CN111118127B - Specific tag error-proofing kit for second-generation DNA sequencing sample - Google Patents

Abstract

The invention discloses a specific tag error-proofing kit for a second-generation DNA sequencing sample, which comprises ten groups of DNA sequences and a pair of specific primers, wherein: ten sets of DNA sequences include SEQ ID 1, SEQ ID 2, SEQ ID3, SEQ ID 4, SEQ ID 5, SEQ ID 6, SEQ ID 7, SEQ ID 8, SEQ ID 9 and SEQ ID 10; the ten groups of DNA sequences respectively add TTCATTAGACTTCAGCCAAAC specific recognition sequences at the 5 'end of the sequences as specific tags, and add CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTG specific recognition sequences at the 3' end as specific tags to form 10 groups of specific DNA sequences; a pair of specific primer designs such as PMPrimer1 (upstream primer) and PMPrimer2 (downstream primer), the kit further comprising: 2 ng/. Mu.l of error-proofing specific DNA sequence; 2 μl of RNase inhibitor; a pair of specific primers 2 ng/. Mu.l; nuclease free deionized water 5 μl. According to the invention, the sequence of the non-human rare species is used as the tag DNA to be added into the whole sequencing experiment system, and the sample participates in the whole process of second generation sequencing, so that the sequence of the detection object is checked, and the method has the advantages of low cost, convenience in operation and high precision.

Description

Specific tag error-proofing kit for second-generation DNA sequencing sample

Technical Field

The invention relates to the technical field of bioengineering, in particular to a specific tag error proofing kit for a second-generation DNA sequencing sample.

Background

The second generation DNA sequencing technology has a plurality of steps in clinical application, including steps of blood taking, nucleic acid extraction, DNA fragmentation, library construction, capturing and biological information, and a large number of samples are transferred in the whole sequencing process, and sample pollution and sample mixing can occur in any part. The set of sample accuracy label system which can be monitored in real time is simple and convenient, the laboratory cost can be saved to the greatest extent, and the accuracy of data is ensured. In addition, the existing second-generation DNA sequencing has a longer time period, samples in the process are monitored in real time, repeated sequencing after experimental errors can be saved, and monitoring can be implemented on pollution control conditions of the samples in the sequencing process.

Based on the SNP typing method, the same sample is divided into two parts to carry out various sequencing experiments, and effective label error prevention monitoring is very necessary for controlling the mismatching cost of the experimental samples.

Disclosure of Invention

In order to solve the existing problems, the invention provides a specific tag error-proofing kit for a second-generation DNA sequencing sample. The invention is realized by the following technical scheme.

A specific tag error proofing kit for a second generation DNA sequencing sample, the kit comprising ten sets of DNA sequences and a pair of specific primers, wherein:

the ten groups of DNA sequences comprise SEQ ID 1, SEQ ID 2, SEQ ID3, SEQ ID 4, SEQ ID 5, SEQ ID 6, SEQ ID 7, SEQ ID 8, SEQ ID 9 and SEQ ID 10;

the ten groups of DNA sequences are respectively provided with TTCATTAGACTTCAGCCAAAC specific recognition sequences at the 5 'end of the sequences as specific tags and CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTG specific recognition sequences at the 3' end as specific tags to form 10 groups of specific DNA sequences;

a pair of specific primer designs such as PMPrimer1 (upstream primer) and PMPrimer2 (downstream primer),

wherein the upstream primer sequence is: 5'-TTCATTAGACTTCAGCCAAAC-3' the number of the individual pieces of the plastic,

the downstream primer sequences were: 5'-CACCGACTGCCCATAGAG-3'.

Preferably, the ten groups of DNA sequences adopt a gene synthesis mode, and are subjected to ultralow temperature freeze-drying preservation after being linked with specific tag sequences.

Preferably, the kit further comprises:

2 ng/. Mu.l of error-proofing specific DNA sequence;

2 μl of RNase inhibitor;

a pair of specific primers 2 ng/. Mu.l;

nuclease free deionized water 5 μl.

The application method of the specific tag error-proofing kit for the second-generation DNA sequencing sample comprises the following steps:

step one: lysing the cells and extracting the nucleic acid;

step two: constructing a DNA library;

step three: and adding the specific label error-proofing kit to perform library capturing, comparing the added error-proofing specific DNA sequence with the primer, and comparing the overall capturing efficiency.

The invention has the beneficial effects that:

the specific tag error-proofing kit for the second-generation DNA sequencing sample adopts the Antarctic nematode plectru murrayi genome sequence which completes the whole genome sequencing as a specific DNA sequence tag for the first time, and uses a non-human rare species sequence as a tag DNA to be added into the whole sequencing experiment system, and the sample participates in the whole process of the second-generation sequencing to verify the corresponding detection object sequence, so that the cost is low, the operation is convenient, and the accurate control of the sample tag can be realized.

