KR20150090352A

KR20150090352A - Method of collecting nucleic acid fragments separated from the sequencing process

Info

Publication number: KR20150090352A
Application number: KR1020140010407A
Authority: KR
Inventors: 방두희; 박상언; 임현섭; 한효준
Original assignee: 연세대학교 산학협력단
Priority date: 2014-01-28
Filing date: 2014-01-28
Publication date: 2015-08-06
Also published as: WO2015115768A1; KR101648252B1

Abstract

The present invention relates to a method for collecting nucleic acid fragments separated during sequencing process by amplifying the fragments wherein the method is able to increase the recovery efficiency of desired nucleic acid fragments by effectively downsizing a DNA library. A process of the method comprises: collecting single-stranded nucleic acid fragments separated during sequencing; amplifying the collected single-stranded nucleic acid fragments; and collecting the amplified nucleic acid fragments.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for recovering nucleic acid fragments isolated from a nucleic acid sequence,

The techniques disclosed herein relate to methods for recovering isolated nucleic acid fragments in sequencing.

As biotechnology advances, the importance of ultra-fast, super-parallel DNA (Deoxyribo Nucleic Acid) synthesis and analysis technology is growing. In the 20th century, the development of next-generation sequencing has led to ultra-fast, superparallel DNA analysis. Along with the development of new analytical methods, we have made remarkable progress in reducing the time required for analysis and increasing the amount of data that can be analyzed. Currently, next-generation base analysis methods such as Illumina, Roche-454, and Ion-Torrent are used to link the DNA libraries to be analyzed on a solid phase, Based on the base sequence is analyzed. Recently, as gene synthesis technology has been developed and its application range has been increased, the development of super fast and super parallel gene synthesis technology is also increasing in importance. A prerequisite for super-parallel gene synthesis is the synthesis of gene libraries. Conventional gene synthesis methods have limitations on the synthesis of ultra-fast and superparallel sequences of gene libraries, but synthesis of gene libraries has become possible using the recently developed 'Shotgun DNA Synthesis' method.

Previously, nucleic acid fragments analyzed by the next-generation base analysis method were only able to acquire the nucleotide sequence information, and it was very difficult to recover the nucleic acid fragments themselves. Recently, after the next-generation base analysis, Was developed. The first method is to map the information of each well of the plate for analysis and the analyzed nucleotide sequence information after the analysis of the next generation nucleotide, (high-fidelity gene synthesis by retrieval of sequence-verified DNA identified using high-throughput pyrosequencing, 2010 Nature Biotechnology, Mark Matzas et al). The second method involves linking a barcode sequence to a DNA library obtained from an organism or artificially synthesized, and analyzing a portion of the DNA pool using next-generation sequencing ('Shotgun DNA synthesis' for the high-throughput construction of large DNA molecules, 2012 Nucleic Acids Research, Kim et al.). Then, the desired nucleic acid fragment is selectively amplified from the remaining DNA pool using a primer containing a bar code sequence. These methods have the advantage of being able to selectively recover the nucleic acid fragments for which the nucleotide sequence has been confirmed using the next generation sequencing method.

However, the method of picking beads has a disadvantage in that an expensive apparatus necessary for bead picking is required. In addition, the method of recovering a nucleic acid fragment using a barcode sequence has a limitation in recovering a desired nucleic acid fragment because of the size of the large DNA library when a population of artificially synthesized DNA library obtained from an organism is very large . For example, if hundreds of genes are synthesized at the same time, the pool will contain hundreds of millions or even tens of millions of kinds of nucleic acid fragments, regardless of whether they are errors or not. Selective amplification of only one type of nucleic acid fragment desired by the experimenter from this pool is considerably difficult due to the large library size and the recovery rate is also low.

Michael L. Metzker, Nature Reviews, Vol. January 2010.

It is an object of the present invention to provide a method for easily recovering nucleic acid fragments separated in sequence identification from an entire DNA library.

According to an aspect of the present invention, there is provided a method for detecting nucleic acid, comprising: (a) recovering isolated single-stranded nucleic acid fragments in a sequencing step; (b) amplifying the recovered single stranded nucleic acid fragments; And (c) recovering the amplified nucleic acid fragments.

