symptoms.Organic acidemia is mostly Autosomal recessive hereditary diseases, minority are autosomal dominant inheritance or X, y linkage sex-linked inheritance and mitochondrial inheritance etc..From Since Garrod in 1908 propose the concept of inborn error of metabolism disease, the disease existing more than 500 found so far, and with new The increase of diagnostic techniques and gradually increase.Though the single disease incidence of Organic acidemia is low, cumulative morbidity is high, There are about 1 in 5000 newborns to suffer from Organic acidemia.

Organic acidemia can directly be divided into aminoacidopathy (such as phenylketonuria by metabolism substrate involved in it extremely Disease), organic acidemia (such as isovaleric acidemia), fatty acid oxidation defect (such as medium-chain acyl-coenzyme A dehydrogenase deficiency disease), peroxide (such as adenine is de- for change enzyme body sick (such as Zellweger syndrome), saccharine disease (such as galactosemia), disorder of nucleic acid metabolism disease Oxygenase deficiency disease), lysosomal disease (such as mucopolysaccharidosis) and metal metabolism obstacle (such as Wilson disease).According to abnormal metabolism object Inborn error of metabolism can be divided into small molecule sick (such as aminoacidopathy, Organic aciduria) and organelle disease (such as by molecular size Lipid metabolism disease).

Due to the heterogeneity of heredity, complicated clinical manifestation, severe one is dead in the acute attack stage of neonatal period, disease, deposits Mostly there are nervous system and the symptoms and sign of other visceral organ injuries by reviver.Organic acidemia patient is equal at any age It can fall ill.Age of onset is different, and clinical manifestation is different.General age of onset is more early, the indication state of an illness is heavy, the death rate is high.Due to new Raw youngster is weak to the respond of disease, and clinical manifestation is to refuse milk, vomiting, diarrhea, dehydration, drowsiness, dystonia, shy It nonspecific performance such as faints, have difficulty in breathing.

Part Organic acidemia can be treated.It, can after newborn has found Organic acidemia early Symptomatic treatment saves life, reduces nervous system sequelae.If baby suffers from methylmalonic aciduria, intramuscular injection can be carried out The vitamin B12 of 1mg is treated, and selects low protein diet.

The kinds of Diseases of Organic acidemia are more, largely there is multiple Disease-causing genes.Traditional detection method has enzyme Immunoassay, liquid phase tandem mass spectrometer (LC-MS/MS) technology, round pcr, Sanger sequencing technologies etc..Enzyme immunoassay (EIA) Testing cost is low but can only once detect a kind of disease, and is easy to be influenced by sample collection, has certain false positive and vacation yin Property rate.Liquid phase tandem mass spectrometer technology testing cost is low, energy more than 30 kinds of Organic acidemias of one-time detection, but can not determine The relevant pathogenic mutation of disease.PGR technology, Sanger sequencing technologies can determine that the relevant pathogenic mutation of disease, but once can only One or several mutation an of gene are detected, flux is low.

Therefore it is difficult using the above method to a variety of Organic acidemias while carries out detecting and determining pathogenic mutation, Recall rate is low, is clinically difficult to make a definite diagnosis disease.

The high throughput sequencing technologies of new generation to grow up from after the Human Genome Project capture rapidly because of its flux height Market.In recent years, high throughput sequencing technologies of new generation constantly improve, and the accuracy for detecting variation also steps up, same with this When, derive the targeting weight sequencing technologies to get up and greatly reduces testing cost, the great prospect in genetic disease detection application.

Summary of the invention

Present invention finds the compound heterozygosis of the gene M UT gene of coding methylmalonyl-CoA mutase is prominent Become: missense mutation c.1874A > C (p.Asp625Ala) and missense mutation c.470T > A (p.Val157Asp).It is to be solved Technical problem be how Diagnosis of Congenital metabolic defect or screening Organic acidemia patient.

In order to solve the above technical problems, present invention firstly provides following any products:

1) MUT mutein, for 625 Asp of sequence 2 (MUT protein amino acid sequence) are sported Ala, 157th Val for being of sequence 2 is sported into Asp, the constant obtained protein of other amino acid residues；

2) DNA molecular or cDNA molecule of the MUT mutein are encoded；

3) by the complete protein 1) formed with X1；The X1 is 35 eggs relevant to Organic acidemia At least one of the protein that white matter mutates；The protein of described 35 and Organic acidemia is ACADM、ARG1、ASL、ASS1、BCKDHA、BCKDHB、CPS1、DBT、DLD、ETFA、ETFB、ETFDH、FAH、GCDH、GCH1、 HPD、IVD、LMBRD1、MCEE、MMAA、MMAB、MMACHC、MMADHC、MUT、NAGS、OTC、PAH、PCBD1、PCCA、PCCB、 PTS, QDPR, SLC25A13, SLC25A14 and TAT protein matter；

4) by the complete DNA molecular or cDNA molecule 2) formed with X2；The X2 is the DNA molecular for encoding the X1 Or cDNA molecule.

The DNA molecular or cDNA molecule that encode the MUT mutein will encode the core of the DNA molecular of MUT protein The A that nucleotide sequence is the 1874th sports C, and sequence 1 the 470th T is sported A, the DNA that other invariant nucleotides obtain Molecule；

The nucleotides sequence for encoding the DNA molecular of MUT protein is classified as sequence 1.

In order to solve the above technical problems, the present invention also provides diagnosis or auxiliary diagnosis Organic acidemia patients Reagent set is reagent set 1.

Reagent set 1 provided by the present invention, by entitled G1 detection MUT gene c.1874A > C mutation substance, The detection MUT gene of the entitled G2 substance that c.470T > A is mutated；C.1874A > C sports MUT gene volume to the MUT gene The 1874th, area of code nucleotide is mutated into the DNA molecular that C is obtained by A；C.470T > A sports MUT gene volume to the MUT gene 470th nucleotide in code area is mutated into the obtained DNA molecular of A by T.