In addition, the invention creatively designs a pair of specific recognition sequences as specific labels and specific primers, and realizes real-time sample label detection by using a simple PCR technology in the labeling process without affecting the capturing efficiency of a sequencing object.

Drawings

FIG. 1 is a schematic diagram of the specific tag synthesis process of a second generation DNA sequencing sample of the present invention;

FIG. 2 is a schematic diagram showing the detection results of the specific tag error-proofing kit for a second generation DNA sequencing sample of the present invention.

Detailed Description

The technical scheme of the invention is more fully described in detail below with reference to the accompanying drawings and specific embodiments.

Example 1

Using the genome sequence of rare Antarctic nematode plelus murryai (LZQM01000002.1 plelus murrayi isolate PM 201648) as a sequence selection library, performing differential alignment with human genes, selecting 10 groups of specific DNA sequences, wherein ten groups of DNA sequences comprise SEQ ID 1, SEQ ID 2, SEQ ID3, SEQ ID 4, SEQ ID 5, SEQ ID 6, SEQ ID 7, SEQ ID 8, SEQ ID 9 and SEQ ID 10; the detail of each group of DNA sequences is shown in sequence tables 1-10.

The ten groups of DNA sequences are respectively added with TTCATTAGACTTCAGCCAAAC specific recognition sequences at the 5 'end of the sequences as specific tags and CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTG specific recognition sequences at the 3' end as specific tags to form 10 groups of specific DNA sequences.

1.1 Synthesis of specific tag DNA sequences

Adopting a total gene synthesis mode, linking specific fragments with corresponding sequences, and entrusting the total gene synthesis company to synthesize the specific fragments;

10 sets of tag sequences were constructed, sequenced, sequence accuracy was determined, and the synthesis procedure is shown in FIG. 1.

1.2 primer design and Synthesis

Specific primers were as follows:

an upstream primer: 5'-TTCATTAGACTTCAGCCAAAC-3'

A downstream primer: 5'-CACCGACTGCCCATAGAG-3'

1.3 Using method of error proofing kit

A.10 groups of specific DNA tag sequences are marked according to the number 1-10, the concentration is 2 ng/. Mu.l, and the two groups are combined;

B. the primers were diluted to 25 ng/. Mu.l with 10mM TE buffer and then mixed with pairs of specific DNA tag sequences to 1 ng/. Mu.l (-20 degree preservation);

sequencing subject whole blood DNA extraction was completed by QIAGEN (DY 10) whole blood extraction kit, as follows:

(1) Adding 0.5ml of blood sample into 2ml of centrifuge tubes, and adding a magnetic bead with the average diameter of 5mm into each centrifuge tube;

(2) Adding cell lysate (Buffer ATL) in equal proportion;

(3) Placing the centrifuge tube into a cell lysis instrument, and carrying out 15Hz lysis for 20s;

(3) DNA purification was performed.

C. Adding the specific tag combination into the extracted DNA, and when adding the tag, needing to be confirmed and recorded by two persons;

D. sequencing by a warehouse building and on-machine;

E. and collecting the off-machine data and performing belief analysis.

The using method of the error-proofing label kit comprises the following steps:

after adding the specific misplaced tag, any one of the steps (C-E) may be performed:

specific primers were added and PCR amplification was performed according to the reaction system shown in FIG. 2. And (3) detecting the PCR product by gel electrophoresis, observing the specific sequence label combination corresponding to the strip position, and judging whether the sample is correct or not, as shown in figure 2.

It will be apparent that the described embodiments are only individual embodiments of the invention, and not all embodiments. All other implementations, which can be made by those skilled in the art without the benefit of the teachings of this invention, are intended to be within the scope of this invention.

Sequence listing

<110> Zhengzhou Sang Lin Biotechnology Co., ltd., university of Zhengzhou

<120> specific tag error proofing kit for second generation DNA sequencing sample

<130> 2019

<141> 2019-12-28

<160> 10

<170> SIPOSequenceListing 1.0

<210> 11

<211> 75

<212> DNA

<213> Antarctic nematodes (. Plelus murryai)

