CN116144736A - Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application - Google Patents
Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application Download PDFInfo
- Publication number
- CN116144736A CN116144736A CN202310210770.8A CN202310210770A CN116144736A CN 116144736 A CN116144736 A CN 116144736A CN 202310210770 A CN202310210770 A CN 202310210770A CN 116144736 A CN116144736 A CN 116144736A
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- thyroid cancer
- library
- sequencing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000007403 mPCR Methods 0.000 title claims abstract description 43
- 208000024770 Thyroid neoplasm Diseases 0.000 title claims abstract description 32
- 201000002510 thyroid cancer Diseases 0.000 title claims abstract description 32
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 28
- 108091093088 Amplicon Proteins 0.000 title claims abstract description 27
- 238000002360 preparation method Methods 0.000 title claims abstract description 19
- 238000012163 sequencing technique Methods 0.000 claims abstract description 66
- 238000000034 method Methods 0.000 claims abstract description 42
- 238000006243 chemical reaction Methods 0.000 claims abstract description 26
- 238000000746 purification Methods 0.000 claims abstract description 19
- 230000004048 modification Effects 0.000 claims abstract description 6
- 238000012986 modification Methods 0.000 claims abstract description 6
- 230000026731 phosphorylation Effects 0.000 claims abstract description 5
- 238000006366 phosphorylation reaction Methods 0.000 claims abstract description 5
- 239000000523 sample Substances 0.000 claims description 32
- 239000012634 fragment Substances 0.000 claims description 30
- 238000011144 upstream manufacturing Methods 0.000 claims description 20
- 230000003321 amplification Effects 0.000 claims description 14
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 14
- 239000002773 nucleotide Substances 0.000 claims description 14
- 125000003729 nucleotide group Chemical group 0.000 claims description 14
- 108020004414 DNA Proteins 0.000 claims description 11
- 239000000203 mixture Substances 0.000 claims description 10
- 101000883798 Homo sapiens Probable ATP-dependent RNA helicase DDX53 Proteins 0.000 claims description 8
- 102100038236 Probable ATP-dependent RNA helicase DDX53 Human genes 0.000 claims description 8
- 101000984753 Homo sapiens Serine/threonine-protein kinase B-raf Proteins 0.000 claims description 7
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 7
- 230000008685 targeting Effects 0.000 claims description 6
- 230000004544 DNA amplification Effects 0.000 claims description 4
- 239000013614 RNA sample Substances 0.000 claims description 2
- 101150047500 TERT gene Proteins 0.000 claims description 2
- 239000008280 blood Substances 0.000 claims description 2
- 210000004369 blood Anatomy 0.000 claims description 2
- 101150048834 braF gene Proteins 0.000 claims description 2
- 210000002381 plasma Anatomy 0.000 claims description 2
- 210000003296 saliva Anatomy 0.000 claims description 2
- 210000001519 tissue Anatomy 0.000 claims description 2
- 238000003908 quality control method Methods 0.000 abstract description 10
- 238000012165 high-throughput sequencing Methods 0.000 abstract description 9
- 238000001514 detection method Methods 0.000 abstract description 8
- 239000011324 bead Substances 0.000 abstract description 6
- 230000008569 process Effects 0.000 abstract description 5
- 239000003153 chemical reaction reagent Substances 0.000 abstract description 4
- 239000000443 aerosol Substances 0.000 abstract description 2
- 230000000694 effects Effects 0.000 abstract description 2
- 238000002474 experimental method Methods 0.000 abstract description 2
- 238000004904 shortening Methods 0.000 abstract description 2
- 239000000047 product Substances 0.000 description 20
- 238000005516 engineering process Methods 0.000 description 9
- 230000035772 mutation Effects 0.000 description 7
- 238000004458 analytical method Methods 0.000 description 6
- 238000012408 PCR amplification Methods 0.000 description 5
- 238000009396 hybridization Methods 0.000 description 5
- 102100027103 Serine/threonine-protein kinase B-raf Human genes 0.000 description 4
- 239000000243 solution Substances 0.000 description 4
- 238000012795 verification Methods 0.000 description 4
- 238000007689 inspection Methods 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 238000012545 processing Methods 0.000 description 3
- 238000010276 construction Methods 0.000 description 2