In above-mentioned reagent set 1, the MUT gene c.1874A > C mutation after nucleotides sequence be classified as sequence 21；It is described MUT gene c.470T > A mutation after nucleotides sequence be classified as sequence 23.

In above-mentioned reagent set 1, c.1874A > C mutation can be homozygous mutation to the MUT gene；The MUT gene C.470T > A mutation can be homozygous mutation.

In above-mentioned reagent set 1, the G1 can be detection MUT gene probe pair and/or primer that c.1874A > C is mutated It is right, two probes of the probe centering can the upstream and downstream respectively with the MUT gene c.1874A mutational site > C specifically tie Close, two primers in the primer pair can the upstream and downstream respectively with the MUT gene c.1874A mutational site > C specifically tie It closes；

The G2 can be to detect the MUT gene probe pair that c.470T > A is mutated and/or primer pair, the probe centering Two probes can respectively with the MUT gene c.470T mutational site > A upstream and downstream specific bond, two in the primer pair Primer can respectively with the MUT gene c.470T mutational site > A upstream and downstream specific bond；

In above-mentioned reagent set 1, the sequence of two probes of the detection MUT gene probe pair that c.1874A > C is mutated Sequence 3 and sequence 4 respectively in sequence table；The sequence of two probes of the detection MUT gene probe pair that c.470T > A is mutated Column are respectively sequence 5 and sequence 6 in sequence table；

The sequence of two primers in the detection MUT gene primer pair that c.1874A > C is mutated is respectively in sequence table Sequence 1 and sequence 2；The sequence of two primers in the detection MUT gene primer pair that c.470T > A is mutated is respectively sequence Sequence 13 and sequence 14 in table.

In order to solve the above technical problems, the present invention also provides following As 1)-A3) any one of diagnosis or auxiliary diagnosis The reagent set of Organic acidemia patient, the reagent set are reagent set 2:

A1) the G1；

A2) the G2；

A3) at least two reagent sets formed by the G1 and G2 in both.

In order to solve the above technical problems, the present invention also provides diagnosis or auxiliary diagnosis Organic acidemia patients Reagent set, the reagent set are reagent set 3.

Reagent set 3 provided by the present invention, by the reagent set 1 or the reagent set 2 and detection 35 and first The material composition of nature metabolic defect associated gene mutation；Described 35 are with Organic acidemia related gene ACADM、ARG1、ASL、ASS1、BCKDHA、BCKDHB、CPS1、DBT、DLD、ETFA、ETFB、ETFDH、FAH、GCDH、GCH1、 HPD、IVD、LMBRD1、MCEE、MMAA、MMAB、MMACHC、MMADHC、MUT、NAGS、OTC、PAH、PCBD1、PCCA、PCCB、 PTS, QDPR, SLC25A13, SLC25A14 and TAT gene.

In above-mentioned reagent set 3, it is respectively 7 He of sequence that the substance of the detection DLD gene mutation, which is by nucleotide sequence, The probe pair of two probes composition of sequence 8；

It can be two spies of sequence 9 and sequence 10 that the substance of the detection HPD gene mutation is by nucleotide sequence respectively The probe pair of needle composition；

It is described detection LMBRD1 gene mutation substance be respectively can be the two of sequence 11 and sequence 12 by nucleotide sequence The probe pair of a probe composition.

In order to solve the above technical problems, the present invention also provides diagnosis or auxiliary diagnosis Organic acidemia patients Reagent or kit.

The reagent or kit of diagnosis provided by the present invention or auxiliary diagnosis Organic acidemia patient, including institute State reagent set 1, the reagent set 2 or the reagent set 3.Specifically, the diagnosis or auxiliary diagnosis congenital generation Thank defect patient reagent or kit can by the reagent set 1, the reagent set 2 or the reagent set 3 with into The composition of reagent needed for row gene sequencing.Reagent needed for the carry out gene sequencing can be the production of illumina company TruSeq Custom Amplicon Kit reagent.

In order to solve the above technical problems, the present invention also provides detections and Organic acidemia associated gene mutation Method.

Detection provided by the present invention and the method for Organic acidemia associated gene mutation, including the use of it is described at Cover reagent 1, the reagent set 2 or the reagent set 3 detect sample to be tested MUT gene and/or it is described 35 with it is congenital The sequence of at least one of this 35 genes of property metabolic defect related gene gene, compared with corresponding gene, in determination State whether gene is mutated.

In the above method, the detection can be detection sample to be tested and elder generation with Organic acidemia associated gene mutation It whether there is nonsense mutation (nonsense variant), frameshift mutation (frame in nature metabolic defect related gene Shift), alternative splicing variation (Splicing variant), missense mutation (missense variant), amino acid truncation Or insertion variation (nonframe shift) and/or codon lose (stoplost).

The detection concretely detects sample to be tested MUT gene, DLD with Organic acidemia associated gene mutation Whether gene, HPD gene, and/or LMBRD1 gene are mutated.

The MUT gene mutation can be c.1874A > C mutation and the c.470T > A mutation of MUT gene.

Mutation with Organic acidemia related gene can lead to the single nucleotide polymorphism for corresponding gene occur, such as C.1874A > C is mutated the 1874th two equipotential polymorphisms of appearance that can lead to the gene coding region MUT to MUT gene, which is A Or C；C.470T > A mutation can lead to the two equipotential polymorphisms of appearance of the gene coding region MUT the 470th to MUT gene, which is T Or A.

In the above method, the detection MUT gene method that c.1874A > C is mutated can include:

A1 the cDNA sequence of MUT gene in sample to be tested) is detected,

A2) by the sequence of step a1) compared with the cDNA sequence of MUT gene, step a1) sequence correspond to MUT gene The 1874th of cDNA sequence is C or A/C heterozygosis, and MUT gene has c.1874A > C and is mutated.

Detect the MUT gene method that c.470T > A is mutated can include:

B1 the cDNA sequence of MUT gene in sample to be tested) is detected,

B2) by the sequence of step b1) compared with the cDNA sequence of MUT gene, step b1) sequence correspond to MUT gene The 470th of cDNA sequence is A or T/A heterozygosis, and MUT gene has c.470T > A and is mutated.

