CN105986015B - Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing - Google Patents
Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing Download PDFInfo
- Publication number
- CN105986015B CN105986015B CN201510061690.6A CN201510061690A CN105986015B CN 105986015 B CN105986015 B CN 105986015B CN 201510061690 A CN201510061690 A CN 201510061690A CN 105986015 B CN105986015 B CN 105986015B
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- round
- amplification
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides high throughput sequencing based methods or kits for capturing and labeling one or more target sequences from multiple samples. The invention integrates multiple amplification technology, connection technology and PCR-index technology, and provides a novel marking technical scheme, wherein a target sequence is amplified by using a specific capture primer, a joint with a U base and a known sequence is respectively introduced into two ends of a PCR product by utilizing a connection reaction, the U base is cut by using a USER enzyme, the PCR primer is designed according to the known sequence of the joint, label primers are respectively introduced into two ends of the PCR product by utilizing the PCR reaction, sample information of the PCR product is specifically obtained through the label primer sequences introduced into the two ends of the PCR product, and a sequencing result is corresponding to each target sequence of a sample according to the capture primer sequence of each target sequence.
Description
Technical Field
The invention relates to the field of biotechnology, in particular to a method and a kit for capturing and marking target sequences of multiple samples, and particularly relates to a method or a kit for capturing and marking one or more target sequences of multiple samples based on high-throughput sequencing.
Background
The appearance of a new generation of high-throughput sequencer greatly reduces the nucleic acid sequencing cost, and has the characteristics of high throughput, low cost, low sequencing error rate and the like. By applying the second generation high-throughput sequencing technology, the sequence of the mixed nucleic acid molecules can be determined, and each independent sequence can be distinguished and determined at the same time, so that the sequencing technology can be developed into a high-throughput marker.
With the wide development of the high-throughput sequencing technology in the aspects of human disease research, microbial genome sequencing and the like, how to furthest exert the characteristics of high throughput, large data volume and the like of the second-generation sequencing technology and reduce the single-sample sequencing cost becomes the development direction of the next-step sequencing technology, and the method has great market prospect and value.
However, in the conventional PCR-index technology, the index label of each PCR product needs to be amplified and labeled separately, and then all the products are mixed and sequenced, when the number of PCR fragments is large, the operation is cumbersome, and the uniformity of fragment mixing is difficult to control, which results in huge data quantity difference between fragments in the final sequencing result.
Disclosure of Invention
The invention aims to simultaneously carry out sequencing analysis on target sequence related sequences in a large number of samples by utilizing a high-throughput sequencing technology, solve the problems of low flux and high sequencing cost of the traditional method and expand the application of the second-generation sequencing technology in the field of PCR sequencing.
Aiming at the aim of the invention, the invention integrates a multiple amplification technology, a connection technology and a PCR-index technology, and provides a novel marking technical scheme, wherein a target sequence is amplified by using a specific capture primer (first round amplification), a joint with a U base and a known sequence is respectively introduced into two ends of a first round PCR product by using a connection reaction, the U base is cut by using a USER enzyme, a label primer is designed according to the known sequence of the joint, label primer sequences are respectively introduced into two ends of a second round PCR product by using a PCR reaction (second round amplification), sample information of the PCR product can be specifically obtained through the label primer sequences introduced into two ends of the second round PCR product, and a sequencing result is corresponding to each target sequence of a sample according to the capture primer sequence contained in the second round PCR product.
According to one aspect of the present invention, there is provided a method of capturing and labeling one or more target sequences of a plurality of samples based on high throughput sequencing, comprising the steps of:
first round amplification: respectively amplifying the target region of each sample under the condition suitable for multiple amplification of target nucleic acid by using a capture primer designed according to the target sequence, and recovering all DNA bands within the designed target region range;
and (3) second round amplification: performing a second round of amplification by using the product obtained from the first round of amplification as a template so that the second round of amplification product carries a tag capable of distinguishing each sample;
mixing and recovering: uniformly mixing the enrichment amplification products of each sample together, and recovering all DNA bands within the designed target area;
sequencing: sequencing the recovered DNA mixture;
and (3) analysis: based on a unique label in an amplification product of each sample, firstly, corresponding an obtained sequencing result to the sample one by one; and according to the capture primer sequence of each target sequence, corresponding the sequencing result to the target sequence of the sample.
