CN105986015A - Method and kit for detecting one or more target sequence of multiple samples based on high-throughput sequencing - Google Patents

Abstract

The invention provides a method or a kit for capturing and labeling one or more target sequences of multiple samples based on high-throughput sequencing. A novel labeling technical scheme is provided by integrating a multiplex amplification technology, a ligation technology and a PCR-index (polymerase chain reaction-index) technology; the target sequences are amplified by virtue of specific capturing primers; by virtue of a ligation reaction, an adaptor, which is provided with a U base and has a known sequence, is introduced to each of two ends of a PCR product; the U bases are cut open by virtue of a USER enzyme; PCR primers are designed in accordance with the known sequences of the adaptors; tag primers are separately introduced to two ends of the PCR product by virtue of a PCR reaction; sample information of the PCR product can be specifically obtained by virtue of the sequences of the tag primers which are introduced to two ends of the PCR product; and then, in accordance with the sequence of the capturing primer of each of the target sequences, a corresponding sequencing result is correspondingly applied to each of the target sequences of the samples.

Description

The detection method of one or more target sequences of a kind of multisample based on high-flux sequence and kit

Technical field

The present invention relates to biological technical field, be specifically related to capture and mark the side of the target sequence of multiple sample Method and kit, particularly relate to a kind of capture based on high-flux sequence and mark one of multisample or The method of multiple target sequences or kit.

Background technology

A new generation high-flux sequence instrument appearance greatly reduce nucleic acid sequencing cost, its have high flux, The features such as low cost, order-checking error rate are low.Application second generation high throughput sequencing technologies, can be to mixing Nucleic acid molecules carries out sequencing, differentiates simultaneously and measure each independent sequence so that this sequencing technologies It is possibly realized at high flux marker development.

With extensive at aspects such as human diseases research, microbial genome order-checkings of high throughput sequencing technologies Carry out, how to play the feature such as high flux and big data quantity of second generation sequencing technologies to greatest extent, reduce Single sample order-checking cost becomes the developing direction of next step sequencing technologies, has very big market prospects and valency Value.

But, conventional PCR-index technology, the index label for each PCR primer is to need Individually to carry out amplification label, then by the mixing order-checking of all of product, when PCR fragment is more, no Only complex operation, and it is difficult to the homogeneity of control fragment mixing, fragment in final sequencing result can be caused Between data volume gap huge.

Content of the invention

It is an object of the invention to utilize high throughput sequencing technologies same to the target sequence correlated series in great amount of samples Shi Jinhang sequencing analysis, solves the problem that conventional method flux is low, order-checking cost is high, expands the second generation and surveys Sequence technology is in the application in PCR order-checking field.

For the purpose of the present invention, the present invention incorporates multiplex amplification technology, interconnection technique and PCR-index Technology, provides a kind of novel markings technical scheme, uses specific capture primer amplification target sequence (the One takes turns amplification), utilize coupled reaction respectively introduce at the two ends of first round PCR primer one band U base and Joint known to sequence, is digested out U base with USER, according to joint known array tag design primer, And utilize PCR reaction (second takes turns amplification) to take turns PCR primer two ends second and introduce Tag primer respectively Sequence, can obtain PCR specifically by the second Tag primer sequence taking turns the introducing of PCR primer two ends The sample information of product, takes turns capture primer sequence contained in amplified production further according to second and ties order-checking Fruit corresponds on each target sequence of sample.

According to an aspect of the present invention, a kind of capture based on high-flux sequence is provided and marks multiple sample The method of this one or more target sequences, comprises the following steps:

The first round expands: uses the capture primer designing according to target sequence, is being suitable to multiplex amplification purpose core Respectively the target area of each sample is expanded under conditions of acid, reclaim designed target area scope Within all DNA bands；

Second takes turns amplification: use the product that first round amplification obtains as template carry out second take turns amplification so that Second takes turns on amplified production with the label that can make a distinction each sample；

Mixing is with recovery: mix the Enrichment Amplification product of each sample equably, reclaims designed Target area within the scope of all DNA bands；

Order-checking: the DNA mixture of recovery is checked order；

Analyze: based on label unique in the amplified production of each sample, by the sequencing result of acquisition first With sample one_to_one corresponding；Capture primer sequence according to each target sequence, then sequencing result is corresponded to sample On this target sequence.