In the above method, the sample to be tested may be from the blood or tissue of test individual (such as newborn).

In order to solve the above technical problems, the present invention also provides following any applications:

I, following E1 of the reagent set or the reagent or kit)-E10) in any application:

E1) the application in preparation diagnosis or auxiliary diagnosis Organic acidemia patient product；

E2) the application in diagnosis or auxiliary diagnosis Organic acidemia patient；

E3) the application in preparation screening or auxiliary screening Organic acidemia patient product；

E4) the application in screening or auxiliary screening Organic acidemia patient；

E5) the application in preparation prediction Organic acidemia risk product；

E6) the application in prediction Organic acidemia risk；

E7) preparation detection and Organic acidemia related gene whether the application in mutant product；

E8) the application in whether detection is mutated with Organic acidemia related gene；

E9) preparation detection and Organic acidemia related protein whether the application in mutant product；

E10) the application in whether detection is mutated with Organic acidemia related protein；

The E1 of product described in II, claim 1)-E6) in any application.

In above-mentioned application, the patient can be newborn, infant or fetus.

In above-mentioned application, described and Organic acidemia associated gene mutation can be MUT gene, DLD gene, HPD The mutation of gene, LMBRD1 gene, as c.1874A c.470T > A is mutated MUT gene for > C mutation, MUT gene.

Described and Organic acidemia GAP-associated protein GAP cytoplasmic mutation can be MUT, DLD, HPD, and/or LMBRD1 protein Mutation, as MUT protein p.Asp625Ala mutation and/or MUT protein p.Val157Asp mutation.

C.1874A > C mutation and c.470T > A mutation are heterozygous mutant.

The present inventor passes through investigation disease database and document, and according to complementary with existing clinical testing techniques Principle, it is determined that 35 Disease-causing genes to relevant under Organic acidemia, encoded exon and choosing to 35 genes Selecting property shearing site designs multiple probe sequences, congenital to causing then using the high-throughput targeting weight sequencing technologies of a new generation The encoded exon of 35 Disease-causing genes of metabolic defect and alternative splicing site are sequenced, and are verified by clinical sample And analysis of biological information, it is based on crowd and disease database system, known Disease-causing gene mutation is filtered out, does not have to database The gene mutation included carries out the screening of bioinformatics function prediction and goes out new Disease-causing gene mutation, and in family and normal person It verifies and excludes in group, it was found that missense mutation c.1874A > C and the missense mutation of new compound heterozygous mutant-MUT gene C.470T > A is related to methylmalonic aciduria.

The new hair mutation of of the invention two is of great significance to the molecular diagnosis for carrying out Organic acidemia.

Detailed description of the invention

Fig. 1 is library preparation and the data analysis process of high-flux sequence.

Fig. 2 is the pedigree analysis result to MUT gene mutation.Wherein, A is that c.1874A > C heterozygosis is prominent for patient MUT gene Become the Sanger verification result with c.470T > A heterozygous mutant；B is father patient MUT gene c.1874A > C heterozygous mutant Sanger verification result, C are the Sanger verification result of mother patient MUT gene c.470T > A heterozygous mutant.

The step of Fig. 3 is variation quality control and condition.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.Required original Material is hereinafter described, and a part is bought in the illumina TruSeq Custom Amplicon Kit of illumina, A part is purchased from other producers.

The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining The bright present invention, the range being not intended to be limiting of the invention.

Experimental method in following embodiments is unless otherwise specified conventional method.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Embodiment 1, gene mutation related with Organic acidemia discovery

The present embodiment targets weight sequencing technologies with a new generation is high-throughput, faces 62 for having Organic acidemia phenotype Bed sample and 6 normal person's samples without Organic acidemia phenotype carried out known 35 Disease-causing genes exon and The high-flux sequence in alternative splicing site newly sends out heterozygous mutant compound in conjunction with what analysis of biological information had found MUT gene: C.1874A c.470T > A is related with methylmalonic aciduria for > C and missense mutation for missense mutation, and is sieved by normal person's sample The two variations of choosing and Sanger sequence verification.

The nucleotides sequence of MUT gene wild type is classified as sequence 1, and the amino acid sequence of the albumen MUT of coding is sequence 2；

The nucleotide sequence of missense mutation c.1874A > C and the missense mutation c.470T MUT mutated gene after > A occurs For sequence 1 the 1874th A is sported C, and sequence 1 the 470th T is sported into A, other invariant nucleotides.

The amino acid sequence of the MUT mutain of MUT mutated gene coding is to sport 625 Asp of sequence 2 Ala, and the 157th Val for being of sequence 2 is sported into Asp, other amino acid residues are constant.

One, the discovery of gene mutation related with Organic acidemia

Flow chart is as shown in Figure 1.

1. sample collection

The peripheral blood and dried blood spot sample of infant of 62 clinics with Organic acidemia phenotype are acquired, and 6 Normal human peripheral's blood samples without Organic acidemia phenotype are acquired, EDTA is anticoagulant, -80 degrees Celsius of preservations.62 There is clinic the sample of Organic acidemia phenotype largely to pass through tandem mass spectrum screening, and detect to be metabolized accordingly different Often.

2. library preparation and sequencing

The encoded exon and alternative splicing site of 35 genes are directed to using the DesignStudio platform of illumia Design probe, obtain complete probe, this 35 genes are as follows: Gene A CADM, ARG1, ASL, ASS1, BCKDHA, BCKDHB, CPS1、DBT、DLD、ETFA、ETFB、ETFDH、FAH、GCDH、GCH1、HPD、IVD、LMBRD1、MCEE、MMAA、MMAB、 MMACHC, MMADHC, MUT, NAGS, OTC, PAH, PCBD1, PCCA, PCCB, PTS, QDPR, SLC25A13, SLC25A14 and TAT gene.