According to another aspect of the present invention, there is provided a method of amplifying a double-stranded DNA library comprising: (a) preparing a sequencing bead with an amplified double-stranded DNA library; (b) recovering single-stranded nucleic acid fragments separated from the sequencing beads to provide a scaled DNA library; (c) amplifying the recovered single stranded nucleic acid fragments; And (d) recovering the amplified nucleic acid fragments.

According to another aspect of the present invention, there is provided a method of preparing a DNA library comprising: (a) providing a DNA library; (b) joining the DNA library with a sequencing bead for next-generation sequencing; (c) amplifying a DNA library bound to the bead; (d) separating the amplified double-stranded nucleic acid fragments from the beads into a single strand; (e) recovering and purifying a solution of single-stranded nucleic acid fragments separated from the bead; (f) amplifying the recovered nucleic acid fragments; And (g) obtaining a desired nucleic acid fragment of the recovered nucleic acid fragments.

In the method for recovering nucleic acid fragments separated in the sequence identification process of the present invention, the DNA library to be amplified can be reduced, and the recovery rate of a desired nucleic acid fragment can be remarkably increased. That is, if the size of the DNA library is very large, the recovery rate of the desired nucleic acid fragment is low because of the complexity of the DNA library. Accordingly, shrinking the DNA library using the present invention can reduce the complexity of the DNA library and increase the recovery rate of the desired nucleic acid fragment. In addition, the single stranded nucleic acid fragments isolated in the conventional sequence identification process were discarded as waste, but they were efficiently improved to increase the utilization of the separated nucleic acid fragments in the sequence identification process.

FIG. 1 is a flowchart illustrating a method of recovering nucleic acid fragments separated in the nucleotide sequence confirmation process according to an embodiment of the present invention.
FIG. 2 is a flow chart of two methods for recovering nucleic acid fragments in a nucleotide sequence identification process according to an embodiment of the present invention.
FIG. 3 shows a configuration diagram of a DNA library according to an embodiment of the present invention.
FIG. 4 shows the result of purification after purification of a single-stranded nucleic acid fragment recovery solution separated from a sequencing bead according to an embodiment of the present invention.
FIG. 5 shows the results of separating the amplified nucleic acid library according to one embodiment of the present invention into individual DNA fragments through topo cloning and PCR.
FIG. 6 is a graph showing the results of comparing the contents of individual DNA fragments separated by topocloning and PCR according to an embodiment of the present invention with the content of the original DNA library by sequencing.

Hereinafter, various embodiments of the present invention will be described in detail. The following implementations are provided to enable those skilled in the art to fully understand the concepts disclosed herein. Therefore, the present invention is not limited to the embodiments described below, but may be embodied in other forms.

In order to overcome the limitations of the bead-picking method or the method of recovering nucleic acid fragments using the barcode sequence described in the background art, the present inventors have effectively reduced the DNA library to alleviate the restriction by the size of the DNA library, The inventors of the present invention have developed a method capable of recovering the entire nucleic acid fragments obtained in the course of the analysis without loss, thereby completing the present invention.

In one embodiment of the present invention, there is provided a method of detecting nucleic acid, comprising: (a) recovering isolated single stranded nucleic acid fragments in a sequencing step; (b) amplifying the recovered single stranded nucleic acid fragments; And (c) recovering the amplified nucleic acid fragments.

In a preferred embodiment, (d) if necessary, recovering the desired nucleic acid fragments from the recovered nucleic acid fragments may be further included.

1 is a process flow diagram illustrating a method for recovering nucleic acid fragments according to one embodiment of the present invention. Specifically, referring to FIG. 1, separated single stranded nucleic acid fragments are recovered in the sequencing step S110.

In one embodiment of the present invention, the sequencing may be performed by a method of synthesizing nucleic acid fragments. In this case, the nucleic acid fragment may be synthesized by a Sanger method or a hyperparallel method (Michael L. Metzker, Nature Reviews, Vol. II, 2010 January, 'Seqeuencing technologies-the next generation'). The hyper-parallel scheme may be Pyrosequencing chemistry, Bridge amplification, next generation sequencing, third generation sequencing, next generation sequencing, or semiconductor sequencing, but is not limited thereto.

If the length of the nucleic acid fragment to be sequenced is longer than the length of the nucleic acid fragment proposed in the next-generation sequencing method to be used, it can be fragmented using a restriction enzyme method or a physical shearing method. When the length of the nucleic acid fragment is short, it is possible to extend the length using a method such as assemble or ligation.