Preferably, according to one aspect of the present invention, there is provided a high throughput sequencing-based method of capturing and labeling one or more target sequences of a plurality of samples, comprising the steps of:
first round amplification: respectively amplifying the target region of each sample under the condition suitable for multiple amplification of target nucleic acid by using a capture primer designed according to a target sequence, recovering all DNA bands within the designed target region range, carrying out terminal repair on an amplification product and adding an A tail;
joint design: the adaptor comprises two palindromic sequences, a U base and a 3 'T end, wherein one palindromic sequence is positioned at the 5' end of the adaptor and is connected with the other palindromic sequence through the U base, and the palindromic sequence can stably form a hairpin structure;
linker (Adaptor): adding linkers with U basic groups at two ends of the first round amplification product through a connection reaction; performing U base shearing, and digesting the rest of the primers by using single-stranded digestive enzyme;
designing a label primer: the tag primer comprises a tag sequence and a sequence complementary to a palindromic sequence at the 5 'end of the adaptor, wherein the tag sequence is positioned at the 5' end of the tag primer, and the number of the tag sequences multiplied by the number of the adaptors is more than or equal to the number of samples;
and (3) second round amplification: using label (index) primers designed for the adaptor and each sample, taking a product of the corresponding sample connected with the adaptor as a template for enrichment amplification, and digesting the residual primers by using single-stranded digestive enzyme to respectively add distinguishable label primer sequences to the amplification product of each sample;
mixing and recovering: uniformly mixing the enrichment amplification products of each sample together, and recovering all DNA bands within the designed target area;
sequencing: sequencing the recovered DNA mixture;
and (3) analysis: based on the unique label primer sequence in the amplification product of each sample, firstly, the obtained sequencing result is in one-to-one correspondence with the sample; and according to the capture primer sequence of each target sequence, corresponding the sequencing result to each target sequence of the sample.
Preferably, the present invention provides a method for capturing and labeling one or more target sequences of a plurality of samples based on high throughput sequencing, comprising the steps of:
1) primer and linker design:
first round amplification primers: designing corresponding capture primers according to a target sequence to be detected to form a first round amplification primer combination;
linker sequence: designing one or more adaptor sequences, wherein the adaptor comprises two palindromic sequences, a U base and a 3 'T end, wherein one palindromic sequence is positioned at the 5' end of the adaptor and is connected with the other palindromic sequence through the U base, and the palindromic sequences can be stably formed into hairpin structures;
second round amplification primers: designing different label sequences according to the number of samples, adding a sequence complementary to the palindromic sequence at the 5 'end of the adaptor to the 3' end of the sample to form a label primer for enrichment amplification, and forming a second round amplification primer combination, wherein the forward label primer and the reverse label primer for the same sample are the same due to the fact that the adaptors connected at the two ends of the target sequence of the second round amplification are the same, and the number of the designed label primers follows the following rules: the number of the tag sequences multiplied by the number of the adapters is more than or equal to the number of the samples, and in the second round of amplification primers, the sequences added on the tag sequences are complementary with the palindromic sequences at the 5' ends of the adapters connected in the first round of amplification products;
2) first round amplification (PCR capture): mixing the capture primers for amplifying the target sequence, and amplifying each sample under the condition suitable for multiple amplification of target nucleic acid; recovering all DNA bands in the designed target region range, carrying out end repair on the amplification product, and adding A tails to both ends of the amplification product;
3) linker (Adaptor): adding joints with U bases at two ends of an amplification product through a ligation reaction, breaking the U bases by using USER enzyme, and digesting the rest primers by using single-stranded digestive enzyme;
4) second round amplification (product enrichment): according to the label primers designed for different samples and joints, performing enrichment amplification by using a product obtained after the joint treatment of the corresponding sample as a template so as to add distinguishable label primer sequences to the amplification primer of each sample; digesting the rest of the primers by using single-stranded digestive enzyme, and purifying;
5) mixing and recovering: uniformly mixing the enriched products of each sample together; recovering all DNA bands within the designed target region;
6) sequencing: sequencing the DNA mixture;
7) and (3) analysis: based on the unique label primer sequence of each sample, firstly, the obtained sequencing result is in one-to-one correspondence with the sample; and according to the capture primer sequence of each target sequence, corresponding the sequencing result to each target sequence of the sample.