Complete probe is as follows:

Detecting the MUT gene probe sequence that c.1874A > C is mutated is sequence 3 and sequence 4:

Sequence 3 (the detection MUT gene upstream probe sequence that c.1874A > C is mutated)

5’-TGCTCAATGTCTGTCATCATTTTACTAC-3’

Sequence 4 (the detection MUT gene downstream probe sequence that c.1874A > C is mutated)

5’-GGGTTAATGTGCAGGCTTGTTACATAG-3’

Detecting the MUT gene probe sequence that c.470T > A is mutated is sequence 5 and sequence 6:

Sequence 5 (the detection MUT gene upstream probe sequence that c.470T > A is mutated)

5’-ATCGTGGCTATGATTCAGACAACCCTC-3’

Sequence 6 (the detection MUT gene downstream probe sequence that c.470T > A is mutated)

5’-GGAATTTTTACAACATGCTATAACTGAATT-3’

The probe sequence for detecting DLD gene mutation is sequence 7 and 8:

Sequence 7 (the upstream probe sequence of detection DLD gene mutation)

5 '-CTCAGGAAAAAGTTGGCAAAGGAACAG one 3 '

Sequence 8 (the downstream probe sequence of detection DLD gene mutation)

5’-AAACAGACTTCAAATAATCAAAAAGCAC-3’

The probe sequence for detecting HPD gene mutation is sequence 9 and 10:

Sequence 9 (the upstream probe sequence of detection HPD gene mutation)

5’-TGAGTTGACAAAATAAAATGTCCGGCC-3’

Sequence 10 (the upstream probe sequence of detection HPD gene mutation)

5’-AAGATGACGGGTCCTCACGGTGGACT-3’

The probe sequence for detecting LMBRD1 gene mutation is sequence 11 and 12:

Sequence 11 (the upstream probe sequence of detection LMBRD1 gene mutation)

5’-TGTTCCACAGTCTGAAAATAGCATTCC-3’

Sequence 12 (the upstream probe sequence of detection LMBRD1 gene mutation)

5’-GGAAAAGAATTTCCTGGCATTTTGCTG-3’

It is normal to 62 clinical samples and 6 right using illumina TruSeq Custom Amplicon Kit reagent The preparation of this progress library and merging in the same old way.Library after merging is sequenced using MiSeq sequenator, reads long 2 × 300bp.Under State the step (c) in method, (d), (e), (f), (g) and (h) agents useful for same be the production of illumina company TruSeq Custom Amplicon Kit reagent.

(a) extraction of genomic DNA

The genomic DNA of peripheral blood sample is extracted, extracting method can refer to the base provided in " Molecular Cloning:A Laboratory guide " Because of a group DNA extraction method, it also can purchase commercial kit (such as QIAGEN company) and operate to specifications.

(b) Quality Control of genomic DNA

Quality Control is carried out to the genomic DNA of extraction, Nanodrop2000 spectrophotometric measures purity, it is desirable that OD₂₆₀/0D₂₈₀ Between 1.8~2.0；Qubit fluorescent spectrophotometer measuring concentration, it is desirable that concentration is not less than 3.5ng/ μ L, and total amount is not less than 50ng.

(c) probe and genomic DNA hybridization

Above-mentioned complete probe and hybridization buffer are sequentially added in the genomic DNA after dilution, 95 DEG C of incubation 1min, so After be slow cooling to 40 DEG C, obtain hybrid mixed liquid.

(d) purifying of hybrid product

Assembling filter plate filters plate hole with buffer prewashing.Hybrid mixed liquid is added in filter membrane, is centrifuged, filtering Fall the probe not in conjunction with genomic DNA, is then washed with washing buffer, be centrifuged, obtain probe-genomic DNA Hybridization complex.

(e) extension-connection of probe

Into probe after purification-genomic DNA hybridization compound, addition extension-ligase and buffer mixed liquor, 37 DEG C be incubated for 45min.

(f) extension-connection product purifying

After incubation, by obtained extension-connection product using AMPure XP magnetic bead (Beckman company, the U.S.) into Row purifying, the complete enzyme of removal unreacted, buffer and dNTP Mixture.

(g) PCR amplification

96 hole PCR plates are taken, i5 junction block is arranged by the direction of PCR plate A-H, i7 junction block is pressed to the side of PCR plate 1-12 To arrangement, identical i5 connector is added to every row (1-12) of PCR plate, identical i7 connector is added to PCR plate each column (A-H)； PCR master mix is added into PCR plate hole；Extension-connection product after purification is added into each hole again.Of short duration centrifugation, Carry out PCR amplification, amplification condition: 95 DEG C of initial denaturation 3min；95 DEG C of denaturation 30s, 66 DEG C of annealing 30s, 72 DEG C of extension 60s coamplifications 25~30 circulations；Last 72 DEG C of extensions 5min.

(h) purifying of pcr amplification product

The PCR product obtained after amplification is purified using AMPure XP magnetic bead (Beckman company, the U.S.), and according to The scheme of Products Show carries out experimental implementation.

(i) Quality Control in library

PCR product after purification carries out Concentration Testing and amplified fragments size detection.Use Qubit fluophotometer BR Reagent measures roughly concentration, uses QPCR instrument Accurate Determining concentration.Library size is detected with 2100 biological analyser of Agilent Distribution, applied sample amount luL, the requirement of library size distribution: unimodal, clip size is in 600bp or so.

(j) merging in library

The library of Quality Control qualification is merged, the body being added when being merged according to each library of the concentration calculation in each library Product, equimolar merge each library；According to the data throughput of sequenator, the overburden depth of target area size and needs, calculate Combined library number.

(k) dilution in library and the sequencing of upper machine

With Hybridization Dilution buffer (illumina Products, article No.: the text after merging for MS-102-3003) dilution Library, then according to sequenator operating instruction carry out fasciation at and sequencing.

3. data analysis carries out initial data using the matched Data Analysis Software MiSeq Reporter of MiSeq sequenator Processing, analysis, detect SNP and Indel variation.

It makes a variation to the SNP and Indel of detection and is annotated using SnpEff software.Especially pay close attention to nonsense mutation (nonsense variant), frameshift mutation (frame shift), alternative splicing variation (splicing variant), mistake Justice mutation (missense variant), amino acid truncation or insertion variation (nonframe shift) and codon are lost (stoplost) six kinds of variation types.