In one embodiment of the present invention, the single stranded nucleic acid fragment separated in the sequencing step may be separated from the sequencing bead. The sequencing bead may be a sequencing bead with a DNA library, and the double stranded nucleic acid fragment amplified for hyperparallel sequencing may be a conjugated bead. The beads are separated into single-stranded nucleic acid fragments for sequencing and injected into the sequencing plate, wherein the opposite single-stranded nucleic acid fragments not conjugated to the beads can be recovered separately. The single-stranded nucleic acid fragments thus obtained are in a state where the number of nucleic acid fragments is smaller than that of the original DNA library.

The process of shrinking the DNA library by recovering single-stranded nucleic acid fragments separated from the sequencing beads can be described as follows. For example, when analyzed using ion-Torrent (Ion-Torrent) a DNA library obtained by means of the oligonucleotide 90k microchip, about 2 ~ 5x10 one facing the adapter sequence required for sequencing the ¹⁴ nucleic acid fragment after about 5x10 ⁸ After mixing with the beads for sequencing, emulsion PCR is performed so that only one kind of nucleic acid fragments forms a double stranded nucleic acid and amplifies in one kind of beads. In order to enable sequencing through enrichment, only about 2.5x10 ⁸ (1/2 of the total) nucleic acid fragments are left when only nucleic acid fragments having different adapter sequences in both directions are separated. The beads are then separated into single stranded nucleic acids for sequencing and injected into the sequencing chip. At this time, the opposite single-stranded nucleic acid not bonded to the bead can be recovered separately. Thus obtained single-stranded nucleic acid is DNA, the first library (about 2 ~ 5x10 ¹⁴⁾ than the state (about 2.5x10 ⁸⁾ reduction in the number of nucleic acid fragments to be both subjected to a concentrated (enrichment) process on the sequencing amplification beads. Since the nucleic acid fragments obtained from the sequencing are about 1 to 2x10 ⁸ and the nucleic acid fragments having this information are included in the reduced library, the use of the reduced library rather than the recovery from the initial library increases the recovery efficiency .

As another example, the process of reducing the DNA library by recovering the single-stranded nucleic acid fragments separated from the sequencing bead is analyzed using Roche-454 GS Junior. The concentration of the original DNA library (about 2 to 5 × 10 ¹⁴ ) obtained through Microchip Oligo is measured, and the number of molecules is calculated and diluted. At this time, 5 to 20 x 10 ⁶ nucleic acid fragments are reacted with a larger number of the beads to carry out emulsion PCR. After the immersion of the PCR nucleic acid fragments to the bead for sequencing connected amplified to 2x10 ⁵ ~ 5x10 ⁵ gae the single-stranded nucleic acid fragment that is not recovered (more broadly, ⁵ ~ 3x10 ⁶ gae 1x10) and joined to from which beads When recovered, libraries (2 × 10 ⁵ to ⁵ × 10 ⁵ ) with reduced number of nucleic acid fragments can be obtained than the original DNA library (about 2 × 10 ¹⁴ ), and the number of libraries can be arbitrarily limited by limiting the number of sequencing beads. Since the nucleic acid fragments obtained from the sequencing are about 5 × 10 ⁴ to 1 × 10 ⁵ and nucleic acid fragments having this information are contained in the reduced library, it is more efficient to use the reduced library than to recover from the original library .

The reduced DNA library may include purifying the recovered single-stranded nucleic acid solution to recover only the pure nucleic acid fragments.

In step S120, the recovered single-stranded nucleic acid fragments are amplified.

The recovered single-stranded nucleic acid fragments are amplified to double-stranded nucleic acid fragments. As the method for amplifying the recovered single strand nucleic acid fragments, any conventional amplification method of nucleic acid fragments can be used. The method may further comprise injecting a DNA polymerase, a dNTP, a primer, a buffer, and / or a PCR solution into the nucleic acid fragments for amplification of the nucleic acid fragments. The DNA polymerase may be, but is not limited to, Tag polymerase, Pfu polymerase, and the like. Amplification of the nucleic acid fragments can be amplified or extended using temperature-controllable instruments such as ovens, water baths or PCR instruments.

In step S130, the amplified nucleic acid fragments are recovered.