Preferably, in step 1, the length of the tag sequence may be 5-20bp, and more preferably, the length of the tag sequence may be 6-8 bp; the linker sequence comprises two regions of palindromic sequence, preferably each palindromic sequence may be 8-15bp (most preferably 15 bp).
Preferably, in the step 2, the system adopted for amplification is a high-fidelity multiplex PCR reaction system, so as to reduce DNA mutation caused by amplification and ensure that each target segment can be effectively amplified;
preferably, in step 2, PCR amplification is performed for 18-20 cycles.
Preferably, in step 4, the enzyme used for amplification is a high fidelity DNA polymerase, thereby reducing the DNA mutation rate due to amplification.
Preferably, the reagents used in the end repair and A tail addition reaction in the step 2 and the ligation reaction in the step 3 are Neb recommendation second generation library building kits respectively
End Repair Module、
dA-TailingModule and
quick Ligation Module. Preferably, the single stranded digestive enzyme used in steps 3 and 4 is exonuclease i (exouclase i), which is a single strand specific 3 '→ 5' exonuclease that does not break down double stranded DNA and RNA.
Preferably, the second round of amplification in step 4 is performed for 15-18 cycles.
Preferably, the sequencing in step 6 is performed using a second generation sequencing technique, preferably a pair-End technique (e.g., Illumina Hiseq2000, Illumina Hiseq2500 and Illumina Miseq), to obtain the sequence of the DNA mixture.
In another aspect, the present invention also provides a kit for capturing and labeling one or more target sequences of a plurality of samples based on high throughput sequencing, wherein the kit comprises the following primers:
first round amplification primers: designing corresponding capture primers according to a target sequence to be detected to form a first round amplification primer combination;
linker sequence: one or more adaptor sequences comprising two palindromic sequences, a U base and a 3 'T terminus, wherein one palindromic sequence is 5' to the adaptor and is linked to another palindromic sequence by a U base, which is stable to form a hairpin structure; and/or
Second round amplification primers: designing different label sequences according to the number of samples, adding a sequence complementary to the palindromic sequence at the 5 'end of the adaptor to the 3' end of the sample to form a label primer for enrichment amplification, and forming a second round amplification primer combination, wherein the forward label primer and the reverse label primer for the same sample are the same due to the fact that the adaptors connected at the two ends of the target sequence of the second round amplification are the same, and the number of the designed label primers follows the following rules: the number of the tag sequences x the number of the adapters is more than or equal to the number of the samples, and in the second round of amplification primers, the sequence added on the tag sequences is complementary to the palindromic sequence at the 5' end of the adapter connected in the first round of amplification products.
Preferably, in the present invention, the number of the samples may be: the number of samples is ≦ the number of programmable tag sequences × the number of programmable linkers.
More preferably, the present invention provides a kit for labeling and capturing one or more (21) EXONs of the Wilson syndrome-associated ATP7B gene for a plurality (10) of samples based on high throughput sequencing, wherein the EXONs are one or more selected from the group consisting of EXON1, EXON2, EXON3, EXON4, EXON5, EXON6, EXON7, EXON8, EXON9, EXON10, EXON11, EXON12, EXON13, EXON14, EXON15, EXON16, EXON17, EXON18, EXON19, EXON20, EXON 21; the kit comprises the following primers and joints:
the first round amplification primers comprise one or more pairs selected from the group consisting of:
linkers with the following sequences for ligation at both ends of the first round amplification products:
ADP1：5'P-AGGACAGAAGCTCGA-U-TCGAGCTTCTGTCCT-s-T-3'
ADP2：5'P-ACCTTGAGCGATCGA-U-TCGATCGCTCAAGGT-s-T-3'；
the second round amplification primers comprise a primer pair consisting of one or more tag primers selected from the following tag primers, wherein the crosshatched portion is a sequence complementary to the 5' palindromic region of the adaptor ligated in the first round product:
ADP1A：GCTCATTCGAGCTTCTGTCCT
ADP1B：TAGCCTTCGAGCTTCTGTCCT
ADP1C：AGAGGCTCGAGCTTCTGTCCT
ADP1D：TATCCTTCGAGCTTCTGTCCT
ADP1E：CTCTGATCGAGCTTCTGTCCT
ADP2A：GCTCATTCGATCGCTCAAGGT
ADP2B：TAGCCTTCGATCGCTCAAGGT
ADP2C：AGAGGCTCGATCGCTCAAGGT
ADP2D：TATCCTTCGATCGCTCAAGGT
ADP2E：CTCTGATCGATCGCTCAAGGT
wherein, in the second round of amplification, the linkers connected with both ends of the target sequence are the same, and the forward tag primer and the reverse tag primer used for the same sample are the same.