Known pathogenic mutation is filtered out using the disease databases such as ClinVar and other mutation databases, utilizes crowd Database, as dbSNP data, thousand human genome databases, ESP (sequencing of extron group database) filter out known variation.Together The sequencing result of Shi Liyong normal control sample is filtered remaining variation.It chooses and makes a variation present in patient, and it is normal The variation being not present in check sample.

Function prediction is carried out to SNP using a plurality of forecasting softwares such as SIFT, Polyphen, Mutation Taster.Prediction It as a result is potential pathogenic mutation for pathogenic SNP.Find that the heterozygosis of c.1874A > C has occurred in MUT gene in these mutation The heterozygous mutant of mutation and c.470T > A are potential pathogenic mutation.The two variations detect in the same clinical samples, And pass through Sanger sequence verification.The patient has the clinical manifestation of Organic acidemia, and being concatenated mass spectrum screening is methyl Malonic acid urinates disease.Father and mother to patient take peripheral blood, extract DNA, carry out the Sanger sequencing of MUT gene.As a result It was found that the heterozygous mutant of c.1874A > C has occurred in the MUT gene of father patient, the heterozygous mutant of c.470T > A does not occur；Suffer from The heterozygous mutant of c.470T > A has occurred in the MUT gene of mother person, and the heterozygous mutant of c.1874A > C does not occur.It is possible thereby to It determines the c.1874A > C heterozygous mutant of MUT gene and c.470T > A heterozygous mutant is compound heterozygous mutant.Patient be this two It causes a disease when a heterozygous mutant occurs simultaneously, parent is the carrier of one of heterozygous mutant, is normal person.

MUT gene c.1874A > C heterozygous mutant and c.470T > A heterozygous mutant confirms not in 6 normal control samples In the presence of.C.1874A > C using the icp gene group analysis discovery MUT gene of 10000 vertebrates of UCSC database is prominent Become and c.470T > A is located at highly conserved site.

4. experimental result

Sequence is resurveyed by the targeting of 35 Disease-causing genes and analysis of biological information finds that two new hairs have occurred in a patient Mutation, is the c.1874A heterozygous mutant of > C and the c.470T heterozygous mutant of > A on MUT gene respectively, is verified as by family Compound heterozygous mutant.

Omim database annotates the corresponding disease such as table 1 of MUT gene.

Table 1, the corresponding disease of omim database annotation MUT gene

It is proved by the clinical manifestation and the phenotypic information of gene mutation related disease that isolate experiment and patient in family, C.1874A the compound heterozygous mutant of > C and c.470T > A is related with methylmalonic aciduria on MUT gene.

5. the quality control step and condition of variation

The variation number that each pattern detection goes out has several hundred, controls according to the quality of MiSeq Reporter software default Condition is 61.42% by the concordance rate that the variation that quality controls is verified through Sanger PCR sequencing PCR, not over quality control The concordance rate verified through Sanger PCR sequencing PCR that makes a variation is 17.78%.It can be seen that according to the quality control conditions of default have compared with High false positive and false negative.To reduce false positive and false negative, a set of variation matter based on the sequencing of MiSeq amplicon is established Measure rate-determining steps and condition:

(a) variation labeled as " R8 " is filtered out；

(b) variation labeled as " Low Variant Frequency " is filtered out；

(c) variation labeled as " Low GQX " is filtered out；

(d) variation of the QUAL value less than 50 is filtered out；

(e) when genotype heterozygosis, the variation that sequencing depth multiplies less than 20 is filtered out；When genotype is homozygous, survey is filtered out The Indel that the SNP and sequencing depth that sequence depth multiplies less than 4 multiply less than 10.

According to above-mentioned quality control step and condition, concordance rate is verified through Sanger PCR sequencing PCR by the variation that quality controls It is 89.28%, verifying concordance rate through Sanger PCR sequencing PCR not over the variation of quality control is 1.69%.It can be seen that pressing According to quality control step adjusted and condition, false positive and false negative greatly reduces.

The step of quality that makes a variation control and condition are as shown in Figure 3.

Two, the Sanger method sequence verification of gene mutation related with Organic acidemia

Sanger sequence verification is carried out to the mutation detected in clinical samples, the expert that goes forward side by side is verifying.Specific method step It is rapid as follows:

(1) extracting genome DNA

To the clinical sample for detecting above-mentioned mutation, genome is extracted from peripheral blood using QIAGEN Mini Kit DNA.Quality control is carried out to the genomic DNA of extraction, 0D260/280 is between 1.8~2.0, and 0D260/230 is 1.8~2.0 Between.

(2) design of primers and PCR reaction

With reference to human gene data unit sequence library GRCh37/hg19, it is directed to MUT gene respectively using Primer3.0 C.1874A the mutational site > C and c.470T specific primer is designed in the mutational site > A, primer sequence see the table below 2:

Table 2, the mutational site c.1874A > C of MUT gene and c.470T the mutational site > A design specific primer

Gene	Mutational site	Forward primer (5 ' > 3 ')	Reverse primer (5 ' > 3 ')	Primer size
					MUT	C.1874A > C	TGGGCAGGAATGGAGAGAAA (sequence 13)	GGGGTGATCTATGCAGCTGTT (sequence 14)	542bp
MUT	C.470T > A	TCATGGATGGTTCTGGAGGAA (sequence 15)	TGGCACAAGGGAAACAACTG (sequence 16)	535bp

(3) PCR reaction system

Each component is added into PCR pipe for according to the form below 3, reacts 50 μ L of total volume.

Table 3

Reagent	Volume/each reaction
		10×PCR Buffer(mg2+ plus)	5μL
dNTP Mixture(each 10mM)	1μL
		TaKaRa Taq(5U/μL)	0.25μL
Forward primer	2μL
		Reverse primer	2μL
Genomic DNA	100ng
		ddH20	Up to 50μL

(4) PCR thermal cycle conditions

By the of short duration centrifugation of PCR pipe, then in being carried out amplification reaction in PCR instrument according to the thermal cycle conditions in following table.