Preferably, according to an aspect of the present invention, a kind of capture based on high-flux sequence and mark are provided Remember the method for one or more target sequences of multiple sample, comprise the following steps:

The first round expands: uses the capture primer designing according to target sequence, is being suitable to multiplex amplification purpose core Respectively the target area of each sample is expanded under conditions of acid, reclaim designed target area scope Within all DNA bands, carry out end reparation to amplified production and add A tail；

Joint designs: described joint comprises two palindromic sequences, U base and 3 ' T ends, wherein, One palindromic sequence is positioned at described joint 5 ' end, is connected with another palindromic sequence by U base, its Can stably form hairpin structure；

Jointing (Adaptor): by coupled reaction at the two ends of first round amplified production plus band U The joint of base；Carry out U base shearing, and digest remaining primer with strand digestive ferment；

Tag primer designs: described Tag primer comprises sequence label and 5 ' the end palindrome with described joint The complementary sequence of sequence, wherein, described sequence label is positioned at 5 ' ends of described Tag primer, wherein, Quantity >=the sample size of the quantity × joint of sequence label；

Second takes turns amplification: use label (index) primer for joint and each sample design, with correspondence Product after sample jointing carries out Enrichment Amplification as template, and remaining with the digestion of strand digestive ferment Primer, to give the amplified production of each sample plus the Tag primer sequence that can distinguish respectively；

Mixing is with recovery: mix the Enrichment Amplification product of each sample equably, reclaims designed Target area within the scope of all DNA bands；

Order-checking: the DNA mixture of recovery is checked order；

Analyze: based on Tag primer sequence unique in the amplified production of each sample, the order-checking that will obtain Result first with sample one_to_one corresponding；Capture primer sequence according to each target sequence, then by sequencing result Correspond on each target sequence of sample.

Preferably, the invention provides a kind of capture based on high-flux sequence and mark multiple sample The method of individual or multiple target sequence, comprises the following steps:

1) primer and joint design:

First round amplimer: according to target sequence design corresponding capture primer to be measured, form the first round Amplimer combines；

Joint sequence: design one or more joint sequence, described joint comprises two palindromic sequences, U Base and 3 ' T ends, wherein, a palindromic sequence is positioned at described joint 5 ' end, by U base Being connected with another palindromic sequence, it can stably form hairpin structure；

Second takes turns amplimer: designs different sequence labels according to sample size, and adds at its 3 ' end Tag primer used by Enrichment Amplification for the upper sequence composition complementary with 5 ' end palindromic sequences of described joint, Composition second takes turns amplimer combination, wherein, due to the joint of the second target sequence two ends connection taking turns amplification Identical, the forward Tag primer for same sample is identical with reverse Tag primer, the Tag primer of design Quantity follow following rule: the quantity >=sample size of the quantity × joint of sequence label, and wherein, Take turns in amplimer second, the sequence that sequence label adds and connecing of being connected in first round amplified production 5 ' end palindromic sequences of head are complementary；

2) first round amplification (PCR capture): will amplification target sequence capture primer mix, be suitable to many Respectively each sample is expanded under conditions of the nucleic acid of re-spread gaining；Reclaim designed target area model All DNA bands within enclosing, carry out end reparation to amplified production, and by the two of amplified production End all adds A tail；

3) jointing (Adaptor): by coupled reaction at amplified production two ends plus with U base Joint, uses USER enzyme to interrupt U base, with the remaining primer of strand digestive ferment digestion；

4) second amplification (product enrichment) is taken turns: according to the Tag primer of different samples and joint design, make Product after processing with corresponding sample jointing carries out Enrichment Amplification as template, to give each sample respectively This amplimer all adds the Tag primer sequence that can distinguish；Draw with the digestion of strand digestive ferment is remaining Thing, and be purified；

5) mixing is with recovery: mix the enriched product of each sample equably；Designed by reclaiming All DNA bands within the scope of target area；

6) check order: DNA mixture is checked order；

7) analyze: based on the unique Tag primer sequence of each sample, by the sequencing result that obtains first with Sample one_to_one corresponding；Capture primer sequence according to each target sequence, then sequencing result is corresponded to sample Each target sequence on.

Preferably, in step 1, the length of described sequence label can be 5-20bp, it is highly preferred that institute The length stating sequence label can be 6-8bp；Described joint sequence comprises the palindromic sequence in two regions, Preferably, each palindromic sequence can be 8-15bp (most preferably 15bp).

