CN103060310A

CN103060310A - Method for amplifying DNA (deoxyribonucleic acid) library based on random single connector

Info

Publication number: CN103060310A
Application number: CN2013100136308A
Authority: CN
Inventors: 张玉祥; 邹斌斌
Original assignee: Capital Medical University
Current assignee: Capital Medical University
Priority date: 2013-01-15
Filing date: 2013-01-15
Publication date: 2013-04-24

Abstract

The invention discloses a method for amplifying a DNA (deoxyribonucleic acid) library based on a random single connector. The method comprises the steps of adding a digestion sequence on a randomly generated sequence and adding a double-chain connector of an end protrusion T into two ends of the DNA library, and amplifying a connecting product through a connector primer, thereby achieving the aim of amplifying the DNA library. The connector is conveniently and rapidly prepared, and the price is low, so that a simple method with low price is provided for rapidly amplifying the trace DNA library.

Description

Method based on random single joint DNA amplification library

Technical field

The present invention relates to the amplification method in a kind of DNA library, specifically, relate to a kind of and utilize single joint DNA amplification library method, thereby reduce the synthetic expense of joint, and reduce the non-specific of amplification.

Background technology

Along with the development and application of s-generation sequencing technologies, people can measure the sample DNA sequence very easily, thereby determine sample.But at present s-generation order-checking has higher requirement for primary sample concentration, when carrying out the genome target region order-checking, require the sample total amount greater than 6 μ g DNA such as the large genome company of Shenzhen China, concentration is greater than 50ng/ μ L, for some micro-examples, the just relatively more difficult requirement that reaches order-checking.One of them terms of settlement is: sample is added that universal joint increases, and then send to order-checking.

The joint test kit that comparative maturity has been arranged in the market, just made the joint that checks order for its company's sequenator such as illumina company, joint test kit price in the market is expensive, cut certain skewed popularity, the dna fragmentation that is fit to amplification 300-500bp such as the joint of illumina company, and most of joint sequence does not have restriction enzyme site at 3 ' end, the clean joint sequence of the relatively more difficult removal of the product after the amplification.

Summary of the invention

The technical problem to be solved in the present invention is for problems such as difficult removal joint sequences after market joint costliness, the amplification, and a kind of novel joint is provided.

Technical solution of the present invention generates the most joint of 25-30bpDNA sequence at first at random, then adds flat terminal restriction enzyme site at this joint 3 ' end, according to random joint design primer.Specifically, comprise the steps:

1. the generation of stochastic sequence: can be with a sequence that also can on related web site, generate at random joint sequence by writing a program, another is its reverse complementary sequence, for example http://bioinformatics.org/sms/index.htm.

2. flat terminal enzyme is cut the selection of sequence: be free to select flat terminal restriction enzyme digestion enzyme such as MlyI restriction enzyme site to see Fig. 1, this enzyme not only can excise joint and can also cut sequence to enzyme and excise fully totally.

3. the design of the primer of joint sequence: can directly utilize the front 15-20bpDNA sequence of joint as primer.

4. joint and primer is synthetic: stochastic sequence adds that enzyme cuts sequence and just become joint, notice that joint must have a chain 3 ' outstanding T, sends that primer Synesis Company is synthetic to be got final product.

5.DNA terminal the processing: the primer joint is that T is outstanding, so (3 ' → 5 ' exo-) process DNA uses terminal outstanding A with using first Klenow Fragment.

6.DNA Sample Purification on Single: purifying previous step DNA sample

7. joint annealing: the annealing temperature (TM) according to two synthetic joint strands, cycle of annealing is set, make its annealing be hybridized to double-stranded joint.

8. add joint: purified good DNA sample is connected the double-stranded joint for preparing.

8.DNA Sample Purification on Single: the DNA sample of purifying previous step.

9.PCR: with joint primer amplification DNA sample.

10.PCR product purification: purifying amplified production.

11: the excision joint: with corresponding restriction enzyme excision joint.

12:DNA Sample Purification on Single: purifying previous step product.

Present method has following advantage and effect:

1. present method can increase to the minim DNA sample, compares with the joint test kit on the market, easily produces, and low cost is without DNA length skewed popularity.

2. present method has the advantages such as easy and simple to handle, that the reagent validity period is long, with low cost, be quick on the draw.

3. present method can be removed joint sequence and enzyme is cut sequence more fully.

Description of drawings

Fig. 1 is that the MlyI enzyme is cut sequence chart.

Fig. 2 is random single joint figure.

Fig. 3 is joint and sample DNA interface chart, the figure left side and the right are the full formula 100bp DNALadder of King Company, molecular weight is 100bp, 200bp, 300bp, 400bp, 500bp, 600bp, 700bp, 800bp, 900bp, 1000bp, 1500bp successively, and the centre is to connect product.

Fig. 4 is amplification sample DNA figure, and the figure left side and the right are the full formula 100bp DNA Ladder of King Company, and the centre is amplified production.

Fig. 5 is the ultrasonic Hela S3 gene picture group that interrupts, and the figure left side is the full formula 100bp DNA Ladder of King Company, and the right is the 1Kbp DNALadder of King Company, and molecular weight is 1kbp, 2kbp, 3kbp, 4kbp, 5kbp, 6kbp, 8kbp, 10kbp successively.

Fig. 6 is 200-600bp amplified library figure, and the figure left side and the right are the full formula 100bp DNALadder of King Company, and the centre is amplified production.

Embodiment

Embodiment 1

Process with random single joint DNA amplification library

1. the sequences Design of joint reaches synthetic: designed as required the joint such as Fig. 2.

2. joint annealing: get 10 μ L, the 80 μ L that 100 μ M/L joint strands add, ddH ₂Among the O, press the program hybridization of table 1.

Table 1: joint annealing hybridization program

3. sample DNA is terminal processes: usefulness MN company

The full formula 100bp DNA Ladder of King Company (BM301-02) of Gel and PCR Clean-up test kit purifying 50 μ L, NANODROP1000 (Thermo company) surveys concentration 102.3ng/ μ L, add 3 μ LKlenow Fragment (3 '--＞5 ' exo-) (NEB company), 2 μ L dNTP (Takara company), 37 ℃ of water-baths of 5 μ L NEbuffer2 1 hour.

4. Sample Purification on Single: with MN company

Gel and PCR Clean-up test kit purify DNA sample.

5.DNA with joint be connected: get the good DNA of 20 μ L purifying, the joint that 20 μ L prepare, 5 μ L T4DNA Ligase (Takara company), 5 μ L T4DNA Ligase buffer, 16 ℃ of water-baths are spent the night.

6. purifying connects product: usefulness MN company

Gel and PCR Clean-up test kit purifying connects product, and electrophoresis result is seen Fig. 3.

7.PCR amplification connects product: add various compositions with joint primer (CTTACGAGTCTAGAGTCATGC) by 20 μ L PCR systems, carry out pcr amplification by design conditions: 94 ℃, 5 minutes; 94 ℃, 30 seconds; 55 ℃, 30 seconds; 72 ℃, 15 seconds; 72 ℃, 5 minutes; 20 circulations.After circulation is finished, namely amplified production is carried out agarose gel electrophoresis, according to the glue record, the results are shown in Figure 4 with ultraviolet imager.

8. the ultrasonic Hela S3 genome that interrupts the results are shown in Figure 5, usefulness MN company Gel and PCR Clean-up test kit reclaims the 200-600bp fragment, and such as above-mentioned 3-7 step, amplification 200-800bp library the results are shown in Figure 6.

Claims

1. method based on random single joint DNA amplification library is characterized in that adding that with a random sequence that generates an enzyme cuts sequence and consist of the single joint of two strands, and double-stranded single joint is added to the library DNA two ends, with the joint primer library DNA that just can increase.

2. detection method according to claim 1 is characterized in that adding with joint primer amplification two ends the library DNA of top connection.

3. detection method according to claim 2 is characterized in that may further comprise the steps:

(1) design of random single joint is with synthetic;

(2) library DNA links to each other with random single joint;

(3) amplification library DNA, and excision joint.

4. detection method according to claim 3 is characterized in that the design of the random single joint of step (1) is with synthetic:

With program or Software Create stochastic sequence, as required at 3 ' terminal adding restriction enzyme site, and make double-stranded joint 3 ' T outstanding, send primer Synesis Company synthetic.

Detection method according to claim 3 is characterized in that step (2) library DNA links to each other with random single joint:

With Klenow Fragment (3 '--＞5 ' exo-) process library DNAs, with T4DNA Ligase linking library DNA and random single joint.

5. detection method according to claim 3 is characterized in that step (3) amplification library DNA:

Use the pcr amplified dna library with random single joint primer, and excise joint with corresponding restriction enzyme.