Table 4

(5) Sanger is sequenced

PCR product sequencing result is shown in into Fig. 2.Fig. 2 shows the result of clinical samples Sanger sequencing and family verifying.Figure A is patient MUT the gene c.1874A heterozygous mutant of > C and the c.470T sequencing peak figure of > A heterozygous mutant in 2, and two sites are all Heterozygous mutant has occurred.B is father patient MUT the gene c.1874A heterozygous mutant of > C and c.470T > A heterozygous mutant in Fig. 2 Sequencing peak figure, the only heterozygous mutant that A to C has occurred of the gene coding region MUT the 1874th.C is mother patient MUT in Fig. 2 The gene c.1874A heterozygous mutant of > C and c.470T the sequencing peak figure of > A heterozygous mutant, the only gene coding region MUT the 470th The heterozygous mutant of T to A has occurred in position.The position of arrow instruction is mutational site.

Sequence table

<110>hospital general, ground force, Chinese People's Liberation Army Shenzhen, Capitalbio Corporation Co., Ltd. third people cure Institute

<120>one groups of gene new mutations relevant to Organic acidemia and detection kit

<160> 16

<170> PatentIn version 3.5

<210> 1

<211> 2253

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 1

atgttaagag ctaagaatca gcttttttta ctttcacctc attacctgag gcaggtaaaa 60

gaatcatcag gctccaggct catacagcaa cgacttctac accagcaaca gccccttcac 120

ccagaatggg ctgccctggc taaaaagcag ctgaaaggca aaaacccaga agacctaata 180

tggcacaccc cggaagggat ctctataaaa cccttgtatt ccaagagaga tactatggac 240

ttacctgaag aacttccagg agtgaagcca ttcacacgtg gaccatatcc taccatgtat 300

acctttaggc cctggaccat ccgccagtat gctggtttta gtactgtgga agaaagcaat 360

aagttctata aggacaacat taaggctggt cagcagggat tatcagttgc ctttgatctg 420

gcgacacatc gtggctatga ttcagacaac cctcgagttc gtggtgatgt tggaatggct 480

ggagttgcta ttgacactgt ggaagatacc aaaattcttt ttgatggaat tcctttagaa 540

aaaatgtcag tttccatgac tatgaatgga gcagttattc cagttcttgc aaattttata 600

gtaactggag aagaacaagg tgtacctaaa gagaagctta ctggtaccat ccaaaatgat 660

atactaaagg aatttatggt tcgaaataca tacatttttc ctccagaacc atccatgaaa 720

attattgctg acatatttga atatacagca aagcacatgc caaaatttaa ttcaatttca 780

attagtggat accatatgca ggaagcaggg gctgatgcca ttctggagct ggcctatact 840

ttagcagatg gattggagta ctctagaact ggactccagg ctggcctgac aattgatgaa 900

tttgcaccaa ggttgtcttt cttctgggga attggaatga atttctatat ggaaatagca 960

aagatgagag ctggtagaag actctgggct cacttaatag agaaaatgtt tcagcctaaa 1020

aactcaaaat ctcttcttct aagagcacac tgtcagacat ctggatggtc acttactgag 1080

caggatccct acaataatat tgtccgtact gcaatagaag caatggcagc agtatttgga 1140

gggactcagt ctttgcacac aaattctttt gatgaagctt tgggtttgcc aactgtgaaa 1200

agtgctcgaa ttgccaggaa cacacaaatc atcattcaag aagaatctgg gattcccaaa 1260

gtggctgatc cttggggagg ttcttacatg atggaatgtc tcacaaatga tgtttatgat 1320

gctgctttaa agctcattaa tgaaattgaa gaaatgggtg gaatggccaa agctgtagct 1380

gagggaatac ctaaacttcg aattgaagaa tgtgctgccc gaagacaagc tagaatagat 1440

tctggttctg aagtaattgt tggagtaaat aagtaccagt tggaaaaaga agacgctgta 1500

gaagttctgg caattgataa tacttcagtg cgaaacaggc agattgaaaa acttaagaag 1560

atcaaatcca gcagggatca agctttggct gaacgttgtc ttgctgcact aaccgaatgt 1620

gctgctagcg gagatggaaa tatcctggct cttgcagtgg atgcatctcg ggcaagatgt 1680

acagtgggag aaatcacaga tgccctgaaa aaggtatttg gtgaacataa agcgaatgat 1740

cgaatggtga gtggagcata tcgccaggaa tttggagaaa gtaaagagat aacatctgct 1800

atcaagaggg ttcataaatt catggaacgt gaaggtcgca gacctcgtct tcttgtagca 1860

aaaatgggac aagatggcca tgacagagga gcaaaagtta ttgctacagg atttgctgat 1920

cttggttttg atgtggacat aggccctctt ttccagactc ctcgtgaagt ggcccagcag 1980

gctgtggatg cggatgtgca tgctgtgggc ataagcaccc tcgctgctgg tcataaaacc 2040

ctagttcctg aactcatcaa agaacttaac tcccttggac ggccagatat tcttgtcatg 2100

tgtggagggg tgataccacc tcaggattat gaatttctgt ttgaagttgg tgtttccaat 2160

gtatttggtc ctgggactcg aattccaaag gctgccgttc aggtgcttga tgatattgag 2220

aagtgtttgg aaaagaagca gcaatctgta taa 2253

<210> 2

<211> 750

<212> PRT

<213>artificial sequence

<220>

<223>

<400> 2

Met Leu Arg Ala Lys Asn Gln Leu Phe Leu Leu Ser Pro His Tyr Leu

1 5 10 15

Arg Gln Val Lys Glu Ser Ser Gly Ser Arg Leu Ile Gln Gln Arg Leu

20 25 30

Leu His Gln Gln Gln Pro Leu His Pro Glu Trp Ala Ala Leu Ala Lys

35 40 45

Lys Gln Leu Lys Gly Lys Asn Pro Glu Asp Leu Ile Trp His Thr Pro

50 55 60

Glu Gly Ile Ser Ile Lys Pro Leu Tyr Ser Lys Arg Asp Thr Met Asp

65 70 75 80

Leu Pro Glu Glu Leu Pro Gly Val Lys Pro Phe Thr Arg Gly Pro Tyr

85 90 95

Pro Thr Met Tyr Thr Phe Arg Pro Trp Thr Ile Arg Gln Tyr Ala Gly

100 105 110

Phe Ser Thr Val Glu Glu Ser Asn Lys Phe Tyr Lys Asp Asn Ile Lys

115 120 125

Ala Gly Gln Gln Gly Leu Ser Val Ala Phe Asp Leu Ala Thr His Arg