Preferably, in step 2, expanding used system is high-fidelity multi-PRC reaction system, with Reduce the brought DNA mutation of amplification, and ensure that each purpose fragment can effectively be expanded；

Preferably, in step 2, PCR amplification carries out 18-20 circulation.

Preferably, in step 4, expanding used enzyme is high-fidelity DNA polymerase, thus reduces The DNA mutation rate that amplification brings.

Preferably, the end reparation in step 2, the coupled reaction institute adding in A end reaction and step 3 Being respectively Neb with reagent recommended for two generations built storehouse kitEnd Repair Module、DA-Tailing Module andQuick Ligation Module.Preferably, Strand digestive ferment used in step 3 and 4 is exonuclease I (Exonuclease I), and this enzyme is single Specific 3 ' → 5 ' exonucleases of chain, do not decompose double-stranded DNA and RNA.

Preferably, step 4 second is taken turns amplification and carried out 15-18 circulation.

Preferably, in step 6, order-checking utilizes two generation sequencing technologies, preferably pair-End technology (example Such as Illumina Hiseq2000, Illumina Hiseq2500 and Illumina Miseq) check order, obtain Obtain the sequence of DNA mixture.

On the other hand, the present invention also provides a kind of capture based on high-flux sequence and marks multiple sample The kit of one or more target sequences, wherein, described kit includes following primer:

First round amplimer: according to target sequence design corresponding capture primer to be measured, form the first round Amplimer combines；

Joint sequence: one or more joint sequences, described joint comprises two palindromic sequences, U base With 3 ' T ends, wherein, palindromic sequence is positioned at described joint 5 ' end, by U base with another One palindromic sequence connects, and it can stably form hairpin structure；And/or

Second takes turns amplimer: designs different sequence labels according to sample size, and adds at its 3 ' end Tag primer used by Enrichment Amplification for the upper sequence composition complementary with 5 ' end palindromic sequences of described joint, Composition second takes turns amplimer combination, wherein, due to the joint of the second target sequence two ends connection taking turns amplification Identical, the forward Tag primer for same sample is identical with reverse Tag primer, the Tag primer of design Quantity follow following rule: the quantity >=sample size of the quantity × joint of sequence label, and wherein, Take turns in amplimer second, the sequence that sequence label adds and connecing of being connected in first round amplified production 5 ' end palindromic sequences of head are complementary.

Preferably, in the present invention, the quantity of described sample can be: sample size≤programmable label The quantity of the quantity of sequence × programmable joint.

It is highly preferred that the present invention provides a kind of mark based on high-flux sequence and captures multiple (10) The examination of one or more (21) extron of the related ATP7B gene of the Wilson syndrome of sample Agent box, wherein said extron for selected from EXON1, EXON2, EXON3, EXON4, EXON5, EXON6、EXON7、EXON8、EXON9、EXON10、EXON11、EXON12、EXON13、 EXON14、EXON15、EXON16、EXON17、EXON18、EXON19、EXON20、 One or more in EXON21；Described kit includes following primer and joint:

It is one or more pairs of that first round amplimer includes in following:

For being connected to the joint with following sequence at first round amplified production two ends:

ADP1:5'P-AGGACAGAAGCTCGA-U-TCGAGCTTCTGTCCT-s-T-3'

ADP2:5'P-ACCTTGAGCGATCGA-U-TCGATCGCTCAAGGT-s-T-3'；

Second takes turns one or more Tag primers composition that amplimer includes in following Tag primer Primer pair, it is mutual with the 5 ' of the joint being connected in first round product end palindromic regions for wherein drawing horizontal line part The sequence mended:

ADP1A:GCTCATTCGAGCTTCTGTCCT

ADP1B:TAGCCTTCGAGCTTCTGTCCT

ADP1C:AGAGGCTCGAGCTTCTGTCCT

ADP1D:TATCCTTCGAGCTTCTGTCCT

ADP1E:CTCTGATCGAGCTTCTGTCCT

ADP2A:GCTCATTCGATCGCTCAAGGT

ADP2B:TAGCCTTCGATCGCTCAAGGT

ADP2C:AGAGGCTCGATCGCTCAAGGT

ADP2D:TATCCTTCGATCGCTCAAGGT

ADP2E:CTCTGATCGATCGCTCAAGGT

Wherein, due to second take turns amplification when, target sequence two ends connect joint identical, be used for same sample Forward Tag primer identical with reverse Tag primer.

