CN101824412B - Method for conducting connection-by-amplification aiming at one or more target genomic regions - Google Patents
Method for conducting connection-by-amplification aiming at one or more target genomic regions Download PDFInfo
- Publication number
- CN101824412B CN101824412B CN2010101636482A CN201010163648A CN101824412B CN 101824412 B CN101824412 B CN 101824412B CN 2010101636482 A CN2010101636482 A CN 2010101636482A CN 201010163648 A CN201010163648 A CN 201010163648A CN 101824412 B CN101824412 B CN 101824412B
- Authority
- CN
- China
- Prior art keywords
- dna
- target genome
- genome area
- reverse primer
- polynucleotide amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a public joint design method for conducting connection-by-amplification aiming at one or more target genomic regions. The invention relates to a method for conducting connection-by-amplification aiming at one or more target genomic regions. The method of the invention is suitable for connection-by-amplification aiming at target genomic regions with any length. Obtained non-specific connected long-chain DNA can be applied to kinds of DNA analysis platforms according to research needs. The invention additionally relates to a method for sequence re-sequencing work aiming at one or more target genomic regions to establish a random DNA library. The obtained random DNA library can be used for sequencing methods including a Sanger sequencing technique and a sequencing-by-synthesis technique to re-sequence the sequences of one or more target genomic regions.
Description
The application is to be that August 15, application number in 2007 are dividing an application of 200710143624.9 patent application of the same name the applying date.
Technical field
The present invention relates to a kind of public connectors method of design of carrying out the connection of amplification edges limit at one or more target genome areas.The present invention relates to a kind of method of carrying out the connection of amplification edges limit at one or more target genome areas again.The method of the invention is applicable to that the amplification edges limit at the target genome area of random length connects work, and the long-chain DNA of resulting non-special connection can be applied to multiple DNA analysis platform according to the research needs.The invention still further relates to a kind of at one or more target genome area sequences resurvey preface work, set up the method in random dna library, gained random dna library can be used for by comprise the Sanger sequencing technologies, the sequence measurement of sequencing technologies is to described one or more target genome area sequences preface of resurveying while synthesizing.
Background technology
From nineteen eighty-three Kary Mullis invention polymerase chain reaction (polymerase chainreaction, PCR) since, went through for three more than ten years, round pcr become bio-science field indispensable, use experimental technique widely.Be different experiment purposes, on Standard PC R basis, derive RT-PCR (Reverse Transcriptase PCR again, reverse transcription PCR), Inverse PCR (inverse PCR), In Situ PCR (original position PCR), Long PCR (long PCR), Real Time PCR (PCR in real time), Single Cell PCR (unicellular PCR), Hot Start PCR (heat start PCR), Colony PCR (bacterium colony PCR), AFLPPCR multinomial technique means such as (Amplified Fragment Length Polymorphism PCR, amplification fragment length polymorphism PCR).We can say that since round pcr came out, molecular biology and the genomics based on the large scale sequencing reaction had afterwards all obtained development at full speed.
The present invention uses base complementrity paired ultimate principle, the primer that contains the target genome area of " public connectors " by design, behind first round polynucleotide amplification reaction, second takes turns in the polynucleotide amplification reaction, target genome area is connected i.e. " connection of amplification edges limit " efficiently on the basis of amplification.Connection work is undertaken by random sequence, and this in the context of the present invention random sequence ways of connecting is called " non-special connection ".Connect through the amplification edges limit and to obtain the long-chain DNA that the dna fragmentation by target genome area forms through " non-special connection ", this long-chain DNA can be applied to multiple DNA analysis platform according to the research needs.
" connection of the amplification edges limit " method that proposes by the present invention obtains long-chain DNA, and interrupt method at random and interrupt through DNA, can set up be used for by comprise the Sanger sequencing technologies, the sequence measurement of sequencing technologies is to the resurvey random dna library of preface work of described one or more target genome area sequences while synthesizing.
The amplification edges limit that the present invention can apply to a target genome area connects and work is set up in the random dna library, also can be used for two and plural a plurality of amplification edges of target genome area edges connection and random dna library and sets up work.
The difference of purpose of design, " connection of amplification edges limit " reaction that the present invention is proposed has essential difference with the same PCR method of connecting of joint design of using: series connection PCR is the needs according to concrete research, carry out special joint design, DNA with this genus genome different zones, or even the genomic dna segment of different plant species carries out " specificity " and connects, to obtain research needed " functional DNA fragment ".And the present invention is in order to obtain the long-chain DNA of specific amplified, " non-special connection ".
In the present invention, add respectively that except that 5 ' end and 3 ' end in the design of primers of target genome area the public connectors of a pair of reverse complemental that the present invention proposes, the two-wheeled polynucleotide amplification reaction all need not special processing at forward primer and reverse primer; The generation of non-special connection long-chain DNA need not " ligase enzyme " effect.
The long-chain DNA that the present invention obtains can break through the restriction of long PCR (LongPCR) the method purpose fragment length under fidelity requires to limit, and can remove from and use test kit that comprises the specific enzymes material and the trouble that designs stricter primer; Compare with series connection PCR (overlap PCR) method of the joint of the special pairing of connecting zone with use, the present invention only need design a pair of public connectors, take turns second and to utilize public connectors that target genome area original DNA fragment is connected by random sequence in the polynucleotide amplification reaction, removed from again design many to can be used for the operation of special placed in-line complementary primer, concerning the technician of the industry laboratory work involved in the present invention be simple and expense very low.
Summary of the invention
The present invention is based on following understanding: same a pair of " public connectors " (the Universal Adaptor) that in every pair of design of primers of target genome area, adds reverse complemental, the original DNA segment of target genome area is carried out the specificity polynucleotide amplification be connected, form the long-chain DNA mixture that is formed by connecting by random sequence by the target genome area dna fragmentation with non-enzyme process.
The long-chain DNA that the present invention obtains can use on many DNA analysis platforms, and the preface work of resurveying especially has great importance to high-throughput.Through such as ultrasonic method, spray method, chemical shearing method, enzyme shearing method etc. after interior DNA interrupts method at random and interrupts, can regain and contain the segmental dna fragmentation of target genome area, these dna fragmentations can be contained whole target area efficiently, with its random dna library (DNA library) as the preface work of resurveying, the high-throughput that can the carry out target genome area effectively preface work of resurveying.
One aspect of the present invention, relate to a kind of public connectors that is used for carrying out the connection of amplification edges limit at one or more target genome areas, its be two with 5 ' → 3 ' direction with the oligonucleotide sequence of 3 ' → 5 ' direction base complementrity, its sequence structure feature is: 1) do not combine with the target gene group under the polynucleotide amplification reaction annealing temperature; 2) self does not form secondary structures such as hair clip; 3) content of cytosine(Cyt) and guanine accounts for the 20%-80% of four kinds of base quantity summations; And 4) sequence length is 7-100 base.Concrete, a 5 ' end that is added in the polynucleotide amplification reaction forward primer in the described a pair of public connectors, with it complementary another be added in 5 ' end of polynucleotide amplification reaction reverse primer.