130 135 140

Gly Tyr Asp Ser Asp Asn Pro Arg Val Arg Gly Asp Val Gly Met Ala

145 150 155 160

Gly Val Ala Ile Asp Thr Val Glu Asp Thr Lys Ile Leu Phe Asp Gly

165 170 175

Ile Pro Leu Glu Lys Met Ser Val Ser Met Thr Met Asn Gly Ala Val

180 185 190

Ile Pro Val Leu Ala Asn Phe Ile Val Thr Gly Glu Glu Gln Gly Val

195 200 205

Pro Lys Glu Lys Leu Thr Gly Thr Ile Gln Asn Asp Ile Leu Lys Glu

210 215 220

Phe Met Val Arg Asn Thr Tyr Ile Phe Pro Pro Glu Pro Ser Met Lys

225 230 235 240

Ile Ile Ala Asp Ile Phe Glu Tyr Thr Ala Lys His Met Pro Lys Phe

245 250 255

Asn Ser Ile Ser Ile Ser Gly Tyr His Met Gln Glu Ala Gly Ala Asp

260 265 270

Ala Ile Leu Glu Leu Ala Tyr Thr Leu Ala Asp Gly Leu Glu Tyr Ser

275 280 285

Arg Thr Gly Leu Gln Ala Gly Leu Thr Ile Asp Glu Phe Ala Pro Arg

290 295 300

Leu Ser Phe Phe Trp Gly Ile Gly Met Asn Phe Tyr Met Glu Ile Ala

305 310 315 320

Lys Met Arg Ala Gly Arg Arg Leu Trp Ala His Leu Ile Glu Lys Met

325 330 335

Phe Gln Pro Lys Asn Ser Lys Ser Leu Leu Leu Arg Ala His Cys Gln

340 345 350

Thr Ser Gly Trp Ser Leu Thr Glu Gln Asp Pro Tyr Asn Asn Ile Val

355 360 365

Arg Thr Ala Ile Glu Ala Met Ala Ala Val Phe Gly Gly Thr Gln Ser

370 375 380

Leu His Thr Asn Ser Phe Asp Glu Ala Leu Gly Leu Pro Thr Val Lys

385 390 395 400

Ser Ala Arg Ile Ala Arg Asn Thr Gln Ile Ile Ile Gln Glu Glu Ser

405 410 415

Gly Ile Pro Lys Val Ala Asp Pro Trp Gly Gly Ser Tyr Met Met Glu

420 425 430

Cys Leu Thr Asn Asp Val Tyr Asp Ala Ala Leu Lys Leu Ile Asn Glu

435 440 445

Ile Glu Glu Met Gly Gly Met Ala Lys Ala Val Ala Glu Gly Ile Pro

450 455 460

Lys Leu Arg Ile Glu Glu Cys Ala Ala Arg Arg Gln Ala Arg Ile Asp

465 470 475 480

Ser Gly Ser Glu Val Ile Val Gly Val Asn Lys Tyr Gln Leu Glu Lys

485 490 495

Glu Asp Ala Val Glu Val Leu Ala Ile Asp Asn Thr Ser Val Arg Asn

500 505 510

Arg Gln Ile Glu Lys Leu Lys Lys Ile Lys Ser Ser Arg Asp Gln Ala

515 520 525

Leu Ala Glu Arg Cys Leu Ala Ala Leu Thr Glu Cys Ala Ala Ser Gly

530 535 540

Asp Gly Asn Ile Leu Ala Leu Ala Val Asp Ala Ser Arg Ala Arg Cys

545 550 555 560

Thr Val Gly Glu Ile Thr Asp Ala Leu Lys Lys Val Phe Gly Glu His

565 570 575

Lys Ala Asn Asp Arg Met Val Ser Gly Ala Tyr Arg Gln Glu Phe Gly

580 585 590

Glu Ser Lys Glu Ile Thr Ser Ala Ile Lys Arg Val His Lys Phe Met

595 600 605

Glu Arg Glu Gly Arg Arg Pro Arg Leu Leu Val Ala Lys Met Gly Gln

610 615 620

Asp Gly His Asp Arg Gly Ala Lys Val Ile Ala Thr Gly Phe Ala Asp

625 630 635 640

Leu Gly Phe Asp Val Asp Ile Gly Pro Leu Phe Gln Thr Pro Arg Glu

645 650 655

Val Ala Gln Gln Ala Val Asp Ala Asp Val His Ala Val Gly Ile Ser

660 665 670

Thr Leu Ala Ala Gly His Lys Thr Leu Val Pro Glu Leu Ile Lys Glu

675 680 685

Leu Asn Ser Leu Gly Arg Pro Asp Ile Leu Val Met Cys Gly Gly Val

690 695 700

Ile Pro Pro Gln Asp Tyr Glu Phe Leu Phe Glu Val Gly Val Ser Asn

705 710 715 720

Val Phe Gly Pro Gly Thr Arg Ile Pro Lys Ala Ala Val Gln Val Leu

725 730 735

Asp Asp Ile Glu Lys Cys Leu Glu Lys Lys Gln Gln Ser Val

740 745 750

<210> 3

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 3

tgctcaatgt ctgtcatcat tttactac 28

<210> 4

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 4

gggttaatgt gcaggcttgt tacatag 27

<210> 5

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 5

atcgtggcta tgattcagac aaccctc 27

<210> 6

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 6

ggaattttta caacatgcta taactgaatt 30

<210> 7

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 7

ctcaggaaaa agttggcaaa ggaacag 27

<210> 8

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 8

aaacagactt caaataatca aaaagcac 28

<210> 9

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 9

tgagttgaca aaataaaatg tccggcc 27

<210> 10

<211> 26

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 10

aagatgacgg gtcctcacgg tggact 26

<210> 11

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 11

tgttccacag tctgaaaata gcattcc 27

<210> 12

<211> 27

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 12

ggaaaagaat ttcctggcat tttgctg 27

<210> 13

<211> 20

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 13

tgggcaggaa tggagagaaa

<210> 14

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 14

ggggtgatct atgcagctgt t

<210> 15

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 15

tcatggatgg ttctggagga a

<210> 16

<211> 21

<212> DNA

<213>artificial sequence

<220>

<223>

<400> 16

tggcacaagg gaaacaactg

Claims (9)

1. following any products:

1) MUT mutein, for the Asp of the 625th of sequence 2 is sported Ala and the 157th Val of sequence 2 dashes forward Become Asp, the constant obtained protein of other amino acid residues；

2) DNA molecular or cDNA molecule of the MUT mutein are encoded；