There is advantages that

The present invention uses specific capture primer (first round amplimer) amplification target sequence, by even Connect reaction and the joint (Adaptor) with U base is connected to the two ends of target sequence amplification product, use After USER is digested out U base, drawn by using the second of sequence label+joint sequence composition to take turns amplification Thing expands, and finally the 5` end in PCR primer with the addition of Tag primer sequence.By to each sample This all introduces the Tag primer sequence of uniqueness, when second generation high throughput sequencing technologies detects, each sample Sequencing result can be given for change by the Tag primer sequence of its uniqueness, catching further according to each target sequence Obtaining primer sequence and corresponding to sequencing result on each target sequence of sample, therefore, the present invention can apply In the multiple different genes sites detecting great amount of samples simultaneously, greatly reduce order-checking cost.

Brief description

Fig. 1 is the capture of the present invention and the schematic diagram of method of target sequence marking multiple sample.

Detailed description of the invention

Now will be described in further details the present invention, embodiment is only limitted to the present invention is described in conjunction with the embodiments, Rather than limitation of the invention.

Equipment used in following example and reagent are as follows:End Repair Module、DA-Tailing Module andQuick Ligation Module, Exonucleolytic Enzyme Takara (Exonuclease I (E.coli)).

Embodiment 1

Wilson syndrome is related to 21 extrons of ATP7B gene (NCBI Gene ID:540) (EXON1、EXON2、EXON3、EXON4、EXON5、EXON6、EXON7、EXON8、 EXON9、EXON10、EXON11、EXON12、EXON13、EXON14、EXON15、 EXON16, EXON17, EXON18, EXON19, EXON20 and EXON21) order-checking, altogether 10 case clinical samples:

1) primer and joint design:

21 extrons for ATP7B gene separately design corresponding capture primer, relevant parameter: Tm value 58.0 DEG C-65.0 DEG C, GC value 40.0%-60.0%, primer size 23 ± 3bp, purpose piece Duan great little is 150-300bp, and designed primer is as follows:

According to 2 joints of 10 sample designs, joint is single stranded DNA, comprises two regions in sequence The palindromic sequence of (each zone length is 15bp), a U base and 3 ' T ends, can form steady Fixed hairpin structure, designed joint sequence is as follows:

ADP1:5'P-AGGACAGAAGCTCGA-U-TCGAGCTTCTGTCCT-s-T-3'

ADP2:5'P-ACCTTGAGCGATCGA-U-TCGATCGCTCAAGGT-s-T-3'

According to following rule tag design primer: Tag primer comprises sequence label and the 5 ' ends with joint The complementary sequence of palindromic sequence, wherein, the quantity >=sample size of the quantity × joint sequence of sequence label, In the present embodiment, according to 10 samples and 2 joints design 10 strip label primers, i.e. with connect 5 ' ends of the sequence of 5 ' end palindromic sequences complementations of head are plus sequence label (6bp) structure that can distinguish Become Tag primer, wherein, owing to second takes turns the target sequence of amplification (after first round amplified production jointing Product) palindromic sequence of joint that connects of two ends is identical, for same sample forward Tag primer and Reverse Tag primer is identical.Designed Tag primer is as follows, wherein draws horizontal line part for producing with the first round The sequence of 5 ' end palindromic regions complementations of the joint connecting in thing:

ADP1A:GCTCATTCGAGCTTCTGTCCT

ADP1B:TAGCCTTCGAGCTTCTGTCCT

ADP1C:AGAGGCTCGAGCTTCTGTCCT

ADP1D:TATCCTTCGAGCTTCTGTCCT

ADP1E:CTCTGATCGAGCTTCTGTCCT

ADP2A:GCTCATTCGATCGCTCAAGGT

ADP2B:TAGCCTTCGATCGCTCAAGGT

ADP2C:AGAGGCTCGATCGCTCAAGGT

ADP2D:TATCCTTCGATCGCTCAAGGT

ADP2E:CTCTGATCGATCGCTCAAGGT

2) first round amplification (PCR capture):

The every pair of capture primer individually debug qualified after, be respectively directed to each clinical sample, by the 21 pairs of primers respectively It is diluted to 100 μM, then mixed in equal amounts, expand by following system and condition:

Reactive component	50μL
		Multiplex amplification PCR premixed liquid (Multiplex PCR Mix)	25
GC strengthens buffer solution (GC Enhance)	3
		Primer mixed liquor (Primer Mix)	1.25
Template (10ng/ul)	2
		H2O	18.75

Reaction condition:

95 DEG C 10 minutes；

95 DEG C 30 seconds；58 DEG C 5 minutes (20 circulations)；

72 DEG C 7 minutes.

Product reclaims: cut all DNA bands within the scope of glue reclaims designed target area (150-300bp)。

End is repaired: carry out end reparation to above-mentioned recovery product according to following reaction system and condition:

Reaction condition:

20℃30min

65℃20min

Products therefrom is carried out post purifying, final 50 μ L wash-outs.

Add A tail: add A tail to above-mentioned product fragment 3 ' end according to following reaction system and condition:

Reactive component	50μL
		NEBNext adds A reaction buffer (NEBNext dA-Tailing Reaction Buffer) (10 ×)	5
Klenow Fragment enzyme (Klenow Fragment (3 ' → 5 ' exo))	3
		Purified product	42

Reaction condition: 37 DEG C of 30min, 65 DEG C of 20min.

Products therefrom is carried out post purifying, final 30 μ L wash-outs.

3) jointing

Coupled reaction: add joint at above-mentioned product fragment two ends according to following reaction system and condition:

Reaction condition: 20 DEG C of 15min, 12 DEG C of 30min, 65 DEG C of 10min.

Wherein, take turns in amplification Tag primer used second, hold, with sequence label 3 ', the sequence being connected The sequence of 5 ' end palindromic sequences complementations of the joint being and being connected in first round amplified production, each sample The joint that connects in first round product and take turns amplification Tag primer used as shown in following table one second.

USER enzyme and Exonuclease I enzymic digestion: in above-mentioned system, add 1 μ L USER enzyme, 37 DEG C Reaction 30min, cutting the U base in joint, is subsequently adding 1 μ L Exonuclease I enzyme, 37 DEG C Reaction 30min is with the primer strand of residual in digestion system.Carry out post purifying to products therefrom, finally 50 μ L wash-outs.

4) second take turns amplification (product enrichment) and use the above-mentioned Tag primer designing according to sample and joint, Product after processing using corresponding sample jointing carries out Enrichment Amplification as template, to give each sample respectively This amplified production adds the Tag primer sequence that can distinguish, and reaction system and condition are as follows:

Reactive component	50μL
		2 × PCR premixed liquid (2 × PCR Mix)	25
Index primer (100 μM)	1
		Taq polymerase (Taq polymerse)	1

Template

23

Reaction condition: 95 DEG C of 10min；95 DEG C of 1min, 50 DEG C of 5min, (15-18 is individual for 72 DEG C of 1min Circulation)；

Wherein, the joint and the second Tag primer taken turns used in product that connect in first round product are as follows Shown in table one:

Table one

Sample number	Joint	Tag primer
			1#	ADP1	ADP1A
2#	ADP1	ADP1B
			3#	ADP1	ADP1C
4#	ADP1	ADP1D
			5#	ADP1	ADP1E
6#	ADP2	ADP2A
			7#	ADP2	ADP2B
8#	ADP2	ADP2C
			9#	ADP2	ADP2D
10#	ADP2	ADP2E

Primer digestion and product reclaim: the remaining primer of amplified production strand digestive ferment digestion, and carry out Purify, all DNA bands within the scope of the designed target area of recovery；

5) mixing with reclaim: by for each clinical sample with the second of flag sequence take turns PCR amplification Product is according to homogeneous the mixing of concentration, owning within the scope of the designed target area of recovery DNA band；

6) checking order: the DNA mixture that will reclaim, using Illumina Miseq, PE300 checks order, Obtain the sequence of DNA mixture.

7) analyze: the sequencing result of Illumina Miseq product is a series of DNA sequence dnas, by looking into Look for the Tag primer sequence (group of joint sequence and sequence label that in sequencing result, 10 samples are each unique Close), by obtain sequencing result first with sample one_to_one corresponding, the then capture according to 21 extrons Primer sequence, then sequencing result is corresponded on each target sequence of sample.All of 10 samples 21 extrons can find corresponding data, each sample corresponding reads number in sequencing result As shown in following table two, between 10 samples, reads number difference is maximum at about 3 times, 21 extron sequences Arrange corresponding reads difference maximum about 10 times (data see table three, as a example by 1-2# sample), Show that our multisample labeling method can effectively distinguish the corresponding DNA sequence dna of each label.