For example, a PCR solution and amplified nucleic acid fragments can be recovered by using a pipette or the like. As another example, the PCR solution may be electrophoresed on an agarose gel to selectively purify the band in the size of the nucleic acid fragment belonging to the library to recover only the amplified nucleic acid fragment. In this way, the entire nucleic acid fragments of the reduced DNA library can be recovered without loss during the sequencing process.

Next, desired nucleic acid fragments of the recovered nucleic acid fragments are recovered.

As a method of recovering the desired nucleic acid fragments, a conventional method for recovering nucleic acid fragments can be used. A kit for recovering nucleic acid fragments sold on the market or a method using the kit may be applied. In addition, when a specific barcode sequence is linked to the recovered nucleic acid fragments, the nucleic acid fragments can be recovered using a sequence identical to the barcode sequence. This allows the desired nucleic acid fragments to be obtained at a higher recovery rate from the reduced DNA library.

Also, prior to performing the step, the method may further comprise coupling the adapter sequence to the nucleic acid fragments to be sequenced prior to sequencing.

The step of connecting the adapter sequence may be a method using PCR assemble or a method using ligation. When connecting the adapter, a 15 to 30 bp bar code sequence can be added as needed.

In another embodiment of the invention, there is provided a method of preparing a sequencing bead comprising: (a) preparing a sequencing bead with an amplified double stranded DNA library; (b) recovering single-stranded nucleic acid fragments separated from the sequencing beads to provide a scaled DNA library; (c) amplifying the recovered single stranded nucleic acid fragments; And (d) recovering the amplified nucleic acid fragments.

In a preferred embodiment, (e) if necessary, recovering the desired nucleic acid fragments from the recovered nucleic acid fragments may be further included.

Figure 2 shows a flow chart of two methods for recovering nucleic acid fragments in a nucleotide sequence identification process. According to one embodiment of the present invention, there is provided a method of preparing a DNA library comprising: (a) providing a DNA library; (b) joining the DNA library with a sequencing bead for next-generation sequencing; (c) amplifying a DNA library bound to the bead; (d) separating the amplified double-stranded nucleic acid fragments from the beads into a single strand; (e) recovering and purifying a solution of single-stranded nucleic acid fragments separated from the bead; (f) amplifying the recovered nucleic acid fragments; And (g) obtaining a desired nucleic acid fragment of the recovered nucleic acid fragments.

According to the present inventors' method, the entire DNA library is conjugated to the sequencing beads, and then the size of the DNA library can be effectively reduced by the number of the synthesized beads through an enrichment process. The reduced DNA library can be recovered by purifying the recovered single-stranded nucleic acid solution and obtaining pure DNA, followed by amplification using a PCR instrument or the like. In addition, when the DNA library contains a bar code sequence, the desired nucleic acid fragment can be obtained from the reduced DNA library at a higher recovery rate.

Hereinafter, the present invention will be described in more detail based on the following examples, but the present invention is not limited to the following examples.

Example 1. Preparation of a gene for sequencing and acquisition of a reduced library

The DNA library obtained in the present example was synthesized using a microchip array, and then DNA fragments obtained from the chip were obtained. Referring to FIG. 3, the DNA library includes a 19 bp (base pair) barcode sequence at both ends and a 20 bp complementary to the proton adapter sequence. The length of the barcode sequence is adjustable at the time of initial design. Prior to sequencing, the process involved linking the adapter sequences proposed in the next generation sequencing. In this case, the method of connecting the adapter sequence is a method using PCR assemble or a method using ligation. If the obtained DNA library does not contain a barcode sequence and a sequence complementary to the adapter sequence, It is also possible.

The adapter sequences were ligated using PCR assays. The composition of the PCR solution was as follows. 0.5 μl of template, 10 μl of 2X KAPA Hifi Polymerase mix, 1 μl of 10 μM adapter forward primer, 1 μl of 10 μM adapter reverse primer, 7.5 μl of distilled water . The KAPA Hifi Polymerase mix used in the experiments was a 2X KAPA Hifi HotStart PCR kit with dNTPs available from KAPA Biosystems. Also, the primer used in the experiment is a proton adapter sequence and includes a complementary sequence to the end sequence of the DNA library. The actual sequence of the primer is as follows (adapter forward primer (SEQ ID NO: 1): CCATCTCATCCCTGCGTGTCTCCGACTCAGTGAGCGGAACGAT, adapter reverse primer 2): CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT). The denaturation was carried out for 3 minutes at 95 ° C for the first DNA denaturation and then 15 to 20 times at 95 ° C. for 30 seconds, 60 ° C. for 30 seconds, 72 ° C. for 30 seconds, At 72 ° C for 10 minutes.