- 238000012864 cross contamination Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 125000005842 heteroatom Chemical group 0.000 description 2
- 238000007481 next generation sequencing Methods 0.000 description 2
- 239000002096 quantum dot Substances 0.000 description 2
- 238000007480 sanger sequencing Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 1
- 239000003298 DNA probe Substances 0.000 description 1
- 108090000790 Enzymes Proteins 0.000 description 1
- 102000004190 Enzymes Human genes 0.000 description 1
- 108020004518 RNA Probes Proteins 0.000 description 1
- 239000003391 RNA probe Substances 0.000 description 1
- 238000011529 RT qPCR Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 238000011109 contamination Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 238000003745 diagnosis Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000005206 flow analysis Methods 0.000 description 1
- 238000013467 fragmentation Methods 0.000 description 1
- 238000006062 fragmentation reaction Methods 0.000 description 1
- 238000001502 gel electrophoresis Methods 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000002347 injection Methods 0.000 description 1
- 239000007924 injection Substances 0.000 description 1
- 238000012177 large-scale sequencing Methods 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000011403 purification operation Methods 0.000 description 1
- 239000012264 purified product Substances 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 238000007482 whole exome sequencing Methods 0.000 description 1
- 238000012070 whole genome sequencing analysis Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Abstract
The invention relates to the technical field of high-throughput sequencing, in particular to a preparation method of a thyroid cancer related gene high-throughput amplicon library, a multiplex PCR primer pair and application. (1) The invention can finish the preparation of the thyroid cancer related gene library through one-step multiplex PCR and one-step product magnetic bead purification, thereby greatly shortening the operation steps and experimental time of the high-throughput sequencing library. The cost of the experiment can be reduced even more since no more PCR and purification reagents need to be used. The steps of PCR and magnetic bead purification are reduced, and aerosol pollution caused by repeated sample adding and repeated purification of samples in the experimental process is reduced, so that the accuracy of detection results can be improved. (2) The invention contains double-end tag sequences, and can carry out more strict data splitting quality control than a library with only single-end tag sequences, thereby reducing the data pollution of splitting samples and improving the accuracy of data quality control. (3) The library prepared by the invention contains 5' -terminal phosphorylation modification, can be compatible with on-machine sequencing of downstream Illumina and Huada sequencing platforms without library joint conversion reagents, and has more instrument model expansion suitability. In summary, the invention has the effects of simple operation, lower cost, faster time, wider applicable platform, lower library pollution rate and the like.
Description
The invention relates to a method for preparing a high-throughput amplicon library, a multiplex PCR primer pair and application, wherein the application is divided into a master application number 2022115394195 and a theme name is 2022, 12 and 02.
Technical Field
The invention relates to the technical field of high-throughput sequencing, in particular to a preparation method of a thyroid cancer related gene high-throughput amplicon library, a multiplex PCR primer pair and application.
Background
The high-throughput sequencing (Next Generation Sequencing, NGS) technology can simultaneously study more genome regions, and has higher sensitivity and lower cost compared with the traditional technologies of first-generation sequencing, qPCR and the like because the high-throughput, parallel and large-scale sequencing can be performed on samples. The amplicon sequencing (Amplicon Sequencing) method is one of sequencing library preparation, and compared with the conventional hybridization capture library, the method does not need complex processes such as genome fragmentation, end repair, 3' addition of A tail, linker, probe hybridization capture, target region enrichment, product purification and the like. Researchers can obtain a library product of a target region by amplifying only the gene region to be researched in a shorter time at lower cost, and perform rapid high-throughput sequencing.
The principle of hybridization capture library preparation is to artificially design probes (DNA probes or RNA probes) that can be partially or fully complementary to the target segment. Mixing the sample with the probe captures the target segment, the segment not designed with the probe is eluted and discarded, and then the probe and the capture segment are separated by denaturation (typically by adjusting the pH to alkaline), and the captured fragment can be subjected to second generation sequencing library construction. The advantages are that: the capture section is large, can reach hundreds of MB, far super PCR scheme and MIP scheme, and the uniformity is very good according to the principle of the probe, the uniformity is a critical parameter for evaluating the capture technology, and the subsequent sequencing cost can be reduced after the uniformity is good. Disadvantages: non-target fragments are easily captured, resulting in increased costs. Because the pre-hybridization sample is randomly broken, typically 500bp, of a suitable length, the probe may partially hybridize to the target fragment when captured, resulting in capture of some fragments containing a portion of the target segment. Therefore, hybridization capture has poor specificity, and non-target segments are easily captured.
The amplicon targeted sequencing technology, also called multiplex PCR targeted sequencing technology, is a targeted capture sequencing technology combining the multiplex PCR technology with the second generation sequencing technology. The technology firstly utilizes multiple PCR reaction to amplify a plurality of target region sequences simultaneously to obtain an amplicon product, then introduces a connector sequence required by second generation sequencing into two sides of the amplicon product through the PCR reaction or enzyme ligation reaction to obtain an amplicon library, and then carries out second generation sequencing and letter flow analysis to obtain sequence information of a target region so as to realize the purpose of detecting the sequence of the target region. The method is characterized by clear purpose, flexible application, low price, simple analysis, capability of detecting ultra-low frequency mutation which cannot be covered by whole genome and exome sequencing by using ultra-high sequencing depth, and wide application in the fields of large health screening, medical diagnosis, molecular breeding, forensic science and the like.
The common operation flow is: the first step uses 1-100 ng DNA as template, uses multiple PCR to amplify the interested target area and construct amplicon, the second step purifies the product and mixes the product, prepares for joint connection, the third step uses general primer to amplify, the complete sequencing joint band, and then purifies.
When the current amplicon sequencing is used for preparing a library, a target area is usually amplified through a first round of multiplex PCR, after the product is purified, a second round of PCR amplification is carried out by taking the purified product as a template, the sequenced joint and tag sequences are added at two ends of the library sequence, and then the quality inspection can be carried out after the product is purified again, and then the sequencing can be carried out on a machine. The flow has the defects of more experimental steps, longer operation time, easy introduction of sample cross contamination and the like.
In addition, there are amplicon sequencing operations that directly add sequencing adaptors using ligation. The method comprises the steps of amplifying a target region through a first round of multiplex PCR, purifying a product, connecting sequenced connector sequences to two sides of a target fragment through a connection reaction to form a finished library structure, amplifying the library through a round of PCR, adding different tag sequences, and purifying a PCR product. The process also has the problems of multiple PCR and multiple product purification operations, long operation time and the like. The use of such ligation plus sequencing adaptors is often found in targeted sequencing library preparation for hybrid capture. For example, patent document CN111748551B, CN202111152079 discloses a method of adding sequencing adaptors by ligation, which requires fragment screening and PCR amplification and product purification after adaptor ligation, and has many steps and a long time, which is likely to cause more errors.
The above two-step PCR and linker ligation method can add a linker sequence in the second-step PCR or ligation reaction, but requires more experimental steps and operation time in operation, and the possibility of introducing contamination is also increased.
At present, there is also a method for preparing an amplicon sequencing library by one-step PCR, and although the purpose of rapidly preparing the library by one-step PCR can be solved, some problems still exist. For example, the method described in patent document CN201410499918 can only prepare libraries with single-ended tag sequences, which is disadvantageous for the number expansion of sample mixes; the sequencing data of the machine can only be resolved by single ended tag sequences compared to libraries of double ended tag sequences, resulting in higher occurrence of cross contamination between samples. As also described in patent document CN201710218529, the one-step PCR operation is realized by proportionally mixing the primers of the two rounds of PCR, but the operation of preparing a PCR reaction system is more complicated, more components are needed to control the PCR reaction, and the cost is relatively higher.
Therefore, the methods for preparing the libraries still need to be improved in the aspects of reducing the pollution rate of the libraries, simplifying the reaction system, expanding the sequencing platform of the libraries and the like.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a method for rapidly preparing a thyroid cancer related gene amplicon library, which can be expected to prepare a library with double-ended tag sequences through single-step multiplex PCR amplification. The method has the advantages of simple operation, lower cost, faster time, wider applicable platform, lower library pollution rate and the like.
In order to solve the technical problems and achieve the purposes, the invention provides the following technical scheme:
in a first aspect, the present invention provides a method for preparing an amplicon library of thyroid cancer-associated genes, wherein the method comprises amplifying thyroid cancer-associated genes in a sample using a multiplex PCR method, and then purifying the amplified sample in one step to obtain the amplicon library;
the primer pair used for multiplex PCR comprises the following upstream primer and downstream primer:
the nucleotide sequence of the upstream primer is as follows from the 5 'end to the 3' end: 5 '-forward linker sequence-tag sequence 1-forward sequencing primer sequence-specific forward primer sequence-3' for thyroid cancer associated gene amplification;
the nucleotide sequence of the downstream primer is as follows from the 5 'end to the 3' end: 5 '-reverse linker sequence-tag sequence 2-reverse sequencing primer sequence-specific reverse primer sequence-3' for thyroid cancer associated gene amplification;
the tag sequence 1 and the tag sequence 2 are mutually different nucleotide fragments of 6-10 bp.
In alternative embodiments, the forward linker sequence is set forth in SEQ ID No:1 (AATGATACGGCGACCACCGAGATCTACAC); the reverse linker sequence is shown in SEQ ID No:2 (CAAGCAGAAGACGGCATACGAGAT).
In an alternative embodiment, the forward sequencing primer sequence is set forth in SEQ ID No:3 (ACACTCTTTCCCTACACGACGCTCTTCCGATCT); the reverse sequencing primer sequence is shown in SEQ ID No:4 (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT).
In alternative embodiments, the 5' end of the upstream primer and/or the downstream primer has a phosphorylation modification.
In an alternative embodiment, the number of target amplified regions of the same sample is ≡1.
In an alternative embodiment, the number of target amplification regions in the same sample is > 1, and the upstream primer and the downstream primer used for different target amplification regions have the same tag sequence combination.
In alternative embodiments, the upstream primer and the downstream primer used for different samples have different combinations of tag sequences.
In alternative embodiments, the sample comprises a DNA sample or an RNA sample derived from whole blood, plasma, saliva, tissue, formalin-fixed sample, paraffin-embedded sample, or a puncture sample.
In an alternative embodiment, the multiplex PCR reaction procedure comprises, in order:
reacting at 98 ℃ for 5min and circulating for 1 time;
reacting for 10s at 98 ℃, 15s at 60 ℃ and 20s at 72 ℃ and circulating for 30 times;
reacting for 5min at 72 ℃, and circulating for 1 time;
preserving heat at 4 ℃ and circulating for 1 time;
the system of the multiplex PCR reaction comprises a PCR reaction premix, a primer mixture, a DNA template and enzyme-free water.
In a second aspect, the present invention provides a multiplex PCR primer pair for thyroid cancer associated genes, the multiplex PCR primer pair being applied to the preparation method according to any one of the preceding embodiments for preparing a thyroid cancer associated gene amplicon library;
the multiple PCR primer pair targeting genes are BRAF genes and/or TERT genes;
preferably, the multiplex PCR primer pair targeting the BRAF gene comprises a nucleotide sequence shown in SEQ ID No:5 or SEQ ID No:6, and the nucleotide sequence of at least one forward primer is shown as SEQ ID No:7 or SEQ ID No:8, and at least one of the reverse primers shown in FIG. 8.
Preferably, the multiplex PCR primer pair targeting the TERT gene comprises a nucleotide sequence as set forth in SEQ ID No:9 or SEQ ID No:10, and the nucleotide sequence of at least one forward primer is shown as SEQ ID No:11 or SEQ ID No:12, and at least one of the reverse primers shown in FIG. 12.
In a third aspect, the present invention provides the use of a thyroid cancer-associated gene amplicon library obtained by the method of preparation of any one of the preceding embodiments or of a multiplex PCR primer pair of any one of the preceding embodiments for amplification of a thyroid cancer-associated gene for non-diagnostic purposes;
preferably, the amplification for non-diagnostic purposes comprises enrichment or purification of thyroid cancer associated genes.
Compared with the prior art, the invention has the following beneficial effects:
(1) The invention can finish the preparation of the thyroid cancer related gene library through one-step multiplex PCR and one-step product magnetic bead purification, thereby greatly shortening the operation steps and experimental time of the high-throughput sequencing library. The cost of the experiment can be reduced even more since no more PCR and purification reagents need to be used. The steps of PCR and magnetic bead purification are reduced, and aerosol pollution caused by repeated sample adding and repeated purification of samples in the experimental process is reduced, so that the accuracy of detection results can be improved.
(2) The invention contains double-end tag sequences, and can carry out more strict data splitting quality control than a library with only single-end tag sequences, thereby reducing the data pollution of splitting samples and improving the accuracy of data quality control.
(3) The library prepared by the invention contains 5' -terminal phosphorylation modification, can be compatible with on-machine sequencing of downstream Illumina and Huada sequencing platforms without library joint conversion reagents, and has more instrument model expansion suitability.
In summary, the invention has the effects of simple operation, lower cost, faster time, wider applicable platform, lower library pollution rate and the like.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.
FIG. 1 is a schematic diagram of the preparation of a multiplex PCR library according to the one-step method of the present invention;
FIG. 2 is a gel electrophoresis chart of multiplex PCR amplification products in example 1 of the present invention;
FIG. 3 is a fragment distribution diagram of the amplicon library product prepared in example 1 of the present invention;
FIG. 4 shows the IGV results of BRAF c.1799T > A p.V600E site sequencing in example 3 of the present invention;
FIG. 5 shows the IGV results of TERT c.1-124C > T (C228T) site sequencing in example 3 of the invention;
FIG. 6 shows the IGV results of TERT c.1-136C > T (C250T) site sequencing in example 3 of the invention.
Detailed Description
For the purpose of making the objects, technical solutions and advantages of the embodiments of the present invention more apparent, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are some embodiments of the present invention, but not all embodiments of the present invention.
Thus, the following detailed description of the embodiments of the invention, as presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
Some embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following embodiments and features of the embodiments may be combined with each other without conflict.
Example 1: primer group for thyroid cancer related gene detection and library preparation
Provides a primer group for rapidly, accurately and once detecting a plurality of mutation sites of thyroid cancer related genes and a library preparation method. Sequencing library was prepared on FFPE samples from 4 thyroid cancer patients using one-step multiplex PCR, and the specific procedure was as follows:
1. nucleic acid extraction: genomic DNA from FFPE samples was extracted using the FFPE fixed tissue DNA extraction kit (well known as century, CWY 017), specific procedures were described with reference to kit operations, and the purity and concentration of the extracted DNA was measured using NanoDrop and Qubit3.0, and the DNA concentration was diluted to 10ng/ul.
2. Designing and synthesizing a primer: taking the amplification of 2 target areas of thyroid cancer related genes BRAF and TERT as an example, 2 upstream primers and 2 downstream primers are respectively designed. The included thyroid cancer related gene detection sites, primer combinations and sequences are shown in the following table:
wherein the 5' end of the upstream primer is provided with phosphorylation modification, the sequence from the 5' end to the 3' end is sequentially a linker sequence, a tag sequence, a sequencing primer sequence and a specific forward primer sequence amplified by a target fragment, the number of the upstream primers amplified by the same target fragment is 2, and the forward specific primer sequences of the upstream primers are the same, and the difference is that the tag sequences are different. The sequence from the 5 'end to the 3' end of the downstream primer is a linker sequence, a tag sequence, a sequencing primer sequence and a specific reverse primer sequence amplified by the target fragment, 2 downstream primers amplified by the same target fragment are identical in reverse specific primer sequence, and the difference is that the tag sequences are different. The 4 tag sequences in the upstream primer and the downstream primer that constitute the same target fragment amplification are different.
The tag sequences in the forward primers amplified from different target fragments have the same corresponding sequences, e.g., the forward tag sequence of the first upstream primer of the first target fragment is identical to the forward tag sequence of the first upstream primer of the second target fragment. The tag sequences in the reverse primers amplified from different target fragments also have corresponding identical sequences, e.g., the reverse tag sequence of the first downstream primer of the first target fragment is identical to the reverse tag sequence of the first downstream primer of the second target fragment;
depending on the difference in tag sequences between 2 upstream primers and 2 downstream primers for amplification of the target fragment, 4 tag sequence combinations of 2x 2 can be constructed, see table below:
| label combination | Upstream primer F | |
| 1 | |
|
| 2 | |
|
| 3 | |
|
| 4 | |
|
It should be noted that more combinations of tag sequences can be designed according to the difference between the tag sequences of the upstream and downstream primers, including but not limited to the 4 combinations in the present embodiment.
3. Preparing primer mixture of multiplex PCR: the synthesized primers were diluted into 100uM stock solution, and each of the 2 target fragments was divided into 4 groups according to the combinations of the tag sequences based on the above 4 different tag sequence combinations.
Taking the preparation of the 1 st tag combination as an example, 4 primers of 2 target fragments are prepared according to TERT 1F: TERT 1R: BRAF 1F: the BRAF 1R molar ratio is 2:2:1:1, and mixing the components in a proportion of 1. The preparation of the other 3 label combinations is analogized and the proportion is the same. Thus, 4 primer combinations for preparing a multiplex PCR library were obtained.
4. Multiplex PCR amplification by one-step method
4 sample DNAs were subjected to multiplex PCR amplification with the above 4 primer combinations, respectively, to prepare amplicon libraries. Multiplex PCR reaction procedure was performed as follows:
the multiplex PCR reaction system was performed as follows:
| component (A) | Dosage of |
| PCR reaction premix | 10μL |
| Primer mixture | 4.8μL |
| DNA template | 2μL |
| Enzyme-free water | Make up to 20 mu L |
The PCR reaction premix is 2X KAPA2G Fast Multiplex Mix, the primer mixture is a multiplex primer composition required for amplifying different target areas, and the sequencing principle is shown in figure 1.
5. Library purification and quality inspection: the library after completion of PCR was subjected to bead purification by Agencourt AMPure XP Kit (Beckman Coulter, A63880/A63881/A63882) and the procedure was followed according to the kit instructions. The library concentration was determined using Qubit from the purified library. Library fragment quality control was performed using Agilent 2100Bioanalyzer or QSEP 100 equivalents, with a distribution of about 220-350 bp for the main fragments of the library, as shown in FIG. 2, without distinct small and large fragment hetero peaks, as shown in FIG. 3, to obtain a qualified library.
Example 2: sequencing verification with different sequencing platforms
The library obtained in example 1 was subjected to on-machine sequencing operations according to the kit instructions of the Illumina and BGI/MGI sequencing platforms, respectively. After biological information analysis is carried out on the off-machine data, the mutation condition of the detection genes is obtained. The data processing comprises the processes of quality control, sequence comparison (reference genome is NCBI GRCh38/Hg 38), mutation site analysis and the like, mutation information of a detection sample is obtained after the data processing analysis, and the quality control result is shown in the following table:
the quality control data obtained by sequencing on the upper computer shows that the sequencing results Q20 of the Illumina and BGI/MGI sequencing platforms are more than 95%, the Q30 is more than 80%, and the mapped_rate is more than 95%, so that the library prepared by the invention can be compatible with the Illumina and BGI/MGI sequencing platforms, and has more expanding adaptability of sequencing instrument platforms than the existing one-step PCR library.
Example 3: verification by first generation sequencing
Sanger sequencing verification was performed on samples found in example 1 to have mutation sites by high throughput sequencing, and the accuracy of the high throughput sequencing was compared, and the verification results are shown in the following table:
* SUB: replacement; WT: wild type
The IGV results for BRAF c.1799T > ap.V600E site sequencing are shown in FIG. 4, for TERT c.1-124C > T (C228T) site sequencing in FIG. 5, and for TERT c.1-136C > T (C250T) site sequencing in FIG. 6. The comparison result shows that the high-throughput sequencing result using the primer and the detection method of the invention is 100% consistent with Sanger sequencing method.
Example 4: comparison with two rounds of PCR method library construction
A library was prepared by performing 2 rounds of PCR amplification on 4 samples of example 1, briefly as follows:
(1) The first round multiplex PCR reaction procedure was performed as follows:
the multiplex PCR reaction system was performed as follows:
| component (A) | Dosage of- |
| PCR reaction premix | 10μL |
| Primer mixture | 4.8μL |
| DNA template | 2μL |
| Enzyme-free water | Make up to 20 mu L |
(2) And (3) purifying a PCR product: the multiplex PCR products after PCR were subjected to 1 Xbead purification using Agencourt AMPure XP Kit (Beckman Coulter, A63880/A63881/A63882), and the procedure was followed according to the kit instructions, and finally eluted with 12. Mu.L nuclease-free water, and the eluted products were transferred to a new 0.2ml PCR tube for the second round of PCR amplification.
(3) Second round PCR amplification: the reaction procedure was carried out as follows:
the multiplex PCR reaction system was performed as follows:
| component (A) | Dosage of- |
| PCR reaction premix | 25μL |
| Linker P5- |
1 |
| Linker P7- |
1 |
| First round PCR purification of products | 12μL |
| Enzyme-free water | Make up to 50 mu L |
* And (3) injection: different samples used different tag numbers P5 and P7 adaptor primers, primer mixtures were multiplex primer compositions required for amplification of different target regions, the sequences are shown in the following table:
where N represents the base (A, G, C or T) of the tag sequence, different primers of the tag sequence are used for different samples.
(4) Second round PCR product purification: purification of the 0.9 Xmagnetic beads was performed with Agencourt AMPure XP Kit (Beckman Coulter, A63880/A63881/A63882), operating according to the kit instructions, and finally eluting with 30. Mu.L nuclease-free water. The library concentration was determined using Qubit from the purified library. The Agilent 2100Bioanalyzer or QSEP 100 equivalent is used for controlling the quality of library fragments, the main fragments of the library are distributed about 220-350 bp, and no obvious small fragment and large fragment hetero peaks exist, so that the qualified library is obtained.
(5) Sequencing on a machine: the library passed the quality inspection was diluted to an appropriate concentration and subjected to on-machine sequencing with reference to the sequencing protocol.
(6) And (5) letter generation analysis: analyzing and annotating the sequencing result by using biological information software, and obtaining mutation information of the detection sample after data processing analysis. Library sequencing results from two rounds of PCR were compared to library sequencing quality control results from the one-step PCR prepared in example 1, as shown in the following table:
from the quality control data obtained by sequencing, it can be seen that Q20 and Q30 are substantially identical in the amplicon library sequencing results of the one-step PCR and the two-step PCR of the present invention, but the mapped_rate of the present invention is generally higher than the sequencing results of the two-step PCR. The library prepared by the invention can reach the sequencing result of the two-step PCR, is superior to the data of the two-step PCR in the effective data comparison rate, and has higher anti-pollution control capability.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.
Claims (10)
1. The preparation method of the thyroid cancer related gene amplicon library is characterized in that a multiplex PCR method is used for amplifying the thyroid cancer related genes in a sample, and then the amplicon library is obtained by only one-step purification;
the primer pair used for multiplex PCR comprises the following upstream primer and downstream primer:
the nucleotide sequence of the upