CN114807334A

CN114807334A - Target gene detection method, primer group, kit and application

Info

Publication number: CN114807334A
Application number: CN202210610543.XA
Authority: CN
Inventors: 雷湘华; 郭永超; 王艳平; 苏莹; 叶苑青; 徐仲尧
Original assignee: Shenzhen Uni Medica Technology Co ltd
Current assignee: Shenzhen Uni Medica Technology Co ltd
Priority date: 2022-05-31
Filing date: 2022-05-31
Publication date: 2022-07-29

Abstract

The present disclosure describes a method for detecting a target gene, comprising the steps of: aiming at one or more target genes, selecting a plurality of target regions from the gene sequence of each target gene, and respectively designing a primer group aiming at each target region; preparing a plurality of nucleic acid samples to be detected; carrying out PCR amplification on each nucleic acid sample to be detected by using a primer group to obtain a target library; sequencing the target library to obtain sequencing data of the target library; judging whether each target region is detected or not based on the sequencing data; and for each nucleic acid sample to be detected, if the number of the detected target regions is larger than a preset ratio compared with the number of the plurality of target regions, determining that the nucleic acid sample to be detected contains the target gene. According to the detection method disclosed by the invention, the accuracy of the detection result can be improved. The disclosure also describes a primer group, a kit and application for detecting the target gene.

Description

Target gene detection method, primer group, kit and application

Technical Field

The invention relates to the field of gene detection, in particular to a target gene detection method, a primer group, a kit and application.

Background

In recent years, high-throughput sequencing technology has become more and more widely used in the fields of life science and medicine, and especially plays an important role in prenatal screening, tumor diagnosis, genetic disease detection, infection of pathogens such as viruses or bacteria, health-related metagenomic analysis and the like. The high-throughput sequencing technology is used for simultaneously and independently sequencing thousands to millions of DNA fragments, can quickly, efficiently and accurately acquire genome information in a whole detection sample, and can assist scientific research, clinical diagnosis, treatment and the like by analyzing the information of a target gene.

For high throughput sequencing technologies, before sequencing, library construction is usually performed on a sample to be tested, for example, capture, PCR amplification, modification, etc. are performed on a target gene, so as to improve the signal intensity of the target gene and facilitate sequencing. However, in the course of library construction, it is usually necessary to shake the reaction tube, open the lid, and repeatedly aspirate the sample with a pipette, and in this process, cross contamination between samples, aerosol contamination, and the like may occur, and these contaminations may cause false positives in the gene test results. In particular, for pathogen gene testing, the number of reads (reads) may be detected, with only minimal contamination, resulting in false positives. More seriously, it may even lead to contamination of the entire PCR laboratory, such that the laboratory needs to be shut down. Therefore, aerosol pollution and the like are important factors influencing the accuracy of pathogen target sequencing results.

Disclosure of Invention

The present disclosure has been made in view of the above-described state of the art, and an object thereof is to provide a method for detecting a target gene, a primer set, a kit, and an application, which can improve the accuracy of a detection result.

To this end, the first aspect of the present disclosure provides a method for detecting a target gene, comprising the steps of: selecting a plurality of target regions from the gene sequence of each target gene aiming at one or more target genes, respectively designing a primer group aiming at each target region, to obtain a plurality of primer sets for the plurality of target regions, each primer set comprising a first forward primer, a first reverse primer, a second forward primer and a third reverse primer, the first forward primer comprises a first sequencing primer and a sequence matching the 5' end of the target region, the first reverse primer comprises a second sequencing primer and a sequence matched with the 3' end of the target region, the second reverse primer comprises the second sequencing primer, a first barcode, and a first sequencing adapter, the second forward primer comprises a second sequencing adaptor and the first sequencing primer, and the third reverse primer comprises the first sequencing adaptor; preparing a plurality of nucleic acid samples to be detected; performing PCR amplification on each nucleic acid sample to be detected by using the first forward primer, the first reverse primer and the second reverse primer respectively to obtain an amplification product of each nucleic acid sample to be detected; mixing the amplification products of the nucleic acid samples to be detected to obtain mixed amplification products, and performing PCR amplification on the mixed amplification products by using the second forward primer and the third reverse primer to obtain a target library; sequencing the target library, and acquiring sequencing data of the target library, wherein the sequencing data comprises a sequence of the target library, and the sequence of the target library comprises a sequence of the first barcode; determining whether each target region is detected based on the sequence of the target library, and identifying each nucleic acid sample to be tested based on the sequence of the first barcode; and for each nucleic acid sample to be detected, if the ratio of the number of the detected target regions to the number of the plurality of target regions in any one of the one or more target genes is greater than a preset ratio, determining that the nucleic acid sample to be detected contains the target gene.

In the method, a plurality of target regions are selected from a target gene, a first forward primer, a first reverse primer and a second reverse primer pair are used for amplifying the plurality of target regions, the second reverse primer comprises a first bar code for identifying each nucleic acid sample to be detected, and then the second forward primer and a third reverse primer are used for amplifying to obtain a target library. In addition, the detection of the target gene is judged by the detection ratio of the plurality of target regions being larger than the preset ratio, so that the influence of aerosol pollution and the like on the judgment of the detection result can be further reduced, and the accuracy of the detection result can be improved.

In the detection method according to the present disclosure, optionally, for each sample nucleic acid to be detected, if a ratio of the number of the detected target regions to the number of the plurality of target regions in any one of the one or more target genes is not greater than the preset ratio, it is determined that the sample nucleic acid to be detected does not contain the target gene. Thus, in the case where a target gene not greater than a preset ratio is detected, it can be excluded from the positive results.

In the detection method related to the present disclosure, optionally, the first forward primer is the first sequencing primer and the sequence matching the 5 'end of the target region in sequence from the 5' end to the 3 'end, the first reverse primer is the second sequencing primer and the sequence matching the 3' end of the target region in sequence from the 5 'end to the 3' end, the second reverse primer is the first sequencing linker, the first barcode and the second sequencing primer in sequence from the 5 'end to the 3' end, the second forward primer is the second sequencing linker and the first sequencing primer in sequence from the 5 'end to the 3' end, and the third reverse primer is the first sequencing linker. Thus, the target region can be directly captured and amplified using the first forward primer, the first reverse primer, the second forward primer, and the third reverse primer.

In the detection method related to the present disclosure, optionally, the mixed amplification product is used as a specific batch of amplification products, the second forward primer further comprises a second barcode, the sequence of the target library further comprises a sequence of the second barcode, and the specific batch is identified based on the sequence of the second barcode. In this case, by making the second forward primer include the second barcode for identifying a specific lot, the influence of contamination between lots on the detection result can be reduced.

In the detection method related to the present disclosure, optionally, the second forward primer is the second sequencing adaptor, the second barcode and the first sequencing primer in sequence from 5 'end to 3' end. Thus, the second barcode for identifying a specific batch can be added to the sequence of each target region directly using the second forward primer, and the influence of contamination between batches on the detection result can be reduced.

In the detection methods contemplated by the present disclosure, optionally, the first sequencing primer and the second sequencing primer are sequencing primers of an illumina sequencing platform, the first sequencing linker is a P7 linker of the illumina sequencing platform, and the second sequencing linker is a P5 linker of the illumina sequencing platform. Thus, the library of interest can be sequenced by the illumina sequencing platform.

In the detection method according to the present disclosure, optionally, 3 target regions are selected from the gene sequence of the target gene, and a primer set is respectively designed for each target region, so as to obtain 3 primer sets. In this case, the accuracy of the detection result can be improved by selecting only 3 target regions from the gene sequence of the target gene.

In the detection method related to the present disclosure, optionally, the respective target regions in the gene sequence of the target gene do not overlap or only partially overlap with each other. This enables selection of a plurality of different target regions from the gene sequence of the target gene.

In the detection method according to the present disclosure, optionally, a detection threshold value of each of the plurality of target regions is obtained based on a positive quality control and a negative quality control of the target gene, and whether each target region is detected is determined based on the detection threshold value. Thus, the detection threshold value for each target region can be obtained from the positive control and the negative control of the target gene.

In the detection method related to the present disclosure, optionally, the nucleic acid sample to be detected includes at least one of a DNA sample and an RNA sample, and if the nucleic acid sample to be detected includes an RNA sample, after obtaining the nucleic acid sample to be detected, a step of performing reverse transcription on the nucleic acid sample to be detected is further included. Thus, a DNA sample and/or an RNA sample can be detected.

In the detection method according to the present disclosure, optionally, the preset ratio is 50% to 80%. This can further improve the accuracy of the detection result.

The second aspect of the present disclosure provides a primer set for detecting a target gene, which is a primer set for detecting a nucleic acid sample to be detected, and is a primer set that selects a plurality of target regions from a gene sequence of the target gene and is designed for each target region, the primer set includes a first forward primer, a first reverse primer, a second forward primer and a third reverse primer, respectively, the first forward primer includes a first sequencing primer and a sequence matching with the 5 'end of the target region, the first reverse primer includes a second sequencing primer and a sequence matching with the 3' end of the target region, the second reverse primer includes the second sequencing primer, a first barcode and a first sequencing linker, the second forward primer includes a second sequencing linker, a second barcode and the first sequencing primer, the third reverse primer comprises the first sequencing adapter; and performing PCR amplification on the nucleic acid sample to be detected by using the first forward primer, the first reverse primer and the second reverse primer to obtain an amplification product, and performing PCR amplification on the amplification product by using the second forward primer and the third reverse primer. Therefore, the first forward primer, the first reverse primer, the second forward primer and the third reverse primer can be used for capturing and amplifying a plurality of target regions of the target gene so as to detect the target gene, and therefore the accuracy of the detection result is improved.

In a third aspect of the present disclosure, there is provided a kit for detecting a target gene, the kit comprising the primer set provided in the second aspect of the present disclosure. Therefore, the primer group of the kit can be used for capturing and amplifying a plurality of target regions of the target gene so as to detect the target gene, thereby improving the accuracy of the detection result.

In the kit related to the present disclosure, optionally, a positive quality control material, a negative quality control material, and a library establishing reagent having a PCR buffer solution and a DNA polymerase are further included. Therefore, the target gene can be more conveniently detected.

In a fourth aspect of the present disclosure, there is provided an application of a primer set in the preparation of a kit for detecting a target gene, wherein the primer set is the primer set according to the second aspect of the present disclosure. Therefore, the primer group can be applied to the preparation of the kit for detecting the target gene, and the accuracy of the detection result can be improved when the prepared kit is used for detecting the target gene.

According to the present disclosure, a method, a primer set, a kit and an application for detecting a target gene with high detection result accuracy can be provided.

Drawings

Fig. 1 shows a schematic view of a scene of a detection method of a target gene according to an example of the present disclosure.

Fig. 2 shows a flowchart of a method for detecting a target gene according to an example of the present disclosure.

Fig. 3 shows a flow diagram of PCR amplification according to an example of the present disclosure.

Fig. 4 shows a schematic diagram of a scenario of PCR amplification to which examples of the present disclosure relate.

Fig. 5 shows a schematic view of different batches to which examples of the present disclosure relate.

Fig. 6 shows a schematic diagram of selecting a plurality of target regions from a gene sequence of one target gene according to an example of the present disclosure.

Fig. 7 shows a schematic representation of the selection of multiple target regions from gene sequences of multiple target genes, in accordance with examples of the present disclosure.

Fig. 8 shows a schematic diagram of a process for PCR amplification of a target region by a primer set according to an example of the present disclosure.

Fig. 9 shows a schematic diagram of a kit according to examples of the present disclosure.

Detailed Description

Hereinafter, preferred embodiments of the present disclosure will be described in detail with reference to the accompanying drawings. In the following description, the same components are denoted by the same reference numerals, and redundant description thereof is omitted. The drawings are schematic and the ratio of the dimensions of the components and the shapes of the components may be different from the actual ones.

It is noted that, as used herein, the terms "comprises," "comprising," or any other variation thereof, such that a process, method, system, article, or apparatus that comprises or has a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include or have other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

In addition, the subtitles and the like referred to in the following description of the present invention are not intended to limit the content or the scope of the present invention, and serve only as a cue for reading. Such a subtitle should neither be understood as a content for segmenting an article, nor should the content under the subtitle be limited to only the scope of the subtitle.

The first aspect of the present disclosure relates to a method for detecting a target gene, which is a method capable of detecting a target gene. The method for detecting a target gene according to the present disclosure may be simply referred to as "detection method". In the present disclosure, the target gene refers to an object desired to be detected, and may be selected according to an actual application scenario. For example, when it is desired to detect whether a sample contains a pathogen, the target gene may be a gene or gene fragment specific to the pathogen. Thus, whether or not a certain pathogen is contained in a sample can be determined by detecting a target gene. That is, the present disclosure also relates to methods of detecting pathogens.

In the present disclosure, detecting a target gene may include obtaining a sequence of the target gene by sequencing, usually performing library construction before sequencing, and usually shaking a reaction tube, uncovering a lid, repeatedly sucking a sample by a pipette during the operation of library construction, and in this process, cross contamination between samples or contamination such as aerosol contamination may be generated, and these contaminations may cause a false positive in a detection result, and may affect the accuracy of the detection result. The method for detecting a target gene according to the present disclosure can improve the accuracy of the detection result of the target gene.

Hereinafter, a method for detecting a target gene according to the present disclosure will be described with reference to the drawings.

Fig. 1 shows a schematic view of a scene of a detection method of a target gene according to an example of the present disclosure. Fig. 2 shows a flowchart of a method for detecting a target gene according to an example of the present disclosure. Fig. 3 shows a flow diagram of PCR amplification according to an example of the present disclosure. Fig. 4 shows a schematic diagram of a scenario of PCR amplification to which examples of the present disclosure relate. Fig. 5 shows a schematic view of different batches to which examples of the present disclosure relate.

In the present embodiment, as shown in FIG. 1, in the method for detecting a target gene according to the present embodiment, a nucleic acid sample 20 to be tested can be usually obtained from a test object such as a human body, and the collected nucleic acid sample 20 to be tested can be loaded in a test tube. The number of the nucleic acid samples 20 to be detected may be plural, for example, the number includes a nucleic acid sample 21 to be detected, a nucleic acid sample 22 to be detected, a nucleic acid sample 23 to be detected, and each nucleic acid sample to be detected may be of a different type or of the same type. Subsequently, the nucleic acid sample to be tested may be subjected to PCR amplification using, for example, the PCR instrument 400. Then, sequencing is performed by the sequencer 500 to obtain sequence information of each nucleic acid sample to be tested (see fig. 1).

In this embodiment, as shown in fig. 2, the method for detecting a target gene may include the steps of: selecting a plurality of target regions from a gene sequence of a target gene, and designing a primer set for each target region (step S100); preparing a sample of nucleic acid to be tested (step S200); carrying out PCR amplification on a nucleic acid sample to be detected by using a primer group to obtain a target library (step S300); sequencing the target library to obtain sequencing data (step S400); judging the detection condition of each target region based on the sequencing data (step S500); based on the detection of the target region, it is determined whether or not the nucleic acid sample to be tested contains the target gene (step S600).

In the detection method according to the present embodiment, the order of step S100 and step S200 is not particularly limited. For example, step S100 may be performed first, and then step S200 may be performed; step S200 may be performed first, and then step S100 may be performed; or step S100 and step S200 may be performed simultaneously.

As described above, the method for detecting a target gene may include selecting a plurality of target regions from a gene sequence of a target gene, and designing a primer set for each of the target regions (step S100).

In some examples, as described above, the target gene refers to an object desired to be detected, and may be selected according to an actual application scenario. For example, if a pathogen is to be detected, the target gene may be a gene or gene fragment specific to the pathogen, and the pathogen can be identified by detecting the gene or gene fragment.

In some examples, the number of target genes may be one or more. That is, the detection method according to the example of the present embodiment may detect one or a plurality of target genes, that is, may detect one detection target (one target gene) or may detect a plurality of detection targets (a plurality of target genes). For example, the detection method according to the example of the present embodiment can simultaneously detect pathogens related to respiratory tract infection for the purpose of assisting diagnosis of a patient with respiratory tract diseases for a plurality of detection targets (a plurality of target genes).

In some examples, multiple target regions may be selected from the gene sequence of each target gene. For example, at least 2 target regions may be selected from the gene sequence of each target gene. For example, if the target gene is a gene of a novel coronavirus, a plurality of target regions (e.g., 2, 3, 5, or 10 genes, etc.) can be selected from the gene sequence of the novel coronavirus; if the target gene is a gene of a novel coronavirus, a gene of influenza a virus H1N1, or a gene of influenza b virus, a plurality of target regions (for example, 2, 3, 5, or 10) may be selected from the gene sequence of the novel coronavirus, a plurality of target regions (for example, 2, 3, 5, or 10) may be selected from the gene sequence of influenza a virus H1N1, and a plurality of target regions (for example, 2, 3, 5, or 10) may be selected from the gene sequence of influenza b virus.

In some examples, preferably, from the viewpoint of difficulty and cost in designing primers, 2 to 5 target regions may be selected from the gene sequence of each target gene, and primer sets may be designed for the 2 to 5 target regions, respectively. For example, 2, 3, 4 or 5 target regions may be selected from the gene sequence of each target gene.

In some examples, the plurality of target regions selected from the gene sequence of each target gene may not overlap with each other. In other examples, the plurality of target regions selected from the gene sequence of each target gene may only partially overlap with each other. That is, when a plurality of target regions are selected from a certain target gene, the plurality of target regions do not completely overlap with each other. This makes it possible to select a plurality of different target regions from the gene sequences of the respective target genes.

In some examples, as described above, one primer set may be designed for each target region, respectively. In some examples, each primer set can include a plurality of primers. In some examples, each primer set may include a first forward primer, a first reverse primer, a second forward primer, and a third reverse primer, respectively (described in detail later). For each target region, the first forward primer and the first reverse primer in the primer set are typically designed to be different, while the second reverse primer, the second forward primer and the third reverse primer are common.

As described above, the method for detecting a target gene may include preparing a nucleic acid sample to be tested (step S200).

In some examples, in step S200, a test nucleic acid sample can be obtained from a test subject. For example, a nucleic acid sample to be tested can be obtained by collecting a sample containing a tissue, a body fluid, or the like of a test object. For example, when the target gene is a hepatitis virus gene or the like, a sample of nucleic acid to be tested can be usually obtained by collecting blood, lesion tissue or the like. For example, when the target gene is a novel coronavirus gene, an influenza virus gene, a respiratory syncytial virus gene, or the like, a sample of nucleic acid to be tested can be usually obtained by collecting a pharyngeal swab, a sputum, a nasal swab, or the like. The collected nucleic acid sample to be tested can be stored in a test tube and sealed. In some examples, the tube holding the nucleic acid sample may be stored refrigerated or frozen.

In some examples, a nucleic acid extraction kit can be used to extract and obtain a sample of nucleic acid to be tested. Wherein, different nucleic acid extraction kits can be adopted for extraction according to different sample types, and DNA/RNA co-extraction kits can also be used for extraction. In some examples, for a sample containing cells difficult to break, ultrasonic wave can be used to break the walls in advance, and then the extraction of nucleic acid can be performed.

In some examples, after the nucleic acid extraction is completed, the concentration can be measured by using a fluorescence quantitative kit and a fluorescence quantitative instrument, and the concentration of the nucleic acid in each nucleic acid sample is made uniform as much as possible. In some examples, the extracted test nucleic acid sample can be stored at-20 ℃ to-80 ℃.

In some examples, the nucleic acid sample to be tested may include at least one of a DNA sample and an RNA sample, and if the nucleic acid sample to be tested includes an RNA sample, after obtaining the nucleic acid sample to be tested, a step of reverse transcription of the nucleic acid sample to be tested is further included. Thus, a nucleic acid sample to be tested containing an RNA sample can be detected. For example, if the nucleic acid sample to be tested is an RNA sample such as a novel coronavirus gene or an influenza virus gene, the nucleic acid sample to be tested needs to be subjected to reverse transcription and then to be subjected to reverse transcription into a DNA sample.

In some examples, as described above, the target gene detection method may include performing PCR amplification on a test nucleic acid sample using a primer set to obtain a target library (step S300).

In this embodiment, each primer set may include a plurality of primers. In some examples, each primer set can include a first forward primer, a first reverse primer, a second forward primer, and a third reverse primer, respectively.

In some examples, the first forward primer may be, from its 5 ' end to its 3 ' end, in turn, a first sequencing primer and a sequence that matches the 5 ' end of the target region. The first reverse primer may be, from its 5 ' end to its 3 ' end, in turn a second sequencing primer and a sequence matching the 3 ' end of the target region. The second reverse primer may be, in order from its 5 'end to its 3' end, a first sequencing adaptor, a first barcode, and a second sequencing primer. The first barcode in the second reverse primer can be configured to identify a different nucleic acid sample to be tested. The second forward primer may be, in order from its 5 'end to its 3' end, a second sequencing adaptor, a second barcode, and a first sequencing primer. The third reverse primer may be a first sequencing adapter.

In some examples, referring to fig. 3, performing PCR amplification on a test nucleic acid sample using a primer set (step S300) may include the steps of: performing PCR amplification on a nucleic acid sample to be detected by using a first forward primer, a first reverse primer and a second reverse primer to obtain a PCR amplification product (step S310); performing magnetic bead purification on the PCR amplification product (step S320); performing PCR amplification on the purified amplification product by using a second forward primer and a third reverse primer to obtain a second PCR amplification product (step S330); and (4) performing magnetic bead purification on the second PCR amplification product to obtain a target library (step S340).

In some examples, a first forward primer, a first reverse primer, and a second reverse primer are used to perform PCR amplification on a nucleic acid sample to be tested and obtain an amplification product (step S310), and the obtained amplification product is stored in a test tube and sealed. And a step of purifying the PCR amplification product from the amplification product in the test tube by magnetic beads (step S320). In this case, the nucleic acid can be purified by magnetic bead purification, and a nucleic acid fragment of a desired length can be retained, whereby a purified PCR amplification product can be obtained. In addition, in the purification process of step S320, the amplification product stored in the test tube needs to be uncapped, but since the content of the amplified nucleic acid is high, aerosol is easily generated and diffuses into the laboratory environment, thereby generating aerosol pollution. In this case, since different nucleic acid samples to be detected are labeled with the first barcode attached to the second reverse primer after the nucleic acid samples to be detected are subjected to PCR amplification, even if aerosol is generated, the influence of aerosol contamination or the like on the detection results between different samples can be reduced.

In some examples, as shown in fig. 3, the mixed amplification product is PCR amplified using the second forward primer and the third reverse primer (step S330), and then magnetic bead purification is performed (step S340) to obtain the target library, as described above. In this case, the nucleic acid can be purified by magnetic bead purification, the nucleic acid can be separated from other components such as proteins, and a nucleic acid fragment having a desired length can be retained, whereby a purified target library can be obtained. Similarly, in the purification process, a cap opening operation is usually performed, and due to the high content of amplified nucleic acid, aerosol is easily generated and diffuses into the laboratory environment, so that aerosol pollution is generated. In this case, since different nucleic acid samples to be detected are labeled with the first barcode carried by the second reverse primer and different batches of samples are labeled with the second barcode carried by the second forward primer, the influence of aerosol contamination and the like on the detection results of samples between different batches can also be reduced.

In some examples, during steps S320, S330 and S340, operations of adding an experimental reagent to a sample, collecting or transferring a purified sample, and the like may be included. During the above operation, there may be problems of sample mixing, sample splashing, reagent contamination, etc. caused by human error, which may cause contamination between samples. In this case, even if the above-mentioned contamination problem exists, since each nucleic acid sample to be tested is "attached" with a different first barcode after being amplified using the second reverse primer, the influence of the above-mentioned contamination problem on the detection result can be reduced.

In some examples, in step S320, the amplification products of each nucleic acid sample to be detected may be mixed to obtain a mixed amplification product, and then the mixed amplification product is uniformly subjected to magnetic bead purification. Referring to fig. 4, a first forward primer, a first reverse primer and a second reverse primer may be used to perform PCR amplification on a nucleic acid sample to be detected (e.g., a nucleic acid sample to be detected 21, a nucleic acid sample to be detected 22, a nucleic acid sample to be detected 23) stored in different test tubes (wherein different nucleic acid samples to be detected use second reverse primers with different first barcodes), so as to obtain first amplification products (including an amplification product 31, an amplification product 32, and an amplification product 33, respectively). Then, the first amplification products of each nucleic acid sample to be detected are mixed to obtain a mixed amplification product 34, and then the second forward primer and the third reverse primer are used to perform a second PCR amplification on the mixed amplification product 34 to obtain a target product 35. In this case, the first sequencing primer, the second sequencing primer, the first barcode and the first sequencing adaptor can be added to the nucleic acid sample to be tested, and then the second barcode and the second sequencing adaptor can be added to the nucleic acid sample to be tested through the first forward primer, the first reverse primer and the second reverse primer. The first sequencing primer and the second sequencing primer are sequencing primers which are common to a sequencing platform, the first sequencing joint and the second sequencing joint are sequencing joints which are common to the sequencing platform, and then the target library can be suitable for the sequencing platform and sequenced. In addition, the magnetic bead purification and the second PCR amplification are uniformly carried out on the mixed amplification products, so that compared with the magnetic bead purification and the second PCR amplification of the amplification products of each nucleic acid sample to be detected, the use of reagents and the cost of labor can be reduced.

In the step S300, the collected and extracted nucleic acid sample to be tested is usually stored in a test tube and sealed, and the test tube needs to be uncapped when the amplification products of each nucleic acid sample to be tested are mixed. Because the nucleic acid sample to be detected has higher nucleic acid concentration after amplification, aerosol containing amplification products and the like are easily generated after the test tube is uncovered. In contrast, in step S300 according to the present embodiment, since different first barcodes are added to each sample nucleic acid to be detected by the second reverse primer when each sample nucleic acid to be detected is amplified, the influence of contamination between samples and the like on the detection result can be reduced even if aerosol of the amplification product or the like is present. In addition, a plurality of amplification products are mixed and then are subjected to second PCR amplification in a unified manner, so that reagents can be saved, and the working efficiency can be improved.

In some examples, in step S310, a first forward primer, a first reverse primer, and a second reverse primer can be used to perform a multiplex PCR amplification on a nucleic acid sample to be tested, resulting in a PCR amplification product. In some examples, in step S310, each nucleic acid sample to be tested can be subjected to multiplex PCR amplification with a first forward primer, a first reverse primer, and a second reverse primer.

In some examples, in step S310, each nucleic acid sample to be tested, and the first forward primer, the first reverse primer, and the second reverse primer may be divided into multiple portions for multiplex PCR amplification, and then combined. For example, for each nucleic acid sample, the primer sets (the first forward primer, the first reverse primer and the second reverse primer) of each target region can be used to perform PCR amplification on the corresponding target region, and then PCR amplification products of each target region are combined to perform PCR amplification on all target regions of one nucleic acid sample to be detected. Thus, PCR capture and amplification efficiency can be improved. In the process of combining the PCR amplification products of each target region, the PCR amplification products generally need to be collectively transferred from each test tube to one test tube, and aerosol contamination may occur during the transfer process.

For example, when 3 target regions of a nucleic acid sample to be detected need to be subjected to PCR capture and amplification, the nucleic acid sample to be detected can be divided into 3 uniform samples, a first sample is added with a first forward primer, a first reverse primer and a second reverse primer for the first target region, a second sample is added with a first forward primer, a first reverse primer and a second reverse primer for the second target region, a third sample is added with a first forward primer, a first reverse primer and a second reverse primer for the third target region, and after 3 samples are subjected to PCR amplification procedures, the final products of the 3 samples are combined. This can improve PCR capture and amplification efficiency.

In some examples, in step S310, a plurality of annealing temperatures may be selected when performing PCR amplification on a nucleic acid sample to be tested using a first forward primer, a first reverse primer, and a second reverse primer. For example, 3 temperatures can be selected from 57 ℃ to 62 ℃ as the annealing temperature, for example, 57 ℃, 60 ℃ and 62 ℃ as the annealing temperature. This facilitates binding of each primer to the template, thereby increasing the coverage of the target library.

In some examples, in step S310 or step S330, the number of cycles used in PCR amplification may be selected according to the requirements of detection sensitivity and the like. Preferably, in the present embodiment, when the target gene is a gene of a pathogen, the number of cycles per PCR amplification may be 10 to 40 cycles, thereby contributing to satisfying the sensitivity of pathogen detection.

In some examples, in step S310, the first forward primer, the first reverse primer and the second reverse primer may be mixed into a mixed system (primer Mix), and a sample of nucleic acid to be tested is added for PCR amplification.

In some examples, in step S330, the second forward primer and the third reverse primer may be mixed into a mixed system (primer Mix), and the purified amplification product may be added for PCR amplification.

In some examples, where there are different batches, the amplification product may be treated as a particular batch of amplification product and a different second barcode added to the particular batch of amplification product by the second forward primer. Here, regarding the above-described specific lot, it may be that the sample is divided into a plurality of lots after the PCR amplification, in which case, different second barcodes may be added for different lots. In addition, regarding the specific lot described above, the sample may be divided into a plurality of lots after the completion of the sequencing, and in this case, different second barcodes may be added to the samples of different sequencing lots. In other examples, a batch may be defined by itself and the same second barcode added to samples of the same batch.

In the present embodiment, the second barcode is provided for a specific lot, samples of different lots have different second barcodes, and samples of the same lot have the same second barcode, so that after sequencing is completed, which specific lot a certain sample belongs to can be identified according to the sequence of the second barcode, sequencing data not belonging to the specific lot is removed, and sequencing data belonging to the specific lot is retained, whereby the influence of contamination of samples between lots on the detection result can be reduced.

As an example of a specific lot, for example, as shown in fig. 5, the amplification product 31, the amplification product 32, and the amplification product 33 may be made one lot to obtain a mixed amplification product 34; taking the amplification product 41, the amplification product 42 and the amplification product 43 as a batch to obtain a mixed amplification product 44; the amplification product 51, the amplification product 52, and the amplification product 53 were used as one batch to obtain a mixed amplification product 54. Then, the second forward primer and the third reverse primer are used to perform PCR amplification on the mixed amplification product 34, the mixed amplification product 44, and the mixed amplification product 54, and different second barcodes are added to the mixed amplification product 34, the mixed amplification product 44, and the mixed amplification product 54 of different batches by using the second forward primer, so as to finally obtain the target library 60.

In some examples, as described above, the method for detecting a target gene may include sequencing a target library to obtain sequencing data (step S400). Here, the target library is obtained by PCR amplification of a sample of a nucleic acid to be tested using a primer set in step S300.

In some examples, the first and second sequencing primers may be sequencing primers of an illumina sequencing platform, the first sequencing linker may be the P7 linker of the illumina sequencing platform, and the second sequencing linker may be the P5 linker of the illumina sequencing platform, in which case the library of interest may be sequenced by the illumina sequencing platform to obtain sequencing data. Of course, in other examples, other sequencing platforms may be used to sequence the library of interest.

In some examples, the sequencing data may include the sequence of the target library (i.e., the sequence of each DNA fragment). In other words, the sequencing data may include the sequence of each of the reads. In some examples, the sequencing data can also include a sequence of the first barcode and/or a sequence of the second barcode.

In some examples, as described above, the detection method of the target gene may include judging the detection condition of each target region based on the sequencing data (step S500).

In some examples, whether each of the reads is a sequence of a certain target region may be determined based on the sequence of the read, that is, whether each target region is detected may be determined. In some examples, which sample the detected reads belong to may be identified based on the sequence of the first barcode, and which sample of which lot the detected reads belong to may also be identified based on the sequence of the second barcode, thereby obtaining the lot and sample information to which the reads belong. Thus, the detection of each target region in each sample nucleic acid can be determined based on the sequencing data.

In some examples, further, a detection threshold value of each target region may be obtained based on the positive quality control and the negative quality control of each target gene, and whether each target region is detected may be determined based on the detection threshold value. In some examples, a receiver operating characteristic curve (ROC curve) may be obtained by using the positive quality control product and the negative quality control product, a detection threshold value of each target region is established through the ROC curve, and then the detection condition of each target region in the nucleic acid sample to be detected is determined according to the detection threshold value. The positive control material is, for example, a sample including a target gene, the negative control material is, for example, a sample not including a target gene, and the positive control material and the negative control material may be obtained by self-preparation or from a commercially available kit.

In some examples, as described above, the method for detecting a target gene may include determining whether the nucleic acid sample contains the target gene based on the detection of the target region (step S600).

In some examples, in step S600, for each nucleic acid sample to be tested, if the ratio of the number of detected target regions to the number of target regions selected when designing the primer set is greater than a preset ratio, it is determined that the nucleic acid sample to be tested contains the target gene.

In some examples, for each test nucleic acid sample, if the number of detected target regions compared to the number of target regions selected when designing the primer set is not greater than a preset ratio, it is determined that the test nucleic acid sample does not contain the target gene. It is understood that if a sample to be tested contains a target gene, every target region in the sample should be detected theoretically, so if only a small portion (not more than a predetermined ratio) of the target regions in the sample is detected, the sample may be contaminated by other samples. In addition, if a sample to be tested does not contain a target gene, each target region in the sample should not be detected theoretically, so if a target region in the sample is detected (but not exceeding a predetermined ratio), the sample may be contaminated by other samples. Thus, the influence of contamination on the detection result can be further eliminated based on the relationship between the ratio of the number of detected target regions to the number of target regions selected at the time of designing the primer set and the preset ratio.

For example, if for a target gene, a total of 3 target regions are selected. When it was judged from the sequencing data that 2 target regions were detected in the target gene, the ratio of the number of detected target regions to the total number of target regions was 2/3. Then, comparing the ratio (2/3) with a preset ratio, if the ratio is greater than the preset ratio, determining that the nucleic acid sample to be detected contains the target gene, and under normal conditions, the detection result of the nucleic acid sample to be detected can also be called as positive; if the ratio is not greater than the predetermined ratio, it is determined that the target gene is not contained in the nucleic acid sample to be detected, and the detection result of the nucleic acid sample to be detected may also be referred to as negative in general.

In addition, in some examples, if 3 target regions are selected for each of a plurality of target genes, such as a first target gene, a second target gene, and a third target gene. When it is judged from the sequencing data that 2 target regions were detected in the first target gene, the ratio of the number of detected target regions to the total number of target regions was 2/3. Then, comparing the ratio (2/3) with a preset ratio, if the ratio is larger than the preset ratio, determining that the nucleic acid sample to be detected contains a first target gene; if the ratio is not greater than the preset ratio, the nucleic acid sample to be detected does not contain the first target gene. Similarly, if 3 target regions of the second target gene are detected according to the sequencing data, the ratio of the number of the detected target regions to the total number of the target regions is 1. Then, comparing the ratio (1) with a preset ratio, and if the ratio is greater than the preset ratio, judging that the nucleic acid sample to be detected contains a second target gene; if the ratio is not greater than the preset ratio, the nucleic acid sample to be detected does not contain the second target gene. Similarly, if it is determined from the sequencing data that 1 target region of the third target gene is detected, the ratio of the number of detected target regions to the total number of target regions is 1/3. Then, comparing the ratio (1/3) with a preset ratio, and if the ratio is greater than the preset ratio, determining that the nucleic acid sample to be detected contains a third target gene; if the ratio is not greater than the preset ratio, the nucleic acid sample to be detected does not contain the third target gene. In this case, it is possible to determine whether or not the first target gene, the second target gene, and the third target gene are contained in the sample nucleic acid based on the detection result.

In some examples, further, the preset proportion may be 50% to 80%. For example, if the preset ratio is 50%, if 2 target regions are selected for the target gene when designing the primers, it is necessary to determine whether all of the 2 target regions are detected when determining whether the nucleic acid sample to be detected contains the target gene; if 3 target regions are selected for the target gene when designing the primer, whether at least 2 (2 or 3) target regions are detected or not is needed when judging whether the nucleic acid sample to be detected contains the target gene or not; if 5 target regions are selected for a target gene when designing a primer, it is necessary to determine whether at least 3 (3, 4, or 5) target regions are detected when determining whether a nucleic acid sample to be tested contains the target gene. That is, when more than half of the target region is detected, the nucleic acid sample to be tested is judged to contain the target gene (i.e., the detection result is positive).

Hereinafter, the primer set according to the present disclosure will be described in more detail.

In some examples, as described above, the primer set is a primer set that selects a plurality of target regions from the gene sequence of the target region and is designed separately for each target region.

In some examples, the sequence of the gene of interest is known or published and can be obtained by public database queries or downloads, such as the National Center for Biotechnology Information (NCBI) DNA sequence database (GenBank), using software (Clone Manager) to locate conserved sequence regions of pathogens. In some examples, multiple target regions may be selected from conserved sequence regions of the target gene for designing specific primers. In some examples, degenerate bases in the primers can be increased, thereby enabling increased coverage of the primers for conserved regions.

In some examples, as described above, the number of target genes may be plural, that is, the primer set of the present embodiment may be used for simultaneous detection of a plurality of detection targets.

In some examples, when the primer set is used for target gene detection of a nucleic acid sample to be detected, the first forward primer, the first reverse primer and the second reverse primer can be used for performing PCR amplification on the nucleic acid sample to be detected and obtaining an amplification product, and then the second forward primer and the third reverse primer can be used for performing PCR amplification on the amplification product.

In some examples, the first forward primer can include a first sequencing primer and a sequence that matches the 5' end of the target region. Specifically, the first forward primer may be, from its 5 ' end to its 3 ' end, the first sequencing primer and the sequence matching the 5 ' end of the target region in that order.

In some examples, the first reverse primer may include a second sequencing primer and a sequence that matches the 3' end of the target region. Specifically, the first reverse primer may be, from its 5 ' end to its 3 ' end, the second sequencing primer and the sequence matching the 3 ' end of the target region in that order.

In some examples, the second reverse primer may include a second sequencing primer, a first barcode, and a first sequencing adapter. Specifically, the second reverse primer may be, in order from its 5 'end to its 3' end, a first sequencing adaptor, a first barcode, and a second sequencing primer.

In some examples, the first barcode in the second reverse primer may be configured to identify different nucleic acid samples to be tested. That is, the first barcodes used for the same sample of nucleic acid to be tested have the same sequence, and different first barcodes are used for different samples of nucleic acid to be tested. In some examples, different first barcodes are used for at least the nucleic acid samples to be detected in the same batch, and in this case, the influence of aerosol pollution and the like on the detection results of different nucleic acid samples to be detected can be reduced by adding the first barcodes to the nucleic acid samples to be detected in the first PCR amplification process.

In some examples, the first barcode may be a random sequence. For example, a first barcode may consist of several bases, with different base orderings representing different first barcodes. In some examples, the first barcode may be a random sequence having a number of bases ranging from 6 to 12. For example, the first barcode may be a random sequence with a number of bases of 6, 7, 8, 9, 10, 11, or 12.

In some examples, the second forward primer may include a second sequencing adaptor and a first sequencing primer. Specifically, the second forward primer may be, in order from its 5 'end to its 3' end, the second sequencing adaptor and the first sequencing primer.

In some examples, the second forward primer may further comprise a second barcode. Specifically, the second forward primer may be, in order from its 5 'end to its 3' end, a second sequencing adaptor, a second barcode, and a first sequencing primer. The second barcode may be configured to identify different batches of samples. That is, the sequence of the second barcode used for the nucleic acid sample to be tested in the same lot is the same, and the sequence of the second barcode used for the nucleic acid sample to be tested in different lots is different. Therefore, the influence of aerosol pollution and the like on the detection results of different batches of samples can be reduced.

In some examples, the second barcode may be a random sequence. For example, the second barcode may consist of several bases, with different base orderings representing different second barcodes. In some examples, the first barcode may be a random sequence with a base number of 6 to 12. For example, the first barcode may be a random sequence with a number of bases of 6, 7, 8, 9, 10, 11, or 12.

In some examples, it is preferred that the second barcode is different from the first barcode for the sake of more convenient sequencing data analysis. Specifically, the number of bases of the second barcode may be different from that of the first barcode, or the base sequence of the second barcode may be different from that of the first barcode.

In some examples, the third reverse primer may include a first sequencing adaptor. In some examples, the third reverse primer can be a first sequencing adaptor.

In some examples, the first forward primer can be used as a forward primer of the target region, and the first reverse primer and the second reverse primer can be used as reverse primers of the target region, and the target region is captured and amplified by PCR to obtain an amplification product.

In some examples, the second forward primer can be used as a forward primer for the amplification product, and the third reverse primer can be used as a reverse primer for the amplification product, and the amplification product is subjected to PCR amplification to obtain the target library.

In some examples, as can be seen from the composition of the first forward primer, the first reverse primer, the second forward primer and the third reverse primer, in the actual primer design, the first forward primer and the first reverse primer are designed mainly for each target region separately, while the second reverse primer, the second forward primer and the third reverse primer may be common for each target region, i.e., the second reverse primer, the second forward primer and the third reverse primer do not need to be designed separately for different target regions.

In some examples, as described above, the first and second sequencing primers can be sequencing primers of an illumina sequencing platform, the first sequencing linker can be the P7 linker of the illumina sequencing platform, and the second sequencing linker can be the P5 linker of the illumina sequencing platform. Thus, a target library obtained by amplifying a target region with a primer set can be sequenced by the illumina sequencing platform to obtain sequencing data. In other examples, the first sequencing primer, the second sequencing primer, the first sequencing adapter and the second sequencing adapter may also be universal sequencing primers and universal sequencing adapters of other sequencing platforms, and may be selected according to actual situations.

The primer set according to the present embodiment will be further described below with reference to the drawings. Fig. 6 shows a schematic diagram of selecting a plurality of target regions from a gene sequence of one target gene according to an example of the present disclosure. Fig. 7 shows a schematic diagram of the selection of multiple target regions from gene sequences of multiple (3) target genes, according to examples of the present disclosure. Fig. 8 shows a schematic diagram of a process for PCR amplification of a target region 100 by a primer set according to an example of the present disclosure.

In some examples, as shown in fig. 6, 3 target regions, i.e., target region 100, target region 200, and target region 300, may be selected from the gene sequence of target gene 10. Here, the target region 100, the target region 200 and the target region 300 are selected from conserved sequence regions of the target gene 10. In some examples, the

target regions

100, 200, and 300 may be different from each other, thereby better obtaining target regions having different sequences, and thus obtaining a determination result based on sequencing data of the target regions more conveniently. In some examples, target area 100, target area 200, and target area 300 may not overlap with each other. In other examples,

target areas

100, 200, and 300 may only partially overlap.

In some examples, as shown in fig. 7, 3 target regions, i.e., target region 100A, target region 200A, and target region 300A, may be selected from the gene sequence of target gene 10A, 2 target regions, i.e., target region 100B and target region 200B, may be selected from the gene sequence of

target gene

10B, and 3 target regions, i.e., target region 100C, target region 200C, and target region 300C, may be selected from the gene sequence of target gene 10C. Here, the target region 100A, the target region 200A, the target region 300A, the target region 100B, the target region 200B, the target region 100C, the target region 200C and the target region 300C are selected from conserved sequence regions of the target gene 10A, the target gene 10B and the target gene 10C.

In some examples, likewise, target area 100A, target area 200A, and target area 300A may be different from one another. In some examples, target area 100A, target area 200A, and target area 300A may not overlap with one another. In other examples, target area 100A, target area 200A, and target area 300A may only partially overlap.

In some examples, likewise, target area 100B and target area 200B may be different from one another. In some examples, target area 100B and target area 200B may not overlap with each other. In other examples, target area 100B and target area 200B may only partially overlap.

In some examples, likewise, target area 100C, target area 200C, and target area 300C may be different from one another. In some examples, target area 100C, target area 200C, and target area 300C may not overlap with one another. In other examples, target area 100C, target area 200C, and target area 300C may only partially overlap.

In some examples, the target gene 10 may be any of a novel coronavirus gene, an influenza a virus H1N1 gene, an influenza b virus gene, a coronavirus 229E, or a respiratory syncytial virus gene. In some examples, the plurality of target genes (e.g., target gene 10A, target gene 10B, target gene 10C) may be any one of a novel coronavirus gene, an influenza a H1N1 gene, an influenza B gene, a coronavirus 229E, or a respiratory syncytial virus gene, and the plurality of target genes are different from one another.

Hereinafter, the primer set will be described by way of example with reference to FIG. 8, in which the primer set is used to amplify the target region 100 by PCR.

As shown in fig. 8, the primer set designed for the target region 100 may include a primer 11 (first forward primer), a primer 12 (first reverse primer), a primer 13 (second reverse primer), a primer 14 (second forward primer), and a primer 15 (third reverse primer). Wherein, the primer 11 can be the first sequencing primer and the forward complementary sequence of the target region 100 in sequence from the 5 'end to the 3' end. Primer 12 may be, in order from its 5 'end to its 3' end, the second sequencing primer and the reverse complement of the target region 100. Primer 13 may be, in order from its 5 'end to its 3' end, a second sequencing primer, a first barcode, and a sequencing adaptor P7. The primer 14 may be, in order from its 5 'end to its 3' end, a sequencing adaptor P5, a second barcode, and a first sequencing primer. Primer 15 may be sequencing adaptor P7. The first sequencing primer and the second sequencing primer are universal sequencing primers of an illumina sequencing platform.

In this case, primer 11 can be used as a forward primer for the target region 100, and primer 12 and primer 13 can be used as a reverse primer for the target region 100, and the target region is captured and amplified by PCR (first round amplification) to obtain an amplification product 101. Primer 14 can be used as a forward primer of the amplification product 101, and primer 15 can be used as a reverse primer of the amplification product 101, and the amplification product 101 is subjected to PCR amplification (second round of amplification) to obtain the target library 102.

In this embodiment, the first forward primer and the first reverse primer include sequences (forward complementary sequence and reverse complementary sequence) that specifically bind to the upstream or downstream of the target region, and thus, the first forward primer and the first reverse primer need to be designed and synthesized separately for each target region. The composition of the second reverse primer, the second forward primer and the third reverse primer can all be known sequences, and therefore, the second reverse primer, the second forward primer and the third reverse primer can be universal for each target region without being separately designed and synthesized. That is, in some examples, the first forward primer and the first reverse primer may be designed separately for each target region; the second reverse primer, the second forward primer and the third reverse primer may be universal primers and need not be designed separately for each target region.

In some examples, as with the target region 100, a first forward primer and a first reverse primer that specifically bind to the target region 200 upstream and downstream may also be designed and obtained for the target region 200; the second reverse primer, the second forward primer and the third reverse primer are universal primers. Similarly, for the target region 300, a first forward primer and a first reverse primer that specifically bind to the upstream and downstream of the target region 300 may be designed; the second reverse primer, the second forward primer and the third reverse primer are universal primers.

In the case of a plurality of target genes, similarly, a first forward primer and a first reverse primer that specifically bind to the upstream and downstream of each target region are designed and obtained for each target region of each target gene. And the second reverse primer, the second forward primer and the third reverse primer for each target region of each target gene are all universal primers.

Hereinafter, a kit for detecting a target gene (hereinafter, simply referred to as "kit") according to the present disclosure will be described in detail with reference to fig. 9. Fig. 9 shows a schematic diagram of a kit according to examples of the present disclosure.

In the present disclosure, the target gene may be selected according to actual needs. For example, the target gene may be a pathogen gene including, but not limited to, influenza A H1N1, influenza B, novel coronavirus (SARS-CoV-2), coronavirus 229E, respiratory syncytial virus, and the like.

In some examples, the kit 1 may be used in different application scenarios depending on the detection object (target gene). For example, the kit 1 may be a kit for detecting a new coronavirus, a kit for detecting a pathogen associated with respiratory infection, a kit for detecting a pathogen associated with central nervous system infection, or the like.

In the present embodiment, the kit 1 may include the primer set described above. Specifically, the kit 1 may include a reagent bottle 810 containing a first forward primer, a reagent bottle 820 containing a first reverse primer, a reagent bottle 830 containing a second reverse primer, a reagent bottle 840 containing a second forward primer, and a reagent bottle 850 containing a third reverse primer.

In some examples, the kit 1 may further include at least one of a positive quality control, a negative quality control, a reverse transcription reagent, a nucleic acid extraction reagent, a banking reagent (including PCR buffer, DNA polymerase, dNTPs, etc.), a quantification reagent, a purification reagent, a sequencing reagent. Here, the positive quality control material, the negative quality control material, the reverse transcription reagent, the nucleic acid extraction reagent, the library construction reagent (including PCR buffer, DNA polymerase, dNTPs, etc.), the quantification reagent, the purification reagent, and the sequencing reagent may be made by the manufacturer or sold in the market.

As described above, the positive quality control material may be a sample including a target gene, and the negative quality control material may be a sample not including a target gene. Thus, true positive and false positive samples can be provided for each target region of the target gene, for establishing an ROC curve to obtain a detection threshold for each target region, or for performing a positive control experiment or a negative control experiment.

In some examples, the kit 1 may further include instructions that can describe how to use the kit of the present disclosure to detect a target gene, and instructions that can also describe how to interpret the detection result.

According to the kit, the accuracy of a detection result can be improved when the target gene is detected.

In addition, the present disclosure also relates to an application of the primer set in the preparation of a kit for detecting a target gene (hereinafter, simply referred to as "application"). In this embodiment, depending on the detection target, the application of the primer set in the preparation of different kits can be provided, for example, the application of the primer set in the preparation of a kit for detecting a pathogen, the application of the primer set in the preparation of a reagent for assisting in screening a patient with new coronary pneumonia, the application of the primer set in the preparation of a kit for detecting a pathogen associated with respiratory infection, and the like.

Hereinafter, the detection method, the primer set, the kit and the application provided by the present invention will be described in detail with reference to examples and comparative examples, but they should not be construed as limiting the scope of the present invention.

[ examples ]

First, a specific forward complementary sequence and a specific reverse complementary sequence of the examples were designed and obtained, respectively, according to table 1, and finally, each primer set (first forward primer, first reverse primer, second forward primer, and third reverse primer) of the examples was obtained. Next, a sample of example was prepared, and nucleic acid was extracted from the sample of example. Next, in the examples, the nucleic acids were amplified using the corresponding primer sets to obtain the constructed libraries. And then, carrying out quantitative and on-machine sequencing on the constructed library, and finally carrying out sequencing data analysis to obtain a detection result. Among the samples used in the examples are positive samples of influenza a virus H1N1, influenza b virus, coronavirus 229E, novel coronavirus and respiratory syncytial virus, and negative control samples and blank control samples. Wherein, the negative control sample is a sample without genes of influenza A virus H1N1, influenza B virus, coronavirus 229E, novel coronavirus or respiratory syncytial virus, and the blank control sample is a pure water sample. The samples used in the examples are all commercially available. The above specific steps are described below.

1. Primer design

In the examples, primers were designed for the pathogens in table 1. The nucleic acid sequences of the pathogens were downloaded by NCBI (www.ncbi.nlm.nih.gov) and the conserved sequence regions of the pathogens were searched using software (Clone Manager). 3 regions from the conserved sequence region of each pathogen were selected as target regions, and specific forward and reverse complementary sequences were designed for each target region. Specific sequence information is shown in table 1 below.

TABLE 1 pathogen and primer sequence information

In Table 1, in the examples, PT1-F-1 refers to a specific complementary sequence designed against the 5' end of the first target region of the gene of influenza A virus H1N 1; PT1-R-1 refers to a specific complementary sequence designed against the 3' end of the first target region of the gene of influenza A virus H1N 1; PT1-F-2 refers to a specific complementary sequence designed against the 5' end of the second target region of the gene of influenza A virus H1N 1; PT5-F-3 refers to a specific complementary sequence designed for the 5' end of the third target region of the gene of respiratory syncytial virus; the meanings of the other abbreviations are similar and will not be described herein.

In embodiments, the first forward primer of each region of each pathogen is, from its 5 'end to 3' end, the first sequencing primer and the corresponding forward complement of table 1, respectively, and the first reverse primer of each region of each pathogen is, from its 3 'end to 5' end, the corresponding reverse complement of table 1 and the second sequencing primer, respectively.

In embodiments, the second reverse primer, the second forward primer, and the third reverse primer of each region of each pathogen are universal primers. The second reverse primer is a second sequencing primer, a first barcode and a sequencing joint P7 from the 3 'end to the 5' end, the second forward primer is a sequencing joint P5, a second barcode and a first sequencing primer from the 5 'end to the 3' end, and the third reverse primer is a sequencing joint P7.

In an embodiment, the first barcode is a random sequence of base number 8, the same first barcode being used for the same sample. The second barcode is a random sequence with a base number of 8.

In embodiments, sequencing linker P5 and sequencing linker P7 are universal linker sequences for the illumina sequencing platform; the first sequencing primer and the second sequencing primer are universal sequencing primers of an illumina sequencing platform, and the specific sequences are as follows:

sequencing linker P5: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID: NO. 31);

sequencing linker P7: CAAGCAGAAGACGGCATACGAGAT (SEQ ID: NO. 32);

first sequencing primer: ACACTCTTTCCCTACACGACGCTCTTCCGAT (SEQ ID: NO. 33);

a second sequencing primer: GTGACTGGAGTTCAGACGTGTGCTCTTCC GATC (SEQ ID: NO. 34).

2. Sample extraction

The samples prepared in the examples were extracted separately. Specifically, a DNA/RNA co-extraction kit was used to extract nucleic acids from a positive sample of influenza a virus H1N1, a positive sample of influenza b virus, a positive sample of coronavirus 229E, a positive sample of novel coronavirus, a positive sample of respiratory syncytial virus, a negative control sample, and a blank control sample, and the procedures were performed with reference to the kit instructions. The nucleic acids extracted respectively were stored in test tubes at-20 ℃. The DNA/RNA co-extraction kit is a commercially available kit.

3. Library construction

3.1 reverse transcription

The extracted nucleic acids are reverse transcribed separately with random primers. Specifically, 2. mu.l of random primers and 6. mu.l of the extracted nucleic acids were added to a reaction tube, and after denaturation by incubation at 65 ℃ for 5min (minutes), the reaction tube was kept on ice for 2 min. Next, 10. mu.l of 2 XTRT Mix and 2. mu.l of RT Enzyme Mix were added. Then, carrying out reverse transcription program under the reaction condition of 25 ℃ for 5 min; 50 ℃ for 45 min; 85 ℃ for 2 min. Finally, the resulting reverse transcription product (cDNA/DNA template) was stored at 4 ℃. In the examples, the reagents and instruments used were all commercially available products, unless otherwise specified.

3.2 first round PCR amplification

The first round of PCR reaction system mainly adds the above-mentioned first sequencing primer, second sequencing primer, first barcode and sequencing adaptor P7 to each sample.

PCR capture of all target regions of the samples was performed in 2 aliquots, using reverse transcription product cDNA/DNA as template, to prepare 2 separate PCR reaction systems per sample.

Specifically, the PCR amplification buffer (Amplicon PCR buffer) was thawed at room temperature, and after thawing, shaking and centrifugation were performed. The amplilase mixture (Amplicon enzyme Mix) was centrifuged. For the five pathogen genes in table 1, the first forward primers of multiple target regions of each pathogen gene are divided into two first forward primer mixing pools, namely a first forward primer mixing pool 1 and a first forward primer mixing pool 2, according to the target region. For the five pathogen genes in table 1, the first reverse primers of the multiple target regions of each pathogen gene are divided into two first reverse primer mixing pools, namely a first reverse primer mixing pool 1 and a first reverse primer mixing pool 2, according to the target region. In this example, the first forward primer mix pool 1 and the first reverse primer mix pool 1 are used for PCR capture and amplification of a part of the 3 target regions of each pathogen gene; the first forward primer mix pool 2 and the first reverse primer mix pool 2 are used for PCR capture and amplification of the remaining target regions of the 3 target regions of each pathogen gene. In addition, a second reverse primer and a cDNA/DNA template were prepared. The prepared reagent is placed on an ice box for standby.

Next, a first round PCR reaction system 1 and a first round PCR reaction system 2 for each sample were prepared according to the PCR reaction systems shown in table 2 and table 3 below, respectively. Different second reverse primers are added to different samples, and the same second reverse primer is added to two PCR reaction systems of the same sample. Preparing premixed reaction liquid according to the number of samples, subpackaging the premixed reaction liquid into 0.2ml of PCR tubes, and then adding a second reverse primer and a cDNA/DNA template.

TABLE 2 first round PCR reaction System 1

TABLE 3 first round PCR reaction System 2

Then, the PCR tube was placed in a PCR instrument and operated according to the first round of PCR reaction procedure shown in table 4 below to obtain the first round PCR amplification product.

TABLE 4 first round PCR reaction procedure

3.3 first round PCR amplification product purification

In the examples, after the first round of PCR amplification was completed, the reaction solutions of the above first round PCR reaction system 1 and first round PCR reaction system 2 were mixed to obtain a mixed solution of 50 μ l volume. Subsequently, the mixed solution was purified using 0.7 × XP magnetic beads, rinsed with 80% ethanol, and after the magnetic beads were dried, eluted with 53 μ l of eluent (TE). The above steps were repeated once, and 20. mu.l TE was used for elution to obtain the first round of PCR amplification product after purification. And finally, mixing the purified first round PCR amplification products of all the samples into a tube to obtain a mixed amplification product.

3.4 second round PCR amplification

The second round of PCR amplification mainly adds the sequencing linker P5 and the second barcode, and enriches the first round PCR amplification products.

Specifically, the second round of PCR reaction solution was prepared according to the reaction system shown in Table 5 below.

TABLE 5 second round PCR reaction System

Then, the PCR tube was placed in a PCR instrument and run according to the reaction procedure shown in table 6 below to obtain a second round of PCR amplification products.

TABLE 6 second round PCR reaction procedure

3.5 second round PCR amplification product purification

Mu.l of the second round PCR amplification product was purified once using 0.7 XXP magnetic beads. Then, elution was performed using 20. mu.l of TE to obtain a purified second round PCR amplification product.

4. Library quantification, on-machine sequencing

The purified second round PCR amplification product (target library) was accurately quantified with reference to the Qubit fluorometer 4.0 specification. The on-machine sequencing was then performed using PE150 of the illumina sequencing platform, with the steps performed strictly according to the supplier requirements.

5. Sequencing data analysis

The data from the sequencing was filtered for low quality sequences and linker sequences. The comparison is then performed using the comparison software BWA against a reference pathogen database and the number of reads detected for the pathogen is determined.

[ comparative example ]

First, for the five pathogen genes in table 1, the first forward primer and the first reverse primer of the same first target region as in example were used as the first forward primer and the first reverse primer of the comparative example for the first round of amplification of each comparative example. In other words, the comparative example only captured and amplified the first target region of each pathogen. In the comparative example, the same second reverse primer as in the example above and a newly synthesized third forward primer were used as primers for the second round of amplification for each comparative example. Then, extracting the nucleic acid of the sample of the obtained comparative example, and amplifying the nucleic acid of each sample by using the first forward primer, the first reverse primer, the second reverse primer and the third forward primer respectively to obtain a constructed library. And then, carrying out quantitative and on-machine sequencing on the constructed library, and finally carrying out sequencing data analysis to obtain a detection result. Among them, the samples used in the comparative examples were positive samples of influenza A virus H1N1, influenza B virus, coronavirus 229E, novel coronavirus and respiratory syncytial virus, and negative control samples and blank control samples. Wherein, the negative control sample is a sample without genes of influenza A virus H1N1, influenza B virus, coronavirus 229E, novel coronavirus or respiratory syncytial virus, and the blank control sample is a pure water sample. The samples used in the comparative examples are all commercially available. The specific steps are described below.

1. Primer design

First forward primers of the same first target region as in example were used as the first forward primers of the comparative examples, respectively, and first reverse primers of the same first target region as in example were used as the first reverse primers of the comparative examples, respectively. The same second reverse primer as in example was used as the second reverse primer of comparative example. Then, the third forward primer of the comparative example was synthesized, which was the sequencing linker P5 and the first sequencing primer from its 5 'end to 3' end, respectively. The first sequencing primer is also a universal sequencing linker and sequencing primer of the illumina sequencing platform).

2. Sample extraction

Samples of each comparative example, namely a positive sample of influenza a virus H1N1, a positive sample of influenza b virus, a positive sample of coronavirus 229E, a positive sample of novel coronavirus, a positive sample of respiratory syncytial virus, and a negative control sample and a blank control sample were prepared, and the samples were extracted using the same protocol as in the examples to obtain nucleic acids of each sample.

3. Library construction

3.1 reverse transcription

The extracted nucleic acids were reverse-transcribed separately using the same protocol as in the example to obtain a reverse transcription product for each sample, i.e., a cDNA/DNA template.

3.2 first round PCR amplification

PCR capture of the target region of each sample was performed in 2 aliquots, and 2 separate PCR reaction systems were prepared for each sample using the reverse transcription product cDNA/DNA as a template.

Specifically, the PCR amplification buffer (Amplicon PCR buffer) was thawed at room temperature, and after thawing, shaking and centrifugation were performed. The amplilase mixture (Amplicon enzyme Mix) was centrifuged. For the five pathogen genes in table 1, the first forward primer of each pathogen gene is divided into two first forward primer mixing pools, namely a first forward primer mixing pool 1 and a first forward primer mixing pool 2. For the five pathogen genes in table 1, the first reverse primer of each pathogen gene is divided into two first reverse primer mixing pools, namely a first reverse primer mixing pool 1 and a first reverse primer mixing pool 2. In the comparative example, only the first target region of each of the five pathogen genes was captured. The first forward primer mixing pool 1 and the first reverse primer mixing pool 1 are used for carrying out PCR capture and amplification on a first target region of partial pathogen genes in the five pathogen genes; the first forward primer mixing pool 2 and the first reverse primer mixing pool 2 are used for carrying out PCR capture and amplification on a first target region of the remaining pathogen genes in the five pathogen genes. In addition, a cDNA/DNA template was prepared. The prepared reagent is placed on an ice box for standby.

Next, the first round PCR reaction system 1 and the first round PCR reaction system 2 were prepared according to the systems shown in table 7 and table 8 below, respectively.

TABLE 7 first round PCR reaction System 1

TABLE 8 first round PCR reaction System 2

Then, the first round PCR reaction procedure shown in table 9 below was followed and run to obtain the first round PCR amplification product.

TABLE 9 first round PCR reaction procedure

3.3 first round PCR amplification product purification

After the first round of PCR amplification is completed, the reaction solutions of the first round of PCR reaction system 1 and the first round of PCR reaction system 2 are mixed to obtain a mixed solution with a volume of 50. mu.l. Subsequently, the mixed solution was purified using 0.7 × XP magnetic beads, rinsed with 80% ethanol, and after the magnetic beads were dried, eluted with 53 μ l TE. Repeating the steps once, and finally eluting by using 20 mu l of TE to obtain a purified first round PCR amplification product.

3.4 second round PCR amplification

Preparing a second reverse primer and a third forward primer of the comparative example, and performing second PCR amplification on the purified first PCR amplification products by using the second reverse primer and the third forward primer respectively. Different second reverse primers were added for different samples.

Specifically, the second round of PCR reaction solution was prepared according to the reaction system shown in Table 10 below.

TABLE 10 second round PCR reaction System

Then, the reaction procedure shown in the following table 11 was followed to obtain the second round of PCR amplification products.

TABLE 11 second round PCR reaction procedure

3.5 second round PCR amplification product purification

And respectively purifying the second round PCR amplification products of each sample, specifically, taking 20 μ l of the second round PCR amplification products, and purifying once by using 0.7X XP magnetic beads. Then, elution was performed using 20. mu.l of TE to obtain a purified second round PCR amplification product.

4. Library quantification, on-machine sequencing

5. Sequencing data analysis

The data from the sequencing was filtered for low quality sequences and linker sequences. Then, the comparison software BWA is used for comparing the pathogen detection data with a reference pathogen database, and the number of reads detected by the pathogen is judged. In the above respective proportions, the reagents used were all commercially available products, unless otherwise specified.

[ test results ]

Comparison of anti-pollution effects

The results of analyzing the number of reads detected for the first target region in the examples and comparative examples, and the number of reads detected for the first target region in the negative control and blank control are shown in Table 12 below.

TABLE 12 comparison of anti-contamination effects

The above results show that only 0 to 4 Reads were detected in the negative control of the example, only 0 to 1 Reads were detected in the blank control of the example, more than 10 or even several hundred Reads were detected in the negative control of the comparative example, and 10 or even several hundred Reads were detected in the blank control of the comparative example. The detection method of the embodiment can reduce pollution among samples, has obvious effect on pollution prevention, can improve the accuracy of detection results, and obviously reduces the false positive rate.

Result accuracy comparison

The test results of the positive samples of the novel coronavirus in the examples were selected and analyzed, and whether the test results were positive or negative was determined based on the detection ratio of the target region. Whether the corresponding pathogen is detected is judged by judging whether the target area of each pathogen is detected by more than 50 percent (namely, the preset proportion is 50 percent). In other words, in the novel coronavirus sample of the example, when 2 or more target regions among 3 target regions of five pathogens were detected, the detection result of the pathogen was judged to be positive, and when less than 2 (0 or 1) target regions were detected, the detection result of the pathogen was judged to be negative. The results are shown in Table 13 below.

TABLE 13 result accuracy comparisons

As shown in table 13, in the detection results of the novel coronavirus sample of the example, three target regions (the first target region, the second target region, and the third target region) of the gene of the novel coronavirus, which is a pathogen, were detected, and the number of the detected target regions was 3, so that the detection ratio of the target regions was 100% and more than 50%, and therefore, the sample was judged to be positive for the novel coronavirus. In the detection results of the novel coronavirus specimen of the example, since one target region (first target region) was detected in the pathogen gene of influenza a virus H1N1 and the number of detected target regions was 1, the detection ratio of the target regions was 33.3% or less and not more than 50%, and the specimen was judged to be influenza a virus H1N1 negative. In the detection results of the novel coronavirus sample of the examples, a target region (third target region) was detected in the gene of a pathogen of influenza b virus, and the number of the detected target regions was 1, so that the detection ratio of the target region was 33.3% and not more than 50%, and the sample was judged to be negative for influenza b virus. In the detection result of the novel coronavirus sample of the example, one target region (first target region) was detected in the gene of coronavirus 229E as a pathogen, and the number of the detected target regions was 1, so that the detection ratio of the target region was 33.3% and not more than 50%, and the sample was judged to be negative for coronavirus 229E. In the test results of the novel coronavirus sample of the example, the target regions of the pathogen gene of respiratory syncytial virus were not detected, and the number of the detected target regions was 0, so that the ratio of the detected target regions was 0 and not more than 50%, and therefore, the sample was judged to be negative for respiratory syncytial virus.

If the present example only tests the first target region of influenza A virus H1N1, influenza B virus, coronavirus 229E, novel coronavirus and respiratory syncytial virus, then the test results for the novel coronavirus sample of the example show that the sample has reads numbers of influenza A virus H1N1, coronavirus 229E and novel coronavirus, therefore, the detection result of the sample can be positive to influenza A virus H1N1, negative to influenza B virus, positive to coronavirus 229E, positive to novel coronavirus and negative to respiratory syncytial virus, this is clearly inconsistent with the actual conditions of the novel coronavirus samples of the examples (actual conditions should be influenza a H1N1 negative, influenza b negative, coronavirus 229E negative, novel coronavirus positive and respiratory syncytial virus negative), resulting in false positives in the detection results for 2 pathogens influenza a H1N1 and coronavirus 229E.

However, in this embodiment, the detection results of the sample of the novel coronavirus of the embodiment are matched with the actual conditions of the sample by simultaneously detecting three target regions of influenza a virus H1N1, influenza b virus, coronavirus 229E, novel coronavirus and respiratory syncytial virus and determining the detection results according to the relationship between the detection ratio of the target region per pathogen and 50% (the preset ratio).

The above results show that the false positive rate of the detection result can be reduced by detecting a plurality of target regions of a pathogen and determining whether the pathogen is detected according to whether more than 50% (a preset ratio) of the target regions are detected.

While the present disclosure has been described in detail above with reference to the drawings and the embodiments, it should be understood that the above description does not limit the present disclosure in any way. Those skilled in the art can make modifications and variations to the present disclosure as needed without departing from the true spirit and scope of the disclosure, which fall within the scope of the disclosure.

Sequence listing

<110> Shenzhen combined medical science and technology Limited

<120> target gene detection method, primer group, kit and application

<160> 34

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 1

gatcaagtga kmgrragymg raayccagg 29

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 2

tcttcawatg carswsmawk gcatgccatc 30

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

cgtcycaagg caccaaacgr 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

ttrggrtcyt tyccmgcrct 20

<210> 5

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 5

atgagyctty taaccgaggt cgaaacg 27

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 6

tggacaaanc gtctacgctg cag 23

<210> 7

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 7

gatcaagtga kmgrragymg raayccagg 29

<210> 8

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 8

cttaatatgg aaacaggtgt tgccatatt 29

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

acatcycayg gagcacatrg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

gcagagggrc ccagcatttt 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

cragtggcag gagcaargta 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

rgctccgaag aaaccycttt 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 13

acaacgtggt cgtcagggta g 21

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 14

atctttatgr ggtcctgtgc ca 22

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 15

agcttatagg ctattggaat gttca 25

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 16

ccatttggga gcttttgatt g 21

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 17

tgttactgtt gytgawgaac ctga 24

<210> 18

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 18

cgttttcgct gactttttgt ct 22

<210> 19

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 19

tttcagtgtc aacataacca gtcg 24

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 20

aataacggtc aaagagtttt aac 23

<210> 21

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 21

gacaagtgca tattgttaca ctcctg 26

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 22

caatttggtc atctggactg ct 22

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 23

gctcacgagt gagttcacgg a 21

<210> 24

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 24

caaaaggttt gagattagac ttcctaa 27

<210> 25

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 25

tcacgarggc tccacataca c 21

<210> 26

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 26

atgccttaat ttcacagggt 20

<210> 27

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 27

gggtgcccat gttccaatca 20

<210> 28

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 28

tcrcagggtg tggttacatc 20

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 29

ggggcaaatg caaacatgtc c 21

<210> 30

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 30

ggggttgtgt tcttgatc 18

<210> 31

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 31

aatgatacgg cgaccaccga gatctacac 29

<210> 32

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 32

caagcagaag acggcatacg agat 24

<210> 33

<211> 31

<212> DNA

<213> Artificial Sequence

<400> 33

acactctttc cctacacgac gctcttccga t 31

<210> 34

<211> 33

<212> DNA

<213> Artificial Sequence

<400> 34

gtgactggag ttcagacgtg tgctcttccg atc 33

Claims

1. A method for detecting a target gene, comprising the steps of:

selecting a plurality of target regions from the gene sequence of each target gene aiming at one or more target genes, respectively designing a primer group aiming at each target region, to obtain a plurality of primer sets for the plurality of target regions, each primer set comprising a first forward primer, a first reverse primer, a second forward primer and a third reverse primer, the first forward primer comprises a first sequencing primer and a sequence matching the 5' end of the target region, the first reverse primer comprises a second sequencing primer and a sequence matched with the 3' end of the target region, the second reverse primer comprises the second sequencing primer, a first barcode, and a first sequencing adapter, the second forward primer comprises a second sequencing adaptor and the first sequencing primer, and the third reverse primer comprises the first sequencing adaptor;

preparing a plurality of nucleic acid samples to be detected;

performing PCR amplification on each nucleic acid sample to be detected by using the first forward primer, the first reverse primer and the second reverse primer respectively to obtain an amplification product of each nucleic acid sample to be detected;

mixing the amplification products of the nucleic acid samples to be detected to obtain mixed amplification products, and performing PCR amplification on the mixed amplification products by using the second forward primer and the third reverse primer to obtain a target library;

sequencing the target library, and acquiring sequencing data of the target library, wherein the sequencing data comprises a sequence of the target library, and the sequence of the target library comprises a sequence of the first barcode;

determining whether each target region is detected based on the sequence of the target library, and identifying each nucleic acid sample to be tested based on the sequence of the first barcode; and is provided with

And for each nucleic acid sample to be detected, if the ratio of the number of the detected target regions to the number of the multiple target regions in any one target gene in the one or more target genes is greater than a preset ratio, determining that the nucleic acid sample to be detected contains the target gene.

2. The method according to claim 1, wherein for each sample of nucleic acids to be tested, if the ratio of the number of the target regions detected in any one of the one or more target genes to the number of the plurality of target regions is not greater than the preset ratio, it is determined that the sample of nucleic acids to be tested does not contain the target gene.

3. The detection method according to claim 1, wherein the first forward primer is the first sequencing primer and the sequence matching the 5 'end of the target region in sequence from the 5' end to the 3 'end, the first reverse primer is the second sequencing primer and the sequence matching the 3' end of the target region in sequence from the 5 'end to the 3' end, the second reverse primer is the first sequencing linker, the first barcode and the second sequencing primer in sequence from the 5 'end to the 3' end, the second forward primer is the second sequencing linker and the first sequencing primer in sequence from the 5 'end to the 3' end, and the third reverse primer is the first sequencing linker.

4. The detection method according to claim 1, wherein the mixed amplification product is used as a specific batch of amplification products, the second forward primer further comprises a second barcode, the sequence of the target library further comprises a sequence of the second barcode, and the specific batch is identified based on the sequence of the second barcode.

5. The detection method according to claim 4, wherein the second forward primer is the second sequencing adaptor, the second barcode and the first sequencing primer in sequence from 5 'end to 3' end.

6. The detection method according to claim 1, wherein the first sequencing primer and the second sequencing primer are sequencing primers of an illumina sequencing platform, the first sequencing linker is a P7 linker of the illumina sequencing platform, and the second sequencing linker is a P5 linker of the illumina sequencing platform.

7. The detection method according to claim 1, wherein 3 target regions are selected from the gene sequence of the target gene, and a primer set is designed for each target region to obtain 3 primer sets.

8. The method according to claim 1, wherein the target regions in the gene sequence of the target gene do not overlap or only partially overlap with each other.

9. The detection method according to claim 1, wherein a detection threshold value of each of the plurality of target regions is obtained based on a positive quality control and a negative quality control of the target gene, and whether each target region is detected is determined based on the detection threshold value.

10. The method according to claim 1, wherein the nucleic acid sample to be tested comprises at least one of a DNA sample and an RNA sample, and further comprising a step of subjecting the nucleic acid sample to reverse transcription after obtaining the nucleic acid sample to be tested if the nucleic acid sample to be tested comprises an RNA sample.

11. The method according to claim 1, wherein the predetermined proportion is 50% to 80%.

12. A primer group for detecting a target gene is a primer group for detecting a nucleic acid sample to be detected, and is characterized in that a plurality of target regions are selected from a gene sequence of the target gene, and the primer group is designed aiming at each target region, the primer groups respectively comprise a first forward primer, a first reverse primer, a second forward primer and a third reverse primer, the first forward primer comprises a first sequencing primer and a sequence matched with the 5 'end of the target region, the first reverse primer comprises a second sequencing primer and a sequence matched with the 3' end of the target region, the second reverse primer comprises a second sequencing primer, a first barcode and a first sequencing joint, the second forward primer comprises a second sequencing joint, a second barcode and the first sequencing primer, the third reverse primer comprises the first sequencing adapter; and performing PCR amplification on the nucleic acid sample to be detected by using the first forward primer, the first reverse primer and the second reverse primer to obtain an amplification product, and performing PCR amplification on the amplification product by using the second forward primer and the third reverse primer.

13. A kit for detecting a target gene, comprising the primer set according to claim 12.

14. The kit of claim 13, further comprising a positive quality control, a negative quality control, and a library preparation comprising a PCR buffer and a DNA polymerase.

15. Use of a primer set for the preparation of a kit for detecting a target gene, wherein the primer set is the primer set according to claim 12.