Among the present invention, be added in the primer two ends and do not influence target genome area is increased for satisfying, requirement for reducing cost simultaneously, the length of described public connectors should be selected short oligonucleotide sequence as far as possible, and its length suitably is 8-50 base, be preferably 0 base of 9-4, more preferably 10-30 base, more preferably 11-25 base, more preferably 12-20 base, 13-18 base more preferably, even 17 bases more preferably.
Another aspect of the invention relates to a kind of method of carrying out the connection of amplification edges limit at a target genome area, comprises step:
1) at a target genome area, design comprises the forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors of the present invention, wherein public connectors reverse complemental each other in forward and the reverse primer;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the amplification target genome area obtains the connectivity dna fragmentation at described target genome area 5 ' end and 3 ' end adding public connectors of the present invention;
3) step 2) the connectivity dna fragmentation of Huo Deing carries out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting of gained connectivity dna fragmentation.
In the present invention, described target gene group sequence area can be the target genome area of random length, include but not limited to the sequence of length 70-10000 base, for example, length is in the sequence of 100-3000 base, length is in the sequence of 300-2000 base, and length is in the sequence of 700-1000 base.
In still another aspect of the invention, relate to and a kind ofly carry out the method that the amplification edges limit connects, comprise step at two and plural a plurality of target genome area:
1) at each zones of a plurality of target genome areas, design comprises the forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors of the present invention respectively, wherein the every pair of forward and the contained public connectors of reverse primer reverse complemental each other;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the target genome area that increases respectively obtains the different connectivity dna fragmentations at each target genome area 5 ' end and 3 ' end adding public connectors of the present invention;
3) with step 2) the different connectivity dna fragmentations that obtain mix equally, carry out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting by the order of connection at random of the different connectivity dna fragmentation of gained.
In the context of the invention, described first round polynucleotide amplification reaction is meant conventional polynucleotide amplification reaction, for example comprise in the polynucleotide amplification reaction instrument at first elevated temperature, the two strands of original DNA is untwisted, open, reduce temperature immediately, just make, reverse primer respectively with the pairing of 5 ' and 3 ' terminal sequence of target gene group sequence, in conjunction with, and under the effect of polynucleotide polysaccharase, according to the base complementrity pair principle, order with 5 ' → 3 ', free dNTPs in the reaction system of interpolation polynucleotide amplification reaction, through " sex change-annealing-extension " process repeatedly, make that described target genome area original DNA sequence is increased efficiently.In the context of the present invention, the target genome area of the required amplification of first round polynucleotide amplification reaction is called target genome area original DNA sequence, behind first round polynucleotide amplification, obtain the target genome area that 5 ' end and 3 ' end add public connectors of the present invention, be called " connectivity dna fragmentation ".
In the context of the invention, described second takes turns polynucleotide amplification reaction is meant " the connectivity dna fragmentation " that obtains at first round polynucleotide amplification reaction of the present invention, as second template of taking turns polynucleotide amplification reaction, untwist at the dna double chain, after opening, under the guide of base complementrity pair principle, article one, the public connectors held of the strand 3 ' of complementary connectivity dna fragmentation is paired with each other with it with another for the public connectors of the strand 3 ' of connectivity dna fragmentation end, as second primer of taking turns polynucleotide amplification reaction, need not to add in addition under the condition of special primer, carrying out the connection and the polynucleotide amplification reaction of connectivity dna fragmentation.Amplification is carried out with being connected simultaneously, therefore is called " connection of amplification edges limit " reaction.
Take turns in the polynucleotide amplification reaction second, need not the processing of ligase enzyme, the original DNA fragment can be carried out the connection of random sequence in amplification under the leading of public connectors, form " the long-chain DNA of non-special connection ".In the context of the present invention, be also referred to as " non-special connection " by the random sequence ways of connecting.
In the context of the invention, take turns second and to carry out balanced mix according to first round gained DNA output size in the polynucleotide amplification reaction and be meant, mix according to the equimolar amount of first round polynucleotide amplification reaction product.Concrete, available for example Hoechst dyestuff H33258 or Picogreen carry out accurately quantitatively first round polynucleotide amplification reaction products therefrom.Also can carry out quantitatively rough with the DNA Marker comparison of known quantity by the polynucleotide amplification product is carried out gel electrophoresis.
In the context of the invention, describedly carry out amplification edges limit synthetic method at a plurality of target genome areas, be suitable for two or more any a plurality of target genome areas, comprise 2 and greater than 2 arbitrary integer.For example, it is synthetic that described method can be carried out the amplification edges limit at 2-10000000 target genome area, 2-1000000 target genome area for example, 2-100000 target genome area, 2-1000 target genome area, 2-100 target genome area.
Another aspect of the invention relates to a kind of foundation at the resurvey method in preface random dna library of a target genome area sequence, comprises step:
1) at a target genome area, design comprises the forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors of the present invention, wherein public connectors reverse complemental each other in forward and the reverse primer;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the amplification target genome area obtains the connectivity dna fragmentation at described target genome area 5 ' end and 3 ' end adding public connectors of the present invention;
3) step 2) the connectivity dna fragmentation of Huo Deing carries out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting of gained connectivity dna fragmentation;
4) the long-chain DNA of step 3) gained is interrupted method at random with DNA and interrupt, obtain the random dna library.
Of the present inventionly relate to a kind of foundation at the resurvey method in preface random dna library of two and plural a plurality of target genome area more on the one hand, comprise step:
1) at each zones of a plurality of target genome areas, design comprises the forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors of the present invention respectively, wherein the every pair of forward and the contained public connectors of reverse primer reverse complemental each other;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the target genome area that increases respectively obtains the different connectivity dna fragmentations at each target genome area 5 ' end and 3 ' end adding public connectors;
3) with step 2) the different connectivity dna fragmentations that obtain mix equally, carry out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting by the order of connection at random of the different connectivity dna fragmentation of gained;
4) the long-chain DNA of step 3) gained is interrupted method at random with DNA and interrupt, obtain the random dna library.
In the context of the invention, described foundation is suitable for two or more any a plurality of target genome areas at the resurvey method in preface random dna library of a plurality of target genome areas, comprises 2 and greater than 2 arbitrary integer.For example, it is synthetic that described method can be carried out the amplification edges limit at 2-10000000 target genome area, 2-1000000 target genome area for example, 2-100000 target genome area, 2-1000 target genome area, 2-100 target genome area.
In the context of the invention, interrupt the described DNA of gained long-chain dna sequence dna and interrupt the known method that interrupts dna sequence dna in this area that method comprises ultrasonic method, spray method, chemical shearing method, enzyme shearing method etc. at random.
Description of drawings
Fig. 1 has described the flow process of utilizing public connectors to carry out the amplification edges of target genome area edges ligation.Wherein
Figure 1A example the design of primers process, concrete, (1) is shown as the primer that designs, and comprises the public connectors (Universal Adaptor) of black and original primer two portions of target genome area of pattern; (2) show designed primer, in the annealing process of first round polynucleotide amplification reaction, can match the specific amplification of guiding target genome area original DNA sequence with target genome area.
Figure 1B example first round polynucleotide amplification reaction: the primer that contains public connectors that will design makes the amplification of specific target genome area, obtains target genome area original DNA sequence 5 ' end and 3 ' and holds the connectivity dna fragmentation (4) that adds public connectors.Wherein, polynucleotide amplification reaction target genome area that only increases.If the target genome area number is greater than 1, then the polynucleotide amplification reaction of each target genome area needs independently to carry out.
Fig. 1 C example second take turns polynucleotide amplification and ligation (ligation of amplification edges limit).Specifically in two kinds of situation:
1), be that template, public connectors are that primer carries out second and takes turns the polynucleotide amplification reaction (not shown) with first round polynucleotide amplification product at a target genome area;
2) at two and plural a plurality of target genome area, the connectivity dna fragmentation that first round polynucleotide amplification is obtained carries out balanced mix, it is that primer carries out second and takes turns polynucleotide amplification reaction that mixture is taken turns polynucleotide amplification reaction template, public connectors as second, shown in (2)-(3)-(4);
Wherein, the public connectors of reverse complemental is paired with each other at the polynucleotide amplification reaction annealing stage, as second primer of taking turns polynucleotide amplification reaction, the strand that makes the connectivity dna fragmentation separate supination extends under the effect of polynucleotide polysaccharase, forms double-stranded DNA, obtains the long-chain DNA of non-special connection.Amplification and ligation are carried out simultaneously, are called " connection of amplification edges limit " reaction.
The long-chain DNA that obtains can use similar full genome to smash the strategy of back order-checking, interrupt method by (5) at random with DNA long-chain DNA is interrupted, sets up the random dna library, usefulness comprises the Sanger sequencing technologies again, sequencing technologies checks order at interior sequence measurement while synthesizing.
Fig. 2 is through first round polynucleotide amplification reaction among the embodiment 1, the gel electrophoresis figure of " the connectivity dna fragmentation " that obtains, wherein 9 connectivity dna fragmentations are 9 target genome area CSF1R-10, CSF1R-18, JAK2-1, JAK2-5, JAK2-9, JAK2-12, KRAS-1,5 ' end of KRAS-4 and NRAS-1 original series is connected public connectors (each 20 base with 3 ' end, amount to 40 bases) after product, use CSF1R-10 ' (483bp), CSF1R-18 ' (375bp), JAK2-1 ' (524bp), JAK2-5 ' (595bp), JAK2-9 ' (556bp), JAK2-12 ' (490bp), KRAS-1 ' (531bp), KRAS-4 ' (404bp) and NRAS-1 ' (419bp) represent.Wherein the size of NRAS-1 ' (about 500bp) is not inconsistent with theoretical value (419bp) on the glue figure, and the preface of resurveying result proves that there is non-specific amplification in NRAS-1.
Fig. 3 is for second taking turns polynucleotide amplification and ligation, i.e. the gel electrophoresis figure of " the long-chain DNA of non-special connection " that amplification edges limit ligation obtains among the embodiment 1;
Fig. 4 for the long-chain DNA product of non-special connection that the ligation of amplification edges limit is obtained with ultrasonic method interrupt, build the storehouse, with the order-checking of Sanger sequencing technologies, the resulting sequencing fragment result who contains the heterozygosis site.Wherein after the long-chain DNA product of non-special connection being interrupted, set up pUC 118DNA library with ultrasonic method, and on the 3730x1 of ABI company sequenator with the preface work of resurveying of Sanger sequencing.Show for the CSF1R-10 heterozygosis site that obtains after the preface of resurveying shown in the figure.
Fig. 5 is the gel electrophoresis figure of the long-chain DNA of the non-special connection of gained among the embodiment 2.
Fig. 6 is a gained gel electrophoresis figure among the embodiment 3, a part (called after BRCA2-10j in the present embodiment) of wherein selecting the 10th exon of candidate gene BRCA2 relevant with cancer in the human genome is as a target genome area, utilize public connectors (each 17 base, totally 34 bases), through the two-wheeled polynucleotide amplification reaction, with a target genome area amplification and be connected to form long-chain DNA.
Fig. 7 is a gained endonuclease reaction electrophorogram among the embodiment 4.Wherein select the 6th the exon (sequence length: 446 of candidate gene BRCA2 relevant in the human genome with cancer, the 167th base place in 5 ' to 3 ' direction contains a BamH I restriction enzyme site) as a target genome area, utilize public connectors (each 17 base, totally 34 bases), through the two-wheeled polynucleotide amplification reaction, with amplification of target genome area and the long-chain DNA that is connected to form, subsequently with first round polynucleotide amplification reaction product with through two-wheeled polynucleotide reaction amplification, connect the long-chain DNA that obtains isopropanol precipitating method purifying, and cut with the BamHI enzyme under the same conditions.
Embodiment
Detailed process is as follows:
1. design of primers:
Select the 10th of candidate gene CSF1R gene relevant in the human genome with cancer, 18 exons, the 1st of JAK2 gene, 5,9,12 exons, the 1st of KRAS gene, the 1st exon of 4 exons and NRAS gene is as target genome area original DNA fragment, with 9 pairs of primers of Primer 3 software designs, in 9 pairs of primers, add CGCGGATCC GCGGCCGC TTC sequence for forward primer, add GAA GCGGCCGC GGATCC GCG sequence (all being increased in 5 ' end of primer sequence) at reverse primer, these two sections oligonucleotide sequence reverse complementals, public connectors for present embodiment, wherein GGATCC is a Bam HI restriction enzyme site, and GCGGCCGC is a Not I restriction enzyme site.
The primer that designs is (underscore partly is the public connectors sequence):
CSF1R-10 (sequence length: 443):
Forward primer:
CGCGGATCCGCGGCCGCTTCGAGCACCCACTGTGTTCCAG
Reverse primer:
GAAGCGGCCGCGGATCCGCGTGATTAGCACCTGTCTCTCGC
CSF1R-18 (sequence length: 335):
Forward primer:
CGCGGATCCGCGGCCGCTTCTCCAACTACATTGTCAAGGGC
Reverse primer:
GAAGCGGCCGCGGATCCGCGCATTCCTGCACTCTCACCAAC
JAK2-1 (sequence length: 484):
Forward primer:
CGCGGATCCGCGGCCGCTTCTTCTGGGCTCAAGCTATCTGC
Reverse primer:
GAAGCGGCCGCGGATCCGCGAACACACACGCCAGCCATAC
JAK2-5 (sequence length: 555):
Forward primer:
CGCGGATCCGCGGCCGCTTCCACTTGGCCACTGTGTTGTAA
Reverse primer:
GAAGCGGCCGCGGATCCGCGAATGGGAGAAGTGCAATACCA
JAK2-9 (sequence length: 516):
Forward primer:
CGCGGATCCGCGGCCGCTTCGGCACTACATCGGATTCATGG
Reverse primer:
GAAGCGGCCGCGGATCCGCGGAACTTCAAGTCACTTCTAGACCACC
JAK2-12 (sequence length: 450):
Forward primer:
CGCGGATCCGCGGCCGCTTCGCCTGTTTGACTGGCATTATTC
Reverse primer:
GAAGCGGCCGCGGATCCGCGCTGACACCTAGCTGTGATCCTG
KRAS-1 (sequence length: 491):
Forward primer:
CGCGGATCCGCGGCCGCTTCTCTTAAGCGTCGATGGAGGAG
Reverse primer:
GAAGCGGCCGCGGATCCGCGTTGAAACCCAAGGTACATTTCAG
KRAS-4 (sequence length: 364):
Forward primer:
CGCGGATCCGCGGCCGCTTCTCAGTTGCCTGAAGAGAAACATAA
Reverse primer:
GAAGCGGCCGCGGATCCGCGTAACAGTCTGCATGGAGCAGG
NRAS-1 (sequence length: 379):
Forward primer:
CGCGGATCCGCGGCCGCTTCCCAAATGGAAGGTCACACTAGG
Reverse primer:
GAAGCGGCCGCGGATCCGCGGAACTCAACACTGAGTTTGCAATAG
2. first round polynucleotide amplification reaction:
Nine pulsating amplified reactions of target genome area original DNA independently carry out.
Polynucleotide amplification system (10 μ l): DNA (5ng/ μ l): 1 μ l, primer (10 μ M): each 0.4 μ l of forward and reverse primer, Taq archaeal dna polymerase (5U/ μ l): 1 μ l, 10 * buffer:5 μ l, dNTPs (2.5mM): 0.8 μ l, ddH
2O:1.4 μ l.
Polynucleotide amplification reaction program (on GeneAmp 9700 polynucleotide amplification reaction instrument, reacting):
94 degree/10 minutes
/ 30 seconds-58 degree of 94 degree were spent/1 minute, 40 circulations in/30 seconds-72
72 degree/5 minutes.
After first round polynucleotide amplification reaction finishes, acquisition connects the CSF1R-10 that can be used for " connection of amplification edges limit " reaction of public connectors at two ends, CSF1R-18, JAK2-1, JAK2-5, JAK2-9, JAK2-12, KRAS-1, KRAS-4 and NRAS-1 be totally nine kinds of connectivity dna fragmentations, represents with CSF1R-10 ', CSF1R-18 ', JAK2-1 ', JAK2-5 ', JAK2-9 ', JAK2-12 ', KRAS-1 ', KRAS-4 ' and NRAS-1 '.According to amplification output, nine kinds of products mix in the mode that waits the DNA amount, as second template of taking turns polynucleotide amplification and ligation.
Experiment glue figure sees Fig. 2.
3. second take turns polynucleotide amplification and ligation (ligation of amplification edges limit):
Polynucleotide amplification system (20 μ l): template: 8 μ l, Taq archaeal dna polymerase (5U/ μ l): 2 μ l, 10 * buffer:2 μ l, dNTPs (2.5mM): 1.6 μ l, ddH
2O:6.4 μ l.Wherein template is taken from the equal amount of mixture of first round polynucleotide amplification reaction products therefrom.
Polynucleotide amplification program (on GeneAmp 9800 polynucleotide amplification reaction instrument, reacting):
94 degree/2 minutes
/ 30 seconds-68 degree of/15 seconds-60 degree of 94 degree/8 minutes ,/30 seconds-68 degree/8 minutes (every take turns circulation increase by 20 seconds) of/15 seconds-60 degree of 10 circulation 94 degree, totally 15 circulations
72 degree/10 minutes.
Second takes turns polynucleotide amplification and ligation finish after, obtain " the long-chain DNA of non-special connection ".
The epicycle polynucleotide amplification reaction need not to add primer, and ligation need not to add ligase enzyme.The electrophoresis detection glue figure of the long-chain DNA of the non-special connection that obtains sees Fig. 3.
4. set up vector library, use the order-checking of Sanger sequencing technologies:
The utilization ultrasonic method interrupts the long-chain DNA of acquired non-special connection.Get length and set up pUC 118 DNA libraries, and on the 3730x1 of ABI company sequenator, check order with the Sanger sequencing technologies in the fragment of 1.5～2kb.Product sequencing result behind the result of sequencing fragment and the original DNA fragment first round polynucleotide amplification is compared, with the sequence location of definite " interrupting the back dna fragmentation ", and the checking sequencing quality.
Statistical result showed: contain 17 of CSF1-10 fragments in the dna fragmentation after interrupting, 21 of CSF1R-18 fragments, 12 of JAK2-1 fragments, 55 of JAK2-5 fragments, 21 of JAK2-9 fragments, 40 of JAK2-12 fragments, 19 of KRAS-1 fragments, 45 of KRAS-4 fragments, 36 of NRAS-1 fragments, obtain altogether and effectively read long 7274bp, account for 63.89% of total order-checking amount.Read in the length in the order-checking of remainder, the non-specific amplification product reaches 20.37%, can reduce non-specific amplification by improving the segmental primer quality of original DNA, improves the efficient that checks order.
The statistics that obtains effectively to read long dna fragmentation is shown, acquired dna fragmentation can cover nine target genome areas in the present embodiment fully, and can effectively detect in the present embodiment whole heterozygosis site of being contained in nine target genome area original DNA fragments.Fig. 4 has shown one of them heterozygosis site from the CSF1-10 sequence.
Embodiment 2:
Present embodiment selects for use 70 exons of relevant candidate gene BRCA1 of cancer in the human genome and BRCA2 gene as target genome area, by two-wheeled polynucleotide reaction amplification, connect.
Detailed process is as follows:
1. design of primers:
70 exons selecting candidate gene BRCA1 relevant with cancer in the human genome and BRCA2 gene are as 70 target genome areas, with 70 pairs of primers of Primer3 software design, a GTAAAACGACGGCCAGT sequence that adds 17 base length in every pair of primer, another adds the ACTGGCCGTCGTTTTAC sequence (all being increased in 5 ' end of primer sequence) of 17 base length, these two sections oligonucleotide sequence reverse complementals are the public connectors of this experiment.
With the 1st, the 10th exon of BRCA1 gene and BRCA2 gene the 5th, the 24th exon is example, and the primer that designs is (underscore partly is the public connectors sequence):
BRCA1-1 (sequence length: 530):
Forward primer:
GTAAAACGACGGCCAGTATTGCGCCATCACACTCTAGC
Reverse primer:
ACTGGCCGTCGTTTTACTTTGTGCTCATGGCAGATTTC;
BRCA1-18 (sequence length: 548):
Forward primer:
GTAAAACGACGGCCAGTGGGTTTCTCTTGGTTTCTTTGA
Reverse primer:
ACTGGCCGTCGTTTTACGTTGCCAGAATAAATGAAAATGGT
BRCA2-5 (sequence length: 451):
Forward primer:
GTAAAACGACGGCCAGTCAATGTACACATGTAACACCACAAA
Reverse primer:
ACTGGCCGTCGTTTTACCCAAGACATATCAGGATCCACCT
BRCA2-24 (sequence length: 452):
Forward primer:
ACTGGCCGTCGTTTTACTCAGCTATTTTGATTTGCTTTTATT
Reverse primer:
GTAAAACGACGGCCAGTAGCTATTTCCTTGATACTGGACTG
2. first round polynucleotide amplification reaction:
Polynucleotide amplification system (10 μ l): DNA (5ng/ μ l): 1 μ l, primer (5 μ M): each 0.4 μ l of forward and reverse primer, Taq archaeal dna polymerase (5U/ μ l): 1 μ l, 10 * buffer:1 μ l, dNTPs (2.5mM): 0.8 μ l, ddH
2O:5.4 μ l.
Polynucleotide amplification reaction program (on GeneAmp 9700 polynucleotide amplification reaction instrument, reacting):
94 degree/5 minutes
/ 30 seconds-62 degree of 94 degree were spent/35 seconds, 40 circulations in/35 seconds-72
72 degree/10 minutes.
After first round polynucleotide amplification reaction finishes, obtain to hold the 70 kinds of products that can be used for " the amplification edges limit is connected " reaction that connect public connectors at the 5 ' end and 3 ' of 70 target genome area original series.According to amplification output, 70 kinds of products mix in the mode that waits the DNA amount, as second template of taking turns polynucleotide amplification and ligation.
3. second take turns polynucleotide amplification and ligation (ligation of amplification edges limit):
Polynucleotide amplification system (20 μ l): template: 6 μ l, Taq archaeal dna polymerase (5U/ μ l): 2 μ l, 10 * buffer:2 μ l, dNTPs (2.5mM): 1.6 μ l, ddH
2O:8.4 μ l.Wherein template is taken from the equal amount of mixture of first round polynucleotide amplification reaction products therefrom.
Polynucleotide amplification program (on GeneAmp 9800 polynucleotide amplification reaction instrument, reacting):
94 degree/2 minutes
/ 30 seconds-68 degree of/15 seconds-60 degree of 94 degree/8 minutes ,/30 seconds-68 degree/8 minutes (every take turns circulation increase by 20 seconds) of/15 seconds-60 degree of 10 circulation 94 degree, totally 15 circulations
72 degree/10 minutes.
Second takes turns polynucleotide amplification and ligation finish after, obtain " the long-chain DNA of non-special connection ".
The epicycle polynucleotide amplification reaction need not to add primer, and ligation need not to add ligase enzyme.The electrophoresis detection glue figure of the long-chain DNA of the non-special connection that obtains sees Fig. 5.
4. the order-checking sequencing technologies checks order while synthesizing to set up random dna library, use:
According to the requirement of Illumina Genome Analyer sequenator working conditions, the utilization spray method interrupts the long-chain DNA of acquired non-special connection, get length and set up the random dna library in the fragment of 100-200bp, sequencing technologies checks order while synthesizing in utilization on Illumina Genome Analyer sequenator.The result of sequencing fragment and the base sequence of target area are compared, with the sequence location of definite " interrupting the back dna fragmentation ", and the checking sequencing quality.
Statistical result showed: 70 target genome areas are all compared success, and fraction of coverage all reaches 100%, and on average the number of times of each base covering reaches 2000 times.To the analysis in heterozygosis site show the long-chain DNA that uses the non-special connection of method synthetic target genome area that the present invention proposes, in conjunction with sequencing technologies checks order while synthesizing, can effectively detect all heterozygosis sites.Resurvey the preface result relatively with the Sanger method, non-false positive and false negative with the PCR product of 70 target genome areas.
Embodiment 3:
Present embodiment selects for use the part (called after BRCA2-10j in the present embodiment) of the 10th exon of the relevant candidate gene BRCA2 of cancer in the human genome as target genome area, by two-wheeled polynucleotide reaction amplification, connect.
Detailed process is as follows:
1. design of primers:
The part (called after BRCA2-10j in the present embodiment) of the 10th exon of the candidate gene BRCA2 relevant with cancer is as a target genome area in the selection human genome, with Primer3 software design primer, sequence GTAAAACGACGGCCAGT who adds 17 base length in forward primer, in reverse primer, add the ACTGGCCGTCGTTTTAC sequence (all being increased in 5 ' end of primer sequence) of 17 base length, these two sections oligonucleotide sequence reverse complementals are the public connectors of this experiment.
The primer that designs is (underscore partly is the public connectors sequence):
BRCA2-10j (sequence length: 478):
Forward primer:
GTAAAACGACGGCCAGTAAAGATGAAACGGACTTGCTATT
Reverse primer:
ACTGGCCGTCGTTTTACGTTGTCCCTGGAAGGTCACTA.
2. first round polynucleotide amplification reaction:
Polynucleotide amplification system (10 μ l): DNA (5ng/ μ l): 1 μ l, primer (5 μ M): each 0.4 μ l of forward and reverse primer, Taq archaeal dna polymerase (5U/ μ l): 1 μ l, 10 * buffer:1 μ l, dNTPs (2.5mM): 0.8 μ l, ddH
2O:5.4 μ l.
Polynucleotide amplification reaction program (on GeneAmp 9700 polynucleotide amplification reaction instrument, reacting):
94 degree/5 minutes
/ 30 seconds-62 degree of 94 degree were spent/35 seconds, 40 circulations in/35 seconds-72
72 degree/10 minutes.
After first round polynucleotide amplification reaction finishes, obtain to hold the further connectivity dna fragmentation that is connected that can be used for that connects public connectors: BRCA2-10j ' (sequence length: 512) at the 5 ' end and 3 ' of this target genome area original series.
Experiment glue figure sees Fig. 6.
3. second take turns polynucleotide amplification and ligation:
Polynucleotide amplification system (20 μ l): template: 8 μ l, Taq archaeal dna polymerase (5U/ μ l): 2 μ l, 10 * buffer:2 μ l, dNTPs (2.5mM): 1.6 μ l, ddH
2O:6.4 μ l.Wherein template is taken from first round polynucleotide amplification reaction products therefrom.
Polynucleotide amplification program (on GeneAmp 9800 polynucleotide amplification reaction instrument, reacting):
94 degree/2 minutes
/ 15 seconds-60 degree of 94 degree were spent/8 minutes, 10 circulations in/30 seconds-68
/ 30 seconds-68 degree/8 minutes (every take turns circulation increase by 20 seconds) of/15 seconds-60 degree of 94 degree, totally 15 circulations
72 degree/10 minutes.
Second takes turns polynucleotide amplification and ligation finish after, obtain " the long-chain DNA of non-special connection ".
The epicycle polynucleotide amplification reaction need not to add primer, and ligation need not to add ligase enzyme.The electrophoresis detection glue figure of the long-chain DNA of the non-special connection that obtains sees Fig. 6.
Embodiment 4:
Present embodiment is selected the 6th the exon (sequence length: 446 of the candidate gene BRCA2 that cancer is relevant in the human genome for use, the 167th base place in 5 ' → 3 ' direction contains a BamH I restriction enzyme site) as a target genome area, increase, connect into long-chain DNA by the two-wheeled polynucleotide amplification reaction.First round polynucleotide amplification reaction product with through the reaction amplification of two-wheeled polynucleotide, be connected the long-chain DNA that obtains behind isopropanol precipitating method purifying, carry out BamH I enzyme under the same conditions and cut.
Detailed process is as follows:
1. design of primers:
Select target genome area of conduct of the 6th exon of candidate gene BRCA2 relevant in the human genome with cancer, with Primer3 software design primer, sequence GTAAAACGACGGCCAGT who adds 17 base length in forward primer, in reverse primer, add the ACTGGCCGTCGTTTTAC sequence (all being increased in 5 ' end of primer sequence) of 17 base length, these two sections oligonucleotide sequence reverse complementals are the public connectors of this experiment.
The primer that designs is (underscore partly is the public connectors sequence):
BRCA2-6 (sequence length: 446):
Forward primer:
GTAAAACGACGGCCAGTTTCTGCCTCATACAGGCAATTC
Reverse primer:
ACTGGCCGTCGTTTTACCATAATGCTTGACACCACTGGAC.
2. first round polynucleotide amplification reaction:
Polynucleotide amplification system (10 μ l): DNA (5ng/ μ l): 1 μ l, primer (5 μ M): each 0.4 μ l of forward and reverse primer, Taq archaeal dna polymerase (5U/ μ l): 1 μ l, 10 * buffer:1 μ l, dNTPs (2.5mM): 0.8 μ l, ddH
2O:5.4 μ l.
Polynucleotide amplification reaction program (on GeneAmp 9700 polynucleotide amplification reaction instrument, reacting):
94 degree/5 minutes
/ 30 seconds-58 degree of 94 degree were spent/35 seconds, 40 circulations in/35 seconds-72
72 degree/10 minutes.
After first round polynucleotide amplification reaction finishes, obtain to hold the further connectivity dna fragmentation that is connected that can be used for that connects public connectors: BRCA2-6 ' (sequence length: 480) at the 5 ' end and 3 ' of this target genome area original series.
Experiment glue figure sees Fig. 7.
3. second take turns polynucleotide amplification and ligation:
Polynucleotide amplification system (20 μ l): template: 8 μ l, Taq archaeal dna polymerase (5U/ μ l): 2 μ l, 10 * buffer:2 μ l, dNTPs (2.5mM): 1.6 μ l, ddH
2O:6.4 μ l.Wherein template is taken from first round polynucleotide amplification reaction products therefrom.
Polynucleotide amplification program (on GeneAmp 9800 polynucleotide amplification reaction instrument, reacting):
94 degree/1 minute
94 degree were spent/15 minutes, 14 circulations in/10 seconds-68
/ 10 seconds-68 degree/15 minutes (every take turns circulation increase by 15 seconds) of 94 degree, totally 16 circulations
72 degree/10 minutes.
Second takes turns polynucleotide amplification and ligation finish after, obtain " the long-chain DNA of non-special connection ".
The epicycle polynucleotide amplification reaction need not to add primer, and ligation need not to add ligase enzyme.The electrophoresis detection glue figure of the long-chain DNA of the non-special connection that obtains sees Fig. 7.
4.BamH the I enzyme is cut:
At first product that first round polynucleotide amplification reaction is obtained and the long-chain DNA that increases, is connected acquisition through the reaction of two-wheeled polynucleotide carry out purifying with the isopropanol precipitating method.Detailed process is as follows:
Get first round polynucleotide amplification reaction amplified production 100 μ l, add 100 μ l Virahols, 10 μ lNaCl
2(6mM) ,-80 ℃ after freezing 1 hour under 4 ℃ of temperature condition, 13, centrifugal 30 minutes of 000r pm rotating speed, add 500 μ l, 80% ethanol after the abandoning supernatant, under 4 ℃ of temperature condition, 13, centrifugal 10 minutes of 000rpm rotating speed, abandoning supernatant, room temperature is dried, and adds 100 μ ll ddH
2O mixes.Recording purifying after product concentration with NanoDrop nucleic acid-protein determinator ND-1000 is: 37.9ng/ μ l;
The long-chain DNA product 30 μ l that the two-wheeled polynucleotide of learning from else's experience reaction amplification, connection obtain add 30 μ l Virahols, 3 μ l NaCl
2(6mM) ,-80 ℃ after freezing 1 hour under 4 ℃ of temperature condition, 13, centrifugal 30 minutes of 000rpm rotating speed, add 500 μ l, 80% ethanol after the abandoning supernatant, under 4 ℃ of temperature condition, 13, centrifugal 10 minutes of 000rpm rotating speed, abandoning supernatant, room temperature is dried, and adds 100 μ lddH
2O mixes.Recording purifying after product concentration with NanoDrop nucleic acid-protein determinator ND-1000 is: 35.0ng/ μ l.
Product behind the purifying is carried out the BamHI enzyme under the same conditions to be cut.Detailed process is as follows:
Endonuclease reaction system (20 μ l): purifying after product: 6 μ l, BamH I enzyme (15U/ μ l): 1.5 μ l, 10 * k buffer:2 μ l, 0.1%BSA:2 μ l, ddH
2O:8.5 μ l.
Reaction conditions: 37 ℃ of water-baths 2 hours, the glue figure that enzyme is tested conscientiously sees Fig. 7.
Fig. 7 shows: and the connectivity dna fragmentation of purified processing (BRCA2-6 ') after cutting, the BamHI enzyme obtains two specific fragments, and the long-chain DNA that experimental technique increases, connection obtains that proposes through the present invention of purified processing obtains fragment length and the consistent product of connectivity dna fragmentation length after BamH I enzyme is cut.The validity of the amplification edges limit method of attachment of carrying out at target genome area that enzyme cuts that result of experiment confirmed that the present invention proposes.
Sequence table
＜110〉Huada Gene Research Center, Beijing
＜120〉a kind of method of carrying out the connection of amplification edges limit at one or more target genome areas
<130>IDC070080
<140>200710143624.9
<141>2007-08-15
<150>200710097760.9
<151>2007-04-29
<160>34
<170>PatentIn?version?3.3
<210>1
<211>20
<212>DNA
<213>artificial
<220>
<223>5’universal?linker
<400>1
cgcggatccg?cggccgcttc 20
<210>2
<211>20
<212>DNA
<213>artificial
<220>
<223>3’universal?linker
<400>2
gaagcggccg?cggatccgcg 20
<210>3
<211>40
<212>DNA
<213>artificial
<220>
<223>5’primer(CSF1R-10)
<400>3
cgcggatccg?cggccgcttc?gagcacccac?tgtgttccag 40
<210>4
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(CSF1R-10)
<400>4
gaagcggccg?cggatccgcg?tgattagcac?ctgtctctcg?c 41
<210>5
<211>41
<212>DNA
<213>artificial
<220>
<223>5’primer(CSF1R-18)
<400>5
cgcggatccg?cggccgcttc?tccaactaca?ttgtcaaggg?c 41
<210>6
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(CSF1R-18)
<400>6
gaagcggccg?cggatccgcg?cattcctgca?ctctcaccaa?c 41
<210>7
<211>41
<212>DNA
<213>artificial
<220>
<223>5’primer(JAK2-1)
<400>7
cgcggatccg?cggccgcttc?ttctgggctc?aagctatctg?c 41
<210>8
<211>40
<212>DNA
<213>artificial
<220>
<223>3’primer(JAK2-1)
<400>8
gaagcggccg?cggatccgcg?aacacacacg?ccagccatac 40
<210>9
<211>41
<212>DNA
<213>artificial
<220>
<223>5’primer(JAK2-5)
<400>9
cgcggatccg?cggccgcttc?cacttggcca?ctgtgttgta?a 41
<210>10
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(JAK2-5)
<400>10
gaagcggccg?cggatccgcg?aatgggagaa?gtgcaatacc?a 41
<210>11
<211>41
<212>DNA
<213>artificial
<220>
<223>5’primer(JAK2-9)
<400>11
cgcggatccg?cggccgcttc?ggcactacat?cggattcatg?g 41
<210>12
<211>46
<212>DNA
<213>artificial
<220>
<223>3’primer(JAK2-9)
<400>12
gaagcggccg?cggatccgcg?gaacttcaag?tcacttctag?accacc 46
<210>13
<211>42
<212>DNA
<213>artificial
<220>
<223>5’primer(JAK2-12)
<400>13
cgcggatccg?cggccgcttc?gcctgtttga?ctggcattat?tc 42
<210>14
<211>42
<212>DNA
<213>artificial
<220>
<223>3’primer(JAK2-12)
<400>14
gaagcggccg?cggatccgcg?ctgacaccta?gctgtgatcc?tg 42
<210>15
<211>41
<212>DNA
<213>artificial
<220>
<223>5’primer(KRAS-1)
<400>15
cgcggatccg?cggccgcttc?tcttaagcgt?cgatggagga?g 41
<210>16
<211>43
<212>DNA
<213>artificial
<220>
<223>3’primer(KRAS-1)
<400>16
gaagcggccg?cggatccgcg?ttgaaaccca?aggtacattt?cag 43
<210>17
<211>44
<212>DNA
<213>artificial
<220>
<223>5’primer(KRAS-4)
<400>17
cgcggatccg?cggccgcttc?tcagttgcct?gaagagaaac?ataa 44
<210>18
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(KRAS-4)
<400>18
gaagcggccg?cggatccgcg?taacagtctg?catggagcag?g 41
<210>19
<211>42
<212>DNA
<213>artificial
<220>
<223>5’primer(NRAS-1)
<400>19
cgcggatccg?cggccgcttc?ccaaatggaa?ggtcacacta?gg 42
<210>20
<211>45
<212>DNA
<213>artificial
<220>
<223>3’primer(NRAS-1)
<400>20
gaagcggccg?cggatccgcg?gaactcaaca?ctgagtttgc?aatag 45
<210>21
<211>17
<212>DNA
<213>artificial
<220>
<223>5’universal?linder
<400>21
gtaaaacgac?ggccagt 17
<210>22
<211>17
<212>DNA
<213>artificial
<220>
<223>3’universal?linker
<400>22
actggccgtc?gttttac 17
<210>23
<211>38
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA1-1)
<400>23
gtaaaacgac?ggccagtatt?gcgccatcac?actctagc 38
<210>24
<211>38
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA1-1)
<400>24
actggccgtc?gttttacttt?gtgctcatgg?cagatttc 38
<210>25
<211>39
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA1-18)
<400>25
gtaaaacgac?ggccagtggg?tttctcttgg?tttctttga 39
<210>26
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA1-18)
<400>26
actggccgtc?gttttacgtt?gccagaataa?atgaaaatgg?t 41
<210>27
<211>42
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA2-5)
<400>27
gtaaaacgac?ggccagtcaa?tgtacacatg?taacaccaca?aa 42
<210>28
<211>40
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA2-5)
<400>28
actggccgtc?gttttaccca?agacatatca?ggatccacct 40
<210>29
<211>42
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA2-24)
<400>29
actggccgtc?gttttactca?gctattttga?tttgctttta?tt 42
<210>30
<211>41
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA2-24)
<400>30
gtaaaacgac?ggccagtagc?tatttccttg?atactggact?g 41
<210>31
<211>40
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA2-10j)
<400>31
gtaaaacgac?ggccagtaaa?gatgaaacgg?acttgctatt 40
<210>32
<211>38
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA2-10j)
<400>32
actggccgtc?gttttacgtt?gtccctggaa?ggtcacta 38
<210>33
<211>39
<212>DNA
<213>artificial
<220>
<223>5’primer(BRCA2-6)
<400>33
gtaaaacgac?ggccagtttc?tgcctcatac?aggcaattc 39
<210>34
<211>40
<212>DNA
<213>artificial
<220>
<223>3’primer(BRCA2-6)
<400>34
actggccgtc?gttttaccat?aatgcttgac?accactggac 40
Claims (5)
1. one kind is carried out the method that the amplification edges limit connects at a target genome area, comprises step:
1) at a target genome area, design comprises forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, wherein public connectors reverse complemental each other in forward and the reverse primer; The public connectors of described forward and reverse primer is GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, and described target genome area is selected from 70 exons of BRCA1 and BRCA2;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the amplification target genome area obtains the connectivity dna fragmentation at described target genome area 5 ' end and 3 ' end adding public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC;
3) step 2) the connectivity dna fragmentation of Huo Deing, it is anti-to take turns polynucleotide amplification as second
ShouldTemplate carry out the ligation of amplification edges limit; Obtain by step 2) the long-chain DNA that is formed by connecting of gained connectivity dna fragmentation.
2. one kind is carried out the method that the amplification edges limit connects at two and plural a plurality of target genome area, comprises step:
1) at each zone of a plurality of target genome areas, design comprises forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC respectively, wherein public connectors reverse complemental each other in the every pair of forward and the reverse primer; The public connectors of described forward and reverse primer is GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, and described target genome area is selected from 70 exons of BRCA1 and BRCA2;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the target genome area that increases respectively obtains the different connectivity dna fragmentations at each target genome area 5 ' end and 3 ' end adding public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC;
3) with step 2) the different connectivity dna fragmentations that obtain mix equally, carry out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting by the order of connection at random of the different connectivity dna fragmentation of gained.
3. a foundation comprises step at the resurvey method in preface random dna library of a target genome area sequence:
1) at a target genome area, design comprises forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, wherein public connectors reverse complemental each other in forward and the reverse primer;
The public connectors of described forward and reverse primer is GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, and described target genome area is selected from 70 exons of BRCA1 and BRCA2;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the amplification target genome area obtains the connectivity dna fragmentation at described target genome area 5 ' end and 3 ' end adding public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC;
3) step 2) the connectivity dna fragmentation of Huo Deing carries out amplified reaction as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting of gained connectivity dna fragmentation;
4) the long-chain DNA of step 3) gained is interrupted method at random with DNA and interrupt, obtain the random dna library.
4. a foundation comprises step at the resurvey method in preface random dna library of two and plural a plurality of target genome area:
1) at each zone of a plurality of target genome areas, design comprises forward that is used for polynucleotide amplification reaction and the reverse primer of public connectors GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC respectively, wherein public connectors reverse complemental each other in the every pair of forward and the reverse primer;
The public connectors of described forward and reverse primer is GTAAAACGACGGCCAGT and ACTGGCCGTCGTTTTAC, and described target genome area is selected from 70 exons of BRCA1 and BRCA2;
2) utilize forward described in the step 1) and reverse primer, by first round polynucleotide amplification reaction, the target genome area that increases respectively obtains the different connectivity dna fragmentations at each target genome area 5 ' end and 3 ' end adding public connectors;
3) with step 2) the different connectivity dna fragmentations that obtain mix equally, carry out the ligation of amplification edges limit as second template of taking turns polynucleotide amplification reaction; Obtain by step 2) the long-chain DNA that is formed by connecting by the order of connection at random of the different connectivity dna fragmentation of gained;
4) the long-chain DNA of step 3) gained is interrupted method at random with DNA and interrupt, obtain the random dna library.
5. according to claim 3 or 4 described methods, the method that wherein interrupts gained long-chain dna sequence dna in the step 4) is that the DNA that is selected from ultrasonic method, spray method, chemical shearing method and enzyme shearing method interrupts method at random.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010101636482A CN101824412B (en) | 2007-04-29 | 2007-08-15 | Method for conducting connection-by-amplification aiming at one or more target genomic regions |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200710097760.9 | 2007-04-29 | ||
| CN200710097760 | 2007-04-29 | ||
| CN2010101636482A CN101824412B (en) | 2007-04-29 | 2007-08-15 | Method for conducting connection-by-amplification aiming at one or more target genomic regions |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2007101436249A Division CN101265471B (en) | 2007-04-29 | 2007-08-15 | Method for simultaneously amplifying and connecting one or multiple aim genome region |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101824412A CN101824412A (en) | 2010-09-08 |
| CN101824412B true CN101824412B (en) | 2011-11-02 |
Family
ID=42688576
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010101636482A Active CN101824412B (en) | 2007-04-29 | 2007-08-15 | Method for conducting connection-by-amplification aiming at one or more target genomic regions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101824412B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329856B (en) * | 2010-12-03 | 2013-08-14 | 北京标凯科技有限公司 | Sanger sequencing reaction optimizing agent as well as preparation method and application thereof |
| CN103060310A (en) * | 2013-01-15 | 2013-04-24 | 首都医科大学 | Method for amplifying DNA (deoxyribonucleic acid) library based on random single connector |
| CN103849617A (en) * | 2013-12-16 | 2014-06-11 | 复旦大学 | Connector and method for Permanent preservation of genome DNA (deoxyribonucleic acid) |
| CN105821481B (en) * | 2016-04-28 | 2019-03-19 | 元码基因科技(苏州)有限公司 | The detection method of low frequency mutation in a kind of dissociative DNA library constructing method and dissociative DNA |
| CN106755418B (en) * | 2016-12-24 | 2020-08-21 | 广州艾基生物技术有限公司 | Exon assembly sequencing method |
| CN114807334A (en) * | 2022-05-31 | 2022-07-29 | 深圳联合医学科技有限公司 | Target gene detection method, primer group, kit and application |
-
2007
- 2007-08-15 CN CN2010101636482A patent/CN101824412B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| Chikako et al.Evaluation of a Whole-Genome Amplification Method Based on Adaptor-Ligation PCR of Randomly Sheared Genomic DNA.《GENES,CHROMOSOMES$CANCER》.2003,第38卷168-176. * |
| Takala.M13 Primer 使用说明书.《Takala》.2006, * |
| 苏夜阳 等.使用边扩增边连接技术以两步PCR反应制备两个癌症候选基因的重测序DNA文库.《中国科学 C辑：生命科学》.2008,第38卷(第12期),1114-1122. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101824412A (en) | 2010-09-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6849404B2 (en) | Polymerase chain reaction of DNA of which base sequence is completely unidentified | |
| US5753467A (en) | Method for the identification of microorganisms by the utilization of directed and arbitrary DNA amplification | |
| US20220389416A1 (en) | COMPOSITIONS AND METHODS FOR CONSTRUCTING STRAND SPECIFIC cDNA LIBRARIES | |
| Onofri et al. | Development of multiplex PCRs for evolutionary and forensic applications of 37 human Y chromosome SNPs | |
| AU2021204166B2 (en) | Reagents, kits and methods for molecular barcoding | |
| CN101824412B (en) | Method for conducting connection-by-amplification aiming at one or more target genomic regions | |
| JP2001517086A (en) | Extraction and utilization of VNTR alleles | |
| CN105986015B (en) | Method and kit for detecting one or more target sequences of multiple samples based on high-throughput sequencing | |
| CN114901818A (en) | Methods of targeted nucleic acid library formation | |
| CA2840493A1 (en) | Method for genome complexity reduction and polymorphism detection | |
| KR20160138168A (en) | Copy number preserving rna analysis method | |
| CN101265471B (en) | Method for simultaneously amplifying and connecting one or multiple aim genome region | |
| CN106755418B (en) | Exon assembly sequencing method | |
| EP3976899A1 (en) | Flexible and high-throughput sequencing of targeted genomic regions | |
| Vinogradova et al. | Selective differential display of RNAs containing interspersed repeats: analysis of changes in the transcription of HERV-K LTRs in germ cell tumors | |
| CN113544282B (en) | Method for constructing sequencing library based on DNA sample and application | |
| EP3666904A1 (en) | Nucleic acid amplification and identification method | |
| Schlüter et al. | Making the first step: practical considerations for the isolation of low‐copy nuclear sequence markers | |
| US10036053B2 (en) | Determination of variants produced upon replication or transcription of nucleic acid sequences | |
| KR102237248B1 (en) | SNP marker set for individual identification and population genetic analysis of Pinus densiflora and their use | |
| WO2021166989A1 (en) | Method for producing dna molecules having an adaptor sequence added thereto, and use thereof | |
| DE602004025815D1 (en) | PROCESS FOR THE AMPLIFICATION OF POLYMERIC NUCLEIC ACIDS | |
| Okano et al. | Fragment walking for long DNA sequencing by using a library as small as 16 primers | |
| WO2022187334A1 (en) | High-yield probe library construction | |
| WO2024112758A1 (en) | High-throughput amplification of targeted nucleic acid sequences |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: BEIJING LIUHE BGI SCIENCE AND TECHNOLOGY CO., LTD. Free format text: FORMER OWNER: BEIJING BGI RESEARCH CENTER CO., LTD. Effective date: 20111109 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 101300 SHUNYI, BEIJING TO: 101300 HAIDIAN, BEIJING |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20111109 Address after: 101300, No. 56 West Fourth Ring Road, Beijing, Haidian District, 12, 1202 Patentee after: Beijing Liuhe BGI Science and Technology Co., Ltd. Address before: 101300 B-6, Shunyi District airport science and Technology Pioneer Park, Beijing Patentee before: Beijing Genomics Institute (BGI) |