The end of the PCR-completed DNA library has a proton adapter sequence in common, which has a sequence complementary to the single-stranded DNA bound to the sequencing bead.

The PCR-completed DNA library was mixed with PCR-related reagents of ion-torrent protons including ISP (Ion Sphere Particles) and mineral oil, which are sequencing beads, and the DNA library and the sequencing beads were bonded in a 1: Amplification was performed on the OneTouch 2 (Ion OneTouch ^TM 2) instrument. The sequencing beads at this time theoretically contain only one type of DNA library.

Thereafter, both adapters of the DNA library were subjected to a process for selecting DNA in a state of no damage with a combination of correct sequences. The opposite side of the DNA bound to the sequencing bead had a complementary sequence to the streptavidin C1 beads (Streptavidin C1 Beads), which is attached to the magnet. Thereafter, the conjugated streptavidin beads were attached to the magnets and washed, and the DNA library was left with only the perfect DNA, and the rest was discarded. This process was performed automatically using the Ion OneTouch ^™ ES instrument.

The double-stranded DNA library conjugated to the sequencing beads was then denaturated with NaOH and separated into single stranded DNA. Single stranded DNA with adapter sequences was sequenced through ion torrent proton sequencing and at the same time single stranded DNA solution isolated from sequencing beads was recovered. The recovered solution contained only single-stranded nucleic acid fragments as well as enzymes and buffer solutions used for the amplification and isolation procedures, so that only pure single stranded nucleic acid fragments were recovered through DNA purification.

Example 2. Amplification of nucleic acid fragments of a reduced DNA library

The single-stranded nucleic acid fragments obtained in Example 1 were used as a template to carry out a PCR reaction through a PCR instrument.

The composition of the PCR solution is as follows. 1 μl of template, 10 μl of 2X KAPA Hifi Polymerase mix, 1 μl of 10 μM forward primer, 1 μl of 10 μM reverse primer, 7 μl of distilled water. The KAPA Hifi Polymerase mix used in the experiments was a 2X KAPA Hifi HotStart PCR kit with dNTPs from KAPA Biosystems. The primers used in the experiments were 20 bp complementary to the adapter sequences included in the original DNA library. The actual sequence of the primer is as follows (forward primer (SEQ ID NO: 3): GACTCAGTGAGCGGAACGAT, reverse primer (SEQ ID NO: 4): CTCTATGGGCAGTCGGTGAT) where it was kept at 95 ° C for 3 minutes for initial DNA denaturation, 30 sec., 60 sec., 30 sec., 72 sec., 30 sec. Was performed 15-20 times, and the final extension step was maintained at 72C for 10 minutes.

Example 3. Identification of amplified products

The product amplified by PCR in Example 2 was confirmed by electrophoresis on the agarose gel of the PCR solution after the reaction. As a result of the electrophoresis, the band was confirmed in the expected size (size of the nucleic acid fragment belonging to the library) (see FIG. 4) and selectively purified to recover only the amplified library nucleic acid fragment. This means that the entire DNA library has been reduced to the number of sequencing beads synthesized for next-generation sequencing.

The recovered and reduced DNA library was separated into individual DNA fragments by Topo cloning and PCR (see FIG. 5). FIG. 6 shows the result of comparing the separated individual DNA fragments with the contents of the original DNA library by sequence identification through Sanger sequencing. This confirms that the desired nucleic acid fragments were successfully recovered.

The present invention reduces the overall DNA library through sequencing to increase the recovery of final target nucleic acid fragments. In addition, it is considered that the invention is industrially very useful because it provides a method that can more effectively utilize nucleic acid fragments that have not been used differently after being separated in the sequencing process.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> Method of collecting nucleic acid fragments separated from the 시퀀스 공정 <130> SDP2013-1123 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> adapter forward primer <400> 1 ccatctcatc cctgcgtgtc tccgactcag tgagcggaac gat 43 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> adapter reverse primer <400> 2 ccactacgcc tccgctttcc tctctatggg cagtcggtga t 41 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 gactcagtga gcggaacgat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 ctctatgggc agtcggtgat 20 <210> 5 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> sample <400> 5 gactcagtga gcggaacgat gctgactggt acggagggtc tcttcgcggg ggcggctcca 60 cggtctcact ctgcacggcc tcgatcttgt aggggatgtt gaggctgccc agcgagaaga 120 gttggaattg tgcccagtgt atcaccgact gcccatagag 160 <210> 6 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> sample <400> 6 gactcagtga gcggaacgat cggcaactat aaacatttgc tcttcatgga gcctccgcac 60 acgtggacgt tctggacgtg caggctgacc tgccagagcc aggcccccgg gagcggaaga 120 gaagcatgtg tgtccatcaa atcaccgact gcccatagag 160 <210> 7 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> sample <400> 7 gactcagtga gcggaacgat gctgactggt acggagggtc tcttcgcggg ggcggctcca 60 cggtctcact ctgcacggcc tcgatcttgt aggggatgtt gaggctgccc agcgagaaga 120 gttggaattg tgcccagtgt atcaccgact gcccatagag 160 <210> 8 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> sample <400> 8 gactcagtga gcggaacgat ctggatggtt caccatgatc tcttcggaac ttggctccag 60 catgggctgt gtaggtgtcc cctgtcatca acctgctcag gccaaaatca gctacgaaga 120 gcataacaag ttcttattct atcaccgact gcccatagag 160 <210> 9 <211> 160 <212> DNA <213> Artificial Sequence <220> <223> sample <400> 9 gactcagtga gcggaacgat cggcaactat aaacatttgc tcttcatgga gcctccgcac 60 acgtggacgt tctggacgtg caggctgacc tgccagagcc aggcccccgg gagcggaaga 120 gaagcatgtg tgtccatcaa atcaccgact gcccatagag 160

Claims

(a) recovering isolated single-stranded nucleic acid fragments in a sequencing step;
(b) amplifying the recovered single stranded nucleic acid fragments; And
(c) recovering the amplified nucleic acid fragments.

The method according to claim 1,
(d) recovering the desired nucleic acid fragments from the recovered nucleic acid fragments.

The method according to claim 1,
Wherein the sequencing is performed by a method of synthesizing nucleic acid fragments.

The method of claim 3,
Wherein the nucleic acid fragment is synthesized by a superparallel method.

5. The method of claim 4,
Wherein the hyperparallel method is selected from the group consisting of pyrosequencing chemistry, bridge amplification, next generation sequencing, third generation sequencing, next generation sequencing, and semiconductor sequencing.

The method according to claim 1,
Wherein the single strand nucleic acid fragment separated in the sequencing step is separated from the sequencing bead.

The method according to claim 6,
Wherein the sequencing bead is a sequencing bead with a DNA library.

The method according to claim 6,
Wherein the sequencing bead is an amplified double-stranded nucleic acid fragment conjugated bead.

3. The method of claim 2,
And recovering the desired nucleic acid fragments using a sequence homologous to the barcode sequence when a specific barcode sequence is linked to the amplified nucleic acid fragments.

The method according to claim 1,
further comprising the step of connecting the adapter sequence to the nucleic acid fragments prior to step (a).

11. The method of claim 10,
Wherein the step of connecting the adapter sequence is a method using PCR assemble or a method using ligation.

(a) preparing a sequencing bead with an amplified double stranded DNA library;
(b) recovering single-stranded nucleic acid fragments separated from the sequencing beads to provide a scaled DNA library;
(c) amplifying the recovered single stranded nucleic acid fragments; And
(d) recovering the amplified nucleic acid fragments.

13. The method of claim 12,
(e) recovering the desired nucleic acid fragments from the recovered nucleic acid fragments.

(a) providing a DNA library;
(b) joining the DNA library with a sequencing bead for next-generation sequencing;
(c) amplifying a DNA library bound to the bead;
(d) separating the amplified double-stranded nucleic acid fragments from the beads into a single strand;
(e) recovering and purifying a solution of single-stranded nucleic acid fragments separated from the bead;
(f) amplifying the recovered nucleic acid fragments; And
(g) obtaining the desired nucleic acid fragment from the recovered nucleic acid fragments.

15. The method of claim 14,
And recovering the desired nucleic acid fragments using a sequence homologous to the barcode sequence when a specific barcode sequence is linked to the amplified nucleic acid fragments.