<400> 11

aaaatagcaa tcacagtgct gcacgctagc ggtgtgggcg acattagaag caagaagtca 60

gaaagaaaaa taaaa 75

<210> 11

<211> 100

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

aactggtgac cagctgatga ccggttacat taattagccg ctgttgtttc tatggatctt 60

ttggctctat ggaccttttg accggaatcc ccaagatacc 100

<210> 11

<211> 125

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

ccgaacacga gcaaagccgt ttccacttta ccaatctctc cccagttcta acgagagaaa 60

atgaataaca ggtttctttc gatgagatga aacgacgtaa gtagaagcaa ctggagtaaa 120

ttcag 125

<210> 11

<211> 150

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

accagattta cgagttccgg gcctaatcag atacgataac acaaggctaa tgaaagacta 60

ttttgtgcaa attatcatct ccagccaagt tcctgcaatt acggttgaaa taatattttg 120

gacatatatt caaaattttg ctaaaaatca 150

<210> 11

<211> 175

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

cacacttgct caacagtaga caccgatgga ataagtagac agcatccgtg ataactttct 60

cctgcacgag tcttgcaaat cgaacttatt acacctttta gctgtcattg agttctcaga 120

acttgccaaa tttaaaaaaa aactgaccat tcgctggaaa ctcacagcaa cgcat 175

<210> 11

<211> 200

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

ccgacgtggt cattttgaac tgcgaaaaat agtacgaccg gtcgtactat tagaatatat 60

acggtatata gttatccact tccaggggga caatatataa cttgaccccc ccctgattac 120

aggtatgctt ccgcaggtta tgaaaattct atttaatctt gtctaatgta tcacacattt 180

tgtgataaat gattacaaaa 200

<210> 11

<211> 225

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

acaatattga gcagtggtgt caaaatttta aaactgtgga cgtgatggcg cactcccttt 60

taactggtga ccagctgatg accggttaca ttaattagcc gctgttgttt ctatggatct 120

tttggctcta tggacctttt gaccggaatc cccaagatac cgacgtcaga taattagtta 180

attaaataac acgttgatcc gcaagtgcca cctgtcacgc cgtct 225

<210> 11

<211> 250

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

ttcgcagagt tatggactga acagtcgagt gatgtgcgat tttcgtcaaa tcgtccgttt 60

ttttaatcga ccataacttc agcggaaggt aacggcagag gaaggtccgt tcgagctgag 120

cttggaagat tataagacag catttcaatc tctacaacac tgcattagtc gcaaaataat 180

ctgtgattca ccccggaatc tttcaacttg atcggatgaa aactgttgga tctgcagcga 240

tttaatcata 250

<210> 11

<211> 275

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

aggaaaaaat ttctaccaaa atattcgtac tgggagtggg gtgattgtcg aagctgtcgt 60

attcattaga cttcagccaa acagctgcga gagagcagcg atatgtttgt gttccattca 120

ataagcaact caatgcaatg aaaaagcaca cacttgctca acagtagaca ccgatggaat 180

aagtagacag catccgtgat aactttctcc tgcacgagtc ttgcaaatcg aacttattac 240

accttttagc tgtcattgag ttctcagaac ttgcc 275

<210> 11

<211> 298

<212> DNA

<213> Antarctic nematode plelus murryai (Antarctic nematode)

<400> 11

agctgcgaga gagcagcgat atgtttgtgt tccattcaat aagcaactca atgcaatgaa 60

aaagcacaca cttgctcaac agtagacacc gatggaataa gtagacagca tccgtgataa 120

ctttctcctg cacgagtctt gcaaatcgaa cttattacac cttttagctg tcattgagtt 180

ctcagaactt gccaaattta aaaaaaaact gaccattcgc tggaaactca cagcaacgca 240

tattaccttg taggatcaaa aaagtggtcg aaaaaccgat tttttgccca aaaactca 298

Claims (4)

1. The specific tag error-proofing kit for the second-generation DNA sequencing sample is characterized in that: the kit comprises ten groups of DNA sequences and a pair of specific primers, wherein:

the ten groups of DNA sequences comprise SEQ ID NO1, SEQ ID NO2, SEQ ID NO3, SEQ ID NO4, SEQ ID NO5, SEQ ID NO6, SEQ ID NO7, SEQ ID NO8, SEQ ID NO9 and SEQ ID NO10;

the ten groups of DNA sequences are respectively provided with TTCATTAGACTTCAGCCAAAC specific recognition sequences at the 5 'end of the sequences as specific tags and CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTG specific recognition sequences at the 3' end as specific tags to form 10 groups of specific DNA sequences;

a pair of specific primer designs such as PMPrimer1 (upstream primer) and PMPrimer2 (downstream primer);

wherein the upstream primer sequence is: 5'-TTCATTAGACTTCAGCCAAAC-3' the number of the individual pieces of the plastic,

the downstream primer sequences were: 5'-CACCGACTGCCCATAGAG-3'.

2. The second generation DNA sequencing sample specific tag error proofing kit of claim 1, wherein: the ten groups of DNA sequences adopt a gene synthesis mode, and are subjected to ultralow temperature freeze-drying preservation after being linked with specific tag sequences.

3. The second generation DNA sequencing sample specific tag error proofing kit of claim 1, wherein: the kit further comprises:

2 ng/. Mu.l of error-proofing specific DNA sequence;

2 μl of RNase inhibitor;

a pair of specific primers 2 ng/. Mu.l;

nuclease free deionized water 5 μl.

4. A method of using the specific tag error-proofing kit of a second generation DNA sequencing sample of any one of claims 1-3, characterized in that: the method comprises the following steps:

step one: lysing the cells and extracting the nucleic acid;

step two: constructing a DNA library;

step three: and adding the specific label error-proofing kit to perform library capturing, comparing the added error-proofing specific DNA sequence with the primer, and comparing the overall capturing efficiency.

Images