3) by the complete protein 1) formed with X1；The X1 is 35 protein relevant to Organic acidemia Mutate obtained at least one of protein；35 protein relevant to Organic acidemia is ACADM、ARG1、ASL、ASS1、BCKDHA、BCKDHB、CPS1、DBT、DLD、ETFA、ETFB、ETFDH、FAH、GCDH、GCH1、 HPD、IVD、LMBRD1、MCEE、MMAA、MMAB、MMACHC、MMADHC、MUT、NAGS、OTC、PAH、PCBD1、PCCA、PCCB、 PTS, QDPR, SLC25A13, SLC25A14 and TAT protein matter；

4) by the complete DNA molecular or cDNA molecule 2) formed with X2；The X2 be encode the X1 DNA molecular or CDNA molecule.

2. the reagent set of diagnosis or auxiliary diagnosis Organic acidemia patient,

By entitled G1 detection MUT gene c.1874A > C mutation substance and entitled G2 detection MUT gene c.470T > A The material composition of mutation；

The MUT gene c.1874A > C sports the 1874th nucleotide of the gene coding region MUT and is mutated into the base that C is obtained by A Cause；The MUT gene c.470T > A sports the 470th nucleotide of the gene coding region MUT and is mutated into the gene that A is obtained by T；

The MUT coding sequence is as shown in sequence 1 in sequence table；

Or the substance including detecting MUT mutein described in claim 1.

3. reagent set according to claim 2, it is characterised in that: the G1 be detection MUT gene c.1874A > C mutation Probe pair and/or primer pair, two probes of the probe centering respectively with MUT gene c.1874A > mutational site C it is upper Trip and downstream specific bond, two primers in the primer pair respectively with MUT gene c.1874A > upstream in the mutational site C and Downstream specific bond；

The G2 be detect MUT gene c.470T > A mutation probe pair and/or primer pair, two probes of the probe centering Respectively with MUT gene c.470T > the upstream and downstream specific bond in the mutational site A, two primers difference in the primer pair With MUT gene c.470T > the upstream and downstream specific bond in the mutational site A.

4. reagent set according to claim 3, it is characterised in that: it is described detection MUT gene c.1874A > C mutation spy For the sequences of two probes be respectively sequence 3 and sequence 4 in sequence table；It is described detection MUT gene c.470T > A mutation The sequence of two probes of probe pair is respectively sequence 5 and sequence 6 in sequence table；

The detection MUT gene c.1874A > primer pair of C mutation in the sequences of two primers be respectively sequence in sequence table 13 and sequence 14；The detection MUT gene c.470T > primer pair of A mutation in the sequences of two primers be respectively sequence table Middle sequence 15 and sequence 16.

5. the reagent set of diagnosis or auxiliary diagnosis Organic acidemia patient, by the G1 any in claim 2-4 With the reagent set of G2 composition.

6. diagnosis or auxiliary diagnosis Organic acidemia patient reagent set, by claim 2-5 it is any it is described at It covers reagent and detects the material composition of 35 with Organic acidemia associated gene mutation；Described 35 and congenital metabolic Defect related gene be ACADM, ARG1, ASL, ASS1, BCKDHA, BCKDHB, CPS1, DBT, DLD, ETFA, ETFB, ETFDH, FAH、GCDH、GCH1、HPD、IVD、LMBRD1、MCEE、MMAA、MMAB、MMACHC、MMADHC、MUT、NAGS、OTC、PAH、 PCBD1, PCCA, PCCB, PTS, QDPR, SLC25A13, SLC25A14 and TAT gene.

7. reagent set according to claim 6, it is characterised in that:

It is respectively that two probes of sequence 7 and sequence 8 form that the substance of the detection DLD gene mutation, which is by nucleotide sequence, Probe pair；

It is respectively that two probes of sequence 9 and sequence 10 form that the substance of the detection HPD gene mutation, which is by nucleotide sequence, Probe pair；

The substance of the detection LMBRD1 gene mutation is two probes for being respectively sequence 11 and sequence 12 by nucleotide sequence The probe pair of composition.

8. diagnosis or auxiliary diagnosis Organic acidemia patient reagent or kit, including in claim 2-7 it is any The reagent set.

9. following I or II application:

I, in claim 2-7 reagent or kit described in any reagent set or claim 8 following E1)-E5) In any application:

E1) the application in preparation diagnosis or auxiliary diagnosis Organic acidemia product；

E2) the application in preparation screening or auxiliary screening Organic acidemia patient product；

E3) the application in preparation prediction Organic acidemia risk product；

E4) preparation detection and Organic acidemia related gene whether the application in mutant product；

E5) preparation detection and Organic acidemia related protein whether the application in mutant product；

II, the E1 of product described in claim 1)-E3) in any application.