Each sample of table two corresponding reads number and GC number

The corresponding reads number of 3 21 exon sequences of table (as a example by 1-2# sample)

	1#	2#
			Exon 1	14231	10272
Exon 2	9831	6098
			Exon3	17246	11428
Exon 4	13888	9649
			Exon 5	25132	16094
Exon 6	8032	10857
			Exon 7	16989	8565
Exon 8	7564	5826
			Exon 9	15789	20667
Exon 10	13476	10758
			Exon 11	17428	12633
Exon 12	13085	9964
			Exon 13	15714	7234
Exon 14	10857	8574
			Exon 15	11428	9771
Exon 16	13308	10034
			Exon 17	18571	11241
Exon 18	14330	12571
			Exon 19	10094	8143
Exon 20	22455	13215
			Exon 21	11500	10428
Amount to	300,948	224,022

Claims (10)

1. the capture based on high-flux sequence and the side of one or more target sequences marking multiple sample Method, comprises the following steps:

The first round expands: uses the capture primer designing according to target sequence, is being suitable to multiplex amplification purpose core Respectively the target area of each sample is expanded under conditions of acid, reclaim designed target area scope Within all DNA bands；

Second takes turns amplification: use the product that first round amplification obtains as template carry out second take turns amplification so that Second takes turns on amplified production with the label that can make a distinction each sample；

Mixing is with recovery: mix the Enrichment Amplification product of each sample equably, reclaims designed Target area within the scope of all DNA bands；

Order-checking: the DNA mixture of recovery is checked order；

Analyze: based on label unique in the amplified production of each sample, by the sequencing result of acquisition first With sample one_to_one corresponding；Capture primer sequence according to each target sequence, then sequencing result is corresponded to sample On this each target sequence.

2. the capture based on high-flux sequence and the side of one or more target sequences marking multiple sample Method, comprises the following steps:

The first round expands: uses the capture primer designing according to target sequence, is being suitable to multiplex amplification purpose core Respectively the target area of each sample is expanded under conditions of acid, reclaim designed target area scope Within all DNA bands, carry out end reparation to amplified production and add A tail；

Joint designs: described joint comprises two palindromic sequences, U base and 3 ' T ends, wherein, One palindromic sequence is positioned at described joint 5 ' end, is connected with another palindromic sequence by U base, its Can stably form hairpin structure；

Jointing: by coupled reaction at the two ends of first round amplified production plus the joint with U base； Carry out U base shearing, and digest remaining primer with strand digestive ferment；

Tag primer designs: described Tag primer comprises sequence label and 5 ' the end palindrome with described joint The complementary sequence of sequence, wherein, described sequence label is positioned at 5 ' ends of described Tag primer, wherein, Quantity >=the sample size of the quantity × joint of sequence label；

Second takes turns amplification: use the Tag primer for joint and each sample design, connects with corresponding sample Product after joint carries out Enrichment Amplification as template, and digests remaining primer with strand digestive ferment, with Give the amplified production of each sample plus the Tag primer sequence that can distinguish respectively；

Mixing is with recovery: mix the Enrichment Amplification product of each sample equably, reclaims designed Target area within the scope of all DNA bands；

Order-checking: the DNA mixture of recovery is checked order；

Analyze: based on Tag primer sequence unique in the amplified production of each sample, the order-checking that will obtain Result first with sample one_to_one corresponding；Capture primer sequence according to each target sequence, then by sequencing result Correspond on the target sequence of sample.

3. the capture based on high-flux sequence and the side of one or more target sequences marking multiple sample Method, comprises the following steps:

1) primer and joint design:

First round amplimer: according to target sequence design corresponding capture primer to be measured, form the first round Amplimer combines；

Joint sequence: design one or more joint sequence, described joint comprises two palindromic sequences, U Base and 3 ' T ends, wherein, a palindromic sequence is positioned at described joint 5 ' end, by U base Being connected with another palindromic sequence, it can stably form hairpin structure；

Second takes turns amplimer: designs different sequence labels according to sample size, and adds at its 3 ' end Tag primer used by Enrichment Amplification for the upper sequence composition complementary with 5 ' end palindromic sequences of described joint, Composition second takes turns amplimer combination, wherein, due to the joint of the second target sequence two ends connection taking turns amplification Identical, the forward Tag primer for same sample is identical with reverse Tag primer, the Tag primer of design Quantity follow following rule: the quantity >=sample size of the quantity × joint of sequence label, and wherein, Take turns in amplimer second, the sequence that sequence label adds and connecing of being connected in first round amplified production 5 ' end palindromic sequences of head are complementary；

2) first round amplification: by the capture primer mixing of amplification target sequence, be suitable to multiplex amplification purpose core Respectively each sample is expanded under conditions of acid；Owning within the scope of the target area designed by reclaiming DNA band, carries out end reparation, and the two of amplified production ends is all added A to amplified production Tail；

3) jointing (Adaptor): by coupled reaction at amplified production two ends plus with U base Joint, uses USER enzyme to interrupt U base, with the remaining primer of strand digestive ferment digestion；

4) second amplification is taken turns: according to the Tag primer of different samples and joint design, use corresponding sample even Product after joint is processed carries out Enrichment Amplification as template, to give the amplimer of each sample respectively All add the Tag primer sequence that can distinguish；Digest remaining primer with strand digestive ferment, and carry out pure Change；

5) mixing is with recovery: mix the enriched product of each sample equably；Designed by reclaiming All DNA bands within the scope of target area；

6) check order: DNA mixture is checked order；

7) analyze: based on the unique Tag primer sequence of each sample, by the sequencing result that obtains first with Sample one_to_one corresponding；Capture primer sequence according to each target sequence, then sequencing result is corresponded to sample Target sequence on.

4. according to the method in claim 2 or 3, wherein, a length of 5-20bp of described sequence label, Preferably, a length of 6-8bp of described sequence label；Described joint comprises the palindrome sequence in two regions Row, each palindromic sequence is 8-15bp, most preferably 15bp.

5. according to the method in claim 2 or 3, wherein, the used system of first round amplification is High-fidelity multi-PRC reaction system；Second to take turns the enzyme that amplification used be high-fidelity DNA polymerase, Described strand digestive ferment is exonuclease I.

6. according to the method in claim 2 or 3, wherein, first round amplification carries out 18-20 and follows Ring, second takes turns amplification carries out 15-18 circulation.

7. according to the method in claim 2 or 3, wherein, end reparation, add A end reaction with And coupled reaction agents useful for same is respectively Neb and recommended for two generations built storehouse kitEnd Repair Module、DA-Tailing Module andQuick Ligation Module。

8. according to the method in claim 2 or 3, wherein, order-checking utilizes two generation sequencing technologies, excellent Choosing is pair-End technology (such as Illumina Hiseq2000, Illumina Hiseq2500 and Illumina Miseq) check order, it is thus achieved that the sequence of DNA mixture.

9. the capture based on high-flux sequence and the examination of one or more target sequences marking multiple sample Agent box, wherein, described kit includes following primer and joint:

First round amplimer: according to target sequence design corresponding capture primer to be measured, form the first round Amplimer combines；

Joint sequence: one or more joint sequences, described joint comprises two palindromic sequences, U base With 3 ' T ends, wherein, palindromic sequence is positioned at described joint 5 ' end, by U base with another One palindromic sequence connects, and it can stably form hairpin structure；And/or

Second takes turns amplimer: designs different sequence labels according to sample size, and adds at its 3 ' end Tag primer used by Enrichment Amplification for the upper sequence composition complementary with 5 ' end palindromic sequences of described joint, Composition second takes turns amplimer combination, wherein, due to the joint of the second target sequence two ends connection taking turns amplification Identical, the forward Tag primer for same sample is identical with reverse Tag primer, the Tag primer of design Quantity follow following rule: the quantity >=sample size of the quantity × joint of sequence label, and wherein, Take turns in amplimer second, the sequence that sequence label adds and connecing of being connected in first round amplified production 5 ' end palindromic sequences of head are complementary.

10. one kind related with the Wilson syndrome capturing multiple sample based on the mark of high-flux sequence The kit of one or more extrons of ATP7B gene, wherein said extron for selected from EXON1, EXON2、EXON3、EXON4、EXON5、EXON6、EXON7、EXON8、EXON9、 EXON10、EXON11、EXON12、EXON13、EXON14、EXON15、EXON16、 One or more in EXON17, EXON18, EXON19, EXON20, EXON21；Described Kit includes following primer and joint:

It is one or more pairs of that first round amplimer includes in following:

E1-F CTTCCCCGGTCCCAAATGAAG

E1-R CCTCCTGGTGGGAGTGAGCAC

E2-F TGCCAGAGAAGCTGGGATGTTG

E2-R GCAAACCTGTTGCAGGCACAC

E3-F GAGCCCTGAAACCTCTTGTTCTG

E3-R CGAGGTCTATACGCAGCATTCCT

E4-F GCCCTGCCCACCCAGAGTG

E4-R CAAAGATGGATGTGTCCAAAATGC

E5-F CTGGCTTTCACAGGCTTTCCT

E5-R TTACTTACCTCAATAATTTTGATAATATCC

E6-F CTGCCAATGCATATTTTAACCAAGT

E6-R GAAGGGACTTAGATGAGAGCTGGAG

E7-F AATCCAGGTGACAAGCAGCATC

E7-R GCATGGAAGGGAGAGGTCTGC

E8-F ACTTGCTGGCAGCCTTCACTG

E8-R GATTTGTTTACTGAAGGAGCAGCTC

E9-F CGATAGCTCTCATTTCACATTCTGG

E9-R CACACAGATTGATAGATACCAACCAC

E10-F TGACCCGGTGACCGAATGAGT

E10-R ATGATATCCTCCTGAGGGAACATG

E11-F CAAGTGACAGTTGTCTCTTTCCTACG

E11-R TTCCCAGAACTCTTCACATAATTTCT

E12-F CCATGGTCTTGGTGTTTTATTTTC

E12-R TGAAAGAACAGGATCAATGTCAGTAG

E13-F TGGGAGCTTCCTTATTGAACTCTC

E13-R CATCTCTCAGGATGGGGAAAGC

E14-F CCTCCATCTGTATTGTGGTCAGTG

E14-R GGTGAGGAATAAAAGAGCATTGGC

E15-F TCTTGGCTTACAGTTTCCTCTTCC

E15-R CGTGGTGCTCTCTGTGGTTTGA

E16-F GGACCATTTAGAAATAACCACAGCC

E16-R TTTGCCTGATATCTGCAGAAAACTG

E17-F CCAACTTGTGTAGCTGCTGATGC

E17-R TGGTGCTTACTTTTGTCTCTAACTGC

E1819-F TGATACCTTTTGCCAACACTAGGC

E1819-R TGGGAGACAGAAGCCTTTCTGG

E20F TGGCTCCTCTCCCCAGACCTA

E20-R ACTGTGCTAAGCATGCAGAATGAC

E21-F GAGAGGCCTTCACCAGGCTTAG

E21-R GCCTGCCTGAAGTCATCAGATG

For being connected to the joint with following sequence at first round amplified production two ends:

ADP1:5'P-AGGACAGAAGCTCGA-U-TCGAGCTTCTGTCCT-s-T-3'

ADP2:5'P-ACCTTGAGCGATCGA-U-TCGATCGCTCAAGGT-s-T-3'；

Second takes turns one or more Tag primers composition that amplimer includes in following Tag primer Primer pair, it is mutual with the 5 ' of the joint being connected in first round product end palindromic regions for wherein drawing horizontal line part The sequence mended:

ADP1A:GCTCATTCGAGCTTCTGTCCT

ADP1B:TAGCCTTCGAGCTTCTGTCCT

ADP1C:AGAGGCTCGAGCTTCTGTCCT

ADP1D:TATCCTTCGAGCTTCTGTCCT

ADP1E:CTCTGATCGAGCTTCTGTCCT

ADP2A:GCTCATTCGATCGCTCAAGGT

ADP2B:TAGCCTTCGATCGCTCAAGGT

ADP2C:AGAGGCTCGATCGCTCAAGGT

ADP2D:TATCCTTCGATCGCTCAAGGT

ADP2E:CTCTGATCGATCGCTCAAGGT

Wherein, due to second take turns amplification when, target sequence two ends connect joint identical, be used for same sample Forward Tag primer identical with reverse Tag primer.