The invention has the following beneficial effects:
the invention uses a specific capture primer (a first round amplification primer) to amplify a target sequence, connects a linker (Adaptor) with a U base to two ends of a target sequence amplification product through a connection reaction, cuts the U base by using a USER enzyme, and amplifies by using a second round amplification primer consisting of a tag sequence and a linker sequence, and finally adds a tag primer sequence at the 5' end of a PCR product. By introducing the unique label primer sequence into each sample, the sequencing result of each sample can be found back through the unique label primer sequence when the second generation high-throughput sequencing technology is used for detection, and the sequencing result is corresponding to each target sequence of the sample according to the capture primer sequence of each target sequence, so that the invention can be applied to simultaneously detecting a plurality of different gene loci of a large number of samples, and the sequencing cost is greatly reduced.
Drawings
FIG. 1 is a schematic diagram of a method of capturing and labeling target sequences of a plurality of samples according to the present invention.
Detailed Description
The present invention will now be described in further detail with reference to examples, which are given solely for the purpose of illustration and are not intended to be limiting of the invention.
The equipment and reagents used in the following examples are as follows:
End Repair Module、
dA-lifting Module and
quick Ligation Module, Exonuclease Takara (Exonuclease I (E. coli)).
Example 1
Sequencing of 21 EXONs (EXON1, EXON2, EXON3, EXON4, EXON5, EXON6, EXON7, EXON8, EXON9, EXON10, EXON11, EXON12, EXON13, EXON14, EXON15, EXON16, EXON17, EXON18, EXON19, EXON20 and EXON21) of the Wilson syndrome-associated ATP7B Gene (NCBI Gene ID:540), for 10 clinical samples:
1) primer and linker design:
corresponding capture primers are designed aiming at 21 exons of the ATP7B gene, and the related parameters are as follows: the Tm value is 58.0-65.0 ℃, the GC value is 40.0-60.0%, the size of the primer is 23 +/-3 bp, the size of the target fragment is 150-300bp, and the designed primers are as follows:
2 adapters are designed according to 10 samples, the adapters are single-stranded DNA, the sequences comprise palindromic sequences of two regions (each region is 15bp in length), one U base and 3' T ends, and a stable hairpin structure can be formed, and the designed adapter sequences are as follows:
ADP1：5'P-AGGACAGAAGCTCGA-U-TCGAGCTTCTGTCCT-s-T-3'
ADP2：5'P-ACCTTGAGCGATCGA-U-TCGATCGCTCAAGGT-s-T-3'
designing a label primer according to the following rules: the tag primers comprise tag sequences and sequences complementary to palindromic sequences at the 5 ' end of the adaptor, wherein the number of the tag sequences x the number of the adaptor sequences is more than or equal to the number of samples, in this example, 10 tag primers are designed according to 10 samples and 2 adaptors, that is, the 5 ' end of the sequences complementary to the palindromic sequences at the 5 ' end of the adaptor is added with distinguishable tag sequences (6bp) to form the tag primers, wherein, as the palindromic sequences of the adaptors connected at the two ends of the target sequences amplified in the second round (products after the first round of amplification products are connected with the adaptors) are identical, the forward tag primers and the reverse tag primers used for the same sample are identical. The tag primers were designed as follows, with the crosshatched portion being the sequence complementary to the 5' palindromic region of the adaptor ligated in the first round product:
ADP1A：GCTCATTCGAGCTTCTGTCCT
ADP1B：TAGCCTTCGAGCTTCTGTCCT
ADP1C：AGAGGCTCGAGCTTCTGTCCT
ADP1D：TATCCTTCGAGCTTCTGTCCT
ADP1E：CTCTGATCGAGCTTCTGTCCT
ADP2A：GCTCATTCGATCGCTCAAGGT
ADP2B：TAGCCTTCGATCGCTCAAGGT
ADP2C：AGAGGCTCGATCGCTCAAGGT
ADP2D：TATCCTTCGATCGCTCAAGGT
ADP2E：CTCTGATCGATCGCTCAAGGT
2) first round amplification (PCR capture):
after each pair of capture primers is individually debugged to be qualified, respectively diluting 21 pairs of primers to 100 mu M for each clinical sample, then mixing the primers in equal quantity, and amplifying according to the following system and conditions:
| reaction components | 50μL |
| Multiplex PCR premix (Multiplex PCR Mix) | 25 |
| GC enhancement buffer (GC Enhance) | 3 |
| Primer mixture (Primer Mix) | 1.25 |
| Stencil (10ng/ul) | 2 |
| H2O | 18.75 |
Reaction conditions are as follows:
10 minutes at 95 ℃;
30 seconds at 95 ℃; 5 minutes at 58 ℃ (20 cycles);
7 minutes at 72 ℃.
And (3) product recovery: the gel was cut to recover all DNA bands (150-300bp) within the designed target region.
And (3) repairing the tail end: and (3) performing end repairing on the recovered product according to the following reaction system and conditions:
reaction conditions are as follows:
20℃30min
65℃20min
the resulting product was column purified and finally eluted at 50. mu.L.
Adding A tail: adding A tail to the 3' end of the product fragment according to the following reaction system and conditions:
| reaction components | 50μL |
| NEBNext plus A Reaction Buffer (NEBNext dA-labeling Reaction Buffer) (10X) | 5 |
| Klenow Fragment enzyme (Klenow Fragment (3 '→ 5' exo-)) | 3 |
| Purification of the product | 42 |
Reaction conditions are as follows: 30min at 37 ℃ and 20min at 65 ℃.
The resulting product was column purified and finally eluted at 30. mu.L.
3) Connecting joint
And (3) connection reaction: linkers are added to both ends of the product fragments according to the following reaction system and conditions:
reaction conditions are as follows: 15min at 20 ℃, 30min at 12 ℃ and 10min at 65 ℃.
Wherein, in the tag primers used in the second round of amplification, the sequence linked to the 3 'end of the tag sequence is a sequence complementary to the palindromic sequence at the 5' end of the adaptor linked to the first round of amplification products, and the adaptor linked to each sample in the first round of amplification and the tag primers used in the second round of amplification are shown in the following table one.
USER enzyme and Exonuclease I enzyme digestion: mu.L of USER enzyme was added to the above system and reacted at 37 ℃ for 30min to cleave the U base in the linker, and then 1. mu.L of Exonuclease I enzyme was added and reacted at 37 ℃ for 30min to digest the primer single strand remaining in the system. The resulting product was column purified and finally eluted at 50. mu.L.
4) The second round of amplification (product enrichment) uses the above-mentioned labeled primers designed according to the samples and adapters, and the products after the corresponding sample ligation adapter treatment are used as templates for enrichment amplification, so as to add distinguishable labeled primer sequences to the amplification products of each sample, respectively, and the reaction system and conditions are as follows:
| reaction components | 50μL |
| 2 XPCR premix (2 XPCR Mix) | 25 |
| Index primer (100. mu.M) | 1 |
| Taq polymerase (Taq polymerase) | 1 |
| Form panel | 23 |
Reaction conditions are as follows: 10min at 95 ℃; 1min at 95 ℃, 5min at 50 ℃ and 1min at 72 ℃ (15-18 cycles);
wherein the adaptor ligated in the first round product and the tag primer used in the second round product are as shown in the following table one:
watch 1
| Sample numbering | Joint | Label primer |
| 1# | ADP1 | ADP1A |
| 2# | ADP1 | ADP1B |
| 3# | ADP1 | ADP1C |
| 4# | ADP1 | ADP1D |
| 5# | ADP1 | ADP1E |
| 6# | ADP2 | ADP2A |
| 7# | ADP2 | ADP2B |
| 8# | ADP2 | ADP2C |
| 9# | ADP2 | ADP2D |
| 10# | ADP2 | ADP2E |
Primer digestion and product recovery: digesting the residual primers by using single-stranded digestive enzyme, purifying, and recovering all DNA bands in the designed target region range;
5) mixing and recovering: uniformly mixing the second round PCR amplification products with the marker sequences aiming at each clinical sample according to the concentration, and recovering all DNA bands within the designed target region;
6) sequencing: sequencing the recovered DNA mixture by using Illumina Miseq and PE300 to obtain a sequence of the DNA mixture.
7) And (3) analysis: the sequencing result of the Illumina Miseq product is a series of DNA sequences, the obtained sequencing result is firstly in one-to-one correspondence with the samples by searching the label primer sequences (combination of the joint sequence and the label sequence) which are respectively unique to 10 samples in the sequencing result, and then the sequencing result is corresponded to each target sequence of the sample according to the capture primer sequences of 21 exons. The 21 exons of all 10 samples can find corresponding data in the sequencing result, the number of reads corresponding to each sample is shown in the following table two, the maximum difference of the numbers of reads between 10 samples is about 3 times, and the maximum difference of the numbers of reads corresponding to 21 exon sequences is about 10 times (see table three, taking sample # 1-2 as an example), which indicates that the multi-sample labeling method can effectively distinguish the DNA sequence corresponding to each label.
Table two reads and GC counts for each sample
TABLE three numbers of reads corresponding to 21 exon sequences (sample # 1-2 as an example)
| 1# | 2# | |
| Exon 1 | 14231 | 10272 |
| Exon 2 | 9831 | 6098 |
| Exon3 | 17246 | 11428 |
| Exon 4 | 13888 | 9649 |
| Exon 5 | 25132 | 16094 |
| Exon 6 | 8032 | 10857 |
| Exon 7 | 16989 | 8565 |
| Exon 8 | 7564 | 5826 |
| Exon 9 | 15789 | 20667 |
| Exon 10 | 13476 | 10758 |
| Exon 11 | 17428 | 12633 |
| Exon 12 | 13085 | 9964 |
| Exon 13 | 15714 | 7234 |
| Exon 14 | 10857 | 8574 |
| Exon 15 | 11428 | 9771 |
| Exon 16 | 13308 | 10034 |
| Exon 17 | 18571 | 11241 |
| Exon 18 | 14330 | 12571 |
| Exon 19 | 10094 | 8143 |
| Exon 20 | 22455 | 13215 |
| Exon 21 | 11500 | 10428 |
| Total of | 300,948 | 224,022 |
Claims (1)
1. A kit for labeling and capturing EXONs of the Wilson syndrome-associated ATP7B gene in a plurality of samples based on high throughput sequencing, wherein the EXONs are EXON1, EXON2, EXON3, EXON4, EXON5, EXON6, EXON7, EXON8, EXON9, EXON10, EXON11, EXON12, EXON13, EXON14, EXON15, EXON16, EXON17, EXON18, EXON19, EXON20, and EXON 21; the kit comprises the following primers and joints:
the first round amplification primers comprise:
E1-F CTTCCCCGGTCCCAAATGAAG
E1-R CCTCCTGGTGGGAGTGAGCAC
E2-F TGCCAGAGAAGCTGGGATGTTG
E2-R GCAAACCTGTTGCAGGCACAC
E3-F GAGCCCTGAAACCTCTTGTTCTG
E3-R CGAGGTCTATACGCAGCATTCCT
E4-F GCCCTGCCCACCCAGAGTG
E4-R CAAAGATGGATGTGTCCAAAATGC
E5-F CTGGCTTTCACAGGCTTTCCT
E5-R TTACTTACCTCAATAATTTTGATAATATCC
E6-F CTGCCAATGCATATTTTAACCAAGT
E6-R GAAGGGACTTAGATGAGAGCTGGAG
E7-F AATCCAGGTGACAAGCAGCATC
E7-R GCATGGAAGGGAGAGGTCTGC
E8-F ACTTGCTGGCAGCCTTCACTG
E8-R GATTTGTTTACTGAAGGAGCAGCTC
E9-F CGATAGCTCTCATTTCACATTCTGG
E9-R CACACAGATTGATAGATACCAACCAC
E10-F TGACCCGGTGACCGAATGAGT
E10-R ATGATATCCTCCTGAGGGAACATG
E11-F CAAGTGACAGTTGTCTCTTTCCTACG
E11-R TTCCCAGAACTCTTCACATAATTTCT
E12-F CCATGGTCTTGGTGTTTTATTTTC
E12-R TGAAAGAACAGGATCAATGTCAGTAG
E13-F TGGGAGCTTCCTTATTGAACTCTC
E13-R CATCTCTCAGGATGGGGAAAGC
E14-F CCTCCATCTGTATTGTGGTCAGTG
E14-R GGTGAGGAATAAAAGAGCATTGGC
E15-F TCTTGGCTTACAGTTTCCTCTTCC
E15-R CGTGGTGCTCTCTGTGGTTTGA
E16-F GGACCATTTAGAAATAACCACAGCC
E16-R TTTGCCTGATATCTGCAGAAAACTG
E17-F CCAACTTGTGTAGCTGCTGATGC
E17-R TGGTGCTTACTTTTGTCTCTAACTGC
E1819-F TGATACCTTTTGCCAACACTAGGC
E1819-R TGGGAGACAGAAGCCTTTCTGG
E20F TGGCTCCTCTCCCCAGACCTA
E20-R ACTGTGCTAAGCATGCAGAATGAC
E21-F GAGAGGCCTTCACCAGGCTTAG
E21-R GCCTGCCTGAAGTCATCAGATG
the linker sequences used to attach the first round amplification product at both ends were:
ADP1：5'P-AGGACAGAAGCTCGA-U- TCGAGCTTCTGTCCT-s-T-3'
ADP2：5'P-ACCTTGAGCGATCGA -U- TCGATCGCTCAAGGT-s-T-3'；
the second round amplification primers comprise a primer pair consisting of one or more tag primers selected from the following tag primers, wherein the crosshatched portion is a sequence complementary to the 5' palindromic region of the adaptor ligated in the first round product:
ADP1A：GCTCATTCGAGCTTCTGTCCT
ADP1B：TAGCCTTCGAGCTTCTGTCCT
ADP1C：AGAGGCTCGAGCTTCTGTCCT
ADP1D：TATCCTTCGAGCTTCTGTCCT
ADP1E：CTCTGATCGAGCTTCTGTCCT
ADP2A：GCTCATTCGATCGCTCAAGGT
ADP2B：TAGCCTTCGATCGCTCAAGGT
ADP2C：AGAGGCTCGATCGCTCAAGGT
ADP2D：TATCCTTCGATCGCTCAAGGT
ADP2E：CTCTGATCGATCGCTCAAGGT
wherein, during the second round of amplification, the joints connected with both ends of the target sequence are the same, and the forward tag primer and the reverse tag primer used for the same sample are the same,
wherein, the number of the label sequences multiplied by the number of the joints is more than or equal to the number of the samples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510061690.6A CN105986015B (en) | 2015-02-05 | 2015-02-05 | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510061690.6A CN105986015B (en) | 2015-02-05 | 2015-02-05 | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105986015A CN105986015A (en) | 2016-10-05 |
| CN105986015B true CN105986015B (en) | 2020-10-23 |
Family
ID=57037841
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510061690.6A Active CN105986015B (en) | 2015-02-05 | 2015-02-05 | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105986015B (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106554999B (en) * | 2016-10-25 | 2020-03-17 | 大连晶泰生物技术有限公司 | Sequencing library construction method for high-throughput detection of neonatal diabetes pathogenic gene mutation site, kit and application thereof |
| CN106554955B (en) * | 2016-10-25 | 2020-07-14 | 大连晶泰生物技术有限公司 | Method and kit for constructing sequencing library of PKHD1 gene mutation and application thereof |
| EP3643787A4 (en) * | 2017-06-20 | 2021-01-06 | MGI Tech Co., Ltd. | Pcr primer pair and application thereof |
| CN108004301B (en) * | 2017-12-15 | 2022-02-22 | 格诺思博生物科技南通有限公司 | Gene target region enrichment method and library construction kit |
| EP3752614A4 (en) * | 2018-02-14 | 2021-11-10 | Deep Genomics Incorporated | Oligonucleotide therapy for wilson disease |
| CN110468179B (en) * | 2018-05-10 | 2021-03-05 | 北京大学 | Method for selectively amplifying nucleic acid sequences |
| CN111748611B (en) * | 2019-03-28 | 2021-02-19 | 深圳华大基因科技服务有限公司 | PCR primer and application thereof in DNA fragment connection |
| CN110468188B (en) * | 2019-08-22 | 2023-08-22 | 广州微远医疗器械有限公司 | Tag sequence set for second generation sequencing and design method and application thereof |
| CN111118127B (en) * | 2019-12-28 | 2023-05-02 | 郑州大学 | Specific tag error-proofing kit for second-generation DNA sequencing sample |
| CN112458195B (en) * | 2020-12-28 | 2023-03-24 | 广州迈景基因医学科技有限公司 | Multiplex PCR primer set, kit and method for detecting sexually transmitted pathogens based on high-throughput sequencing |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120244525A1 (en) * | 2010-07-19 | 2012-09-27 | New England Biolabs, Inc. | Oligonucleotide Adapters: Compositions and Methods of Use |
| CN104153004A (en) * | 2014-08-11 | 2014-11-19 | 上海美吉生物医药科技有限公司 | Database-building method for amplicon sequencing |
-
2015
- 2015-02-05 CN CN201510061690.6A patent/CN105986015B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105986015A (en) | 2016-10-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105986015B (en) | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing | |
| CN106555226B (en) | A kind of method and kit constructing high-throughput sequencing library | |
| CN107075513B (en) | Isolated oligonucleotides and their use in nucleic acid sequencing | |
| CN110699426B (en) | Gene target region enrichment method and kit | |
| CN108138364B (en) | Construction method and reagent of nucleic acid single-stranded circular library | |
| EP3555305B1 (en) | Method for increasing throughput of single molecule sequencing by concatenating short dna fragments | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| CN109576346B (en) | Construction method and application of high-throughput sequencing library | |
| EP3674413A1 (en) | Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types | |
| CN111041026B (en) | Nucleic acid linker for high-throughput sequencing and library construction method | |
| CN114901818A (en) | Methods of targeted nucleic acid library formation | |
| CN102839168A (en) | Nucleic acid probe, and preparation method and application thereof | |
| CN110699425B (en) | Enrichment method and system of gene target region | |
| CN116043337A (en) | DNA methylation marker screening kit and method | |
| CN109136217B (en) | Sequencing library construction method, library construction reagent and application thereof | |
| CN101824412B (en) | Method for conducting connection-by-amplification aiming at one or more target genomic regions | |
| CN114277447A (en) | Preparation method of target sequence random sgRNA full-coverage group | |
| CN109825552B (en) | Primer and method for enriching target region | |
| CN115715323A (en) | High-compatibility PCR-free library building and sequencing method | |
| CN105316320B (en) | DNA label, PCR primer and application thereof | |
| CN113136416B (en) | Library construction method for PacBio sequencing | |
| CN114808148A (en) | DNA library construction kit, library construction method and application | |
| CN113544282B (en) | Method for constructing sequencing library based on DNA sample and application | |
| CN112126987A (en) | Library construction method for sequencing methylation amplicon | |
| CN113201793A (en) | Construction method and kit of RNA library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220111 Address after: 116600 no.9-2 Jinqi Road, Dalian Economic and Technological Development Zone, Liaoning Province Patentee after: Dalian Jingtai medical laboratory Co.,Ltd. Address before: 116635 No. 9-2, Jinqi Road, advanced equipment manufacturing park, Dalian Economic and Technological Development Zone, Dalian City, Liaoning Province Patentee before: DALIAN GENTALKER BIOTECHNOLOGY Co.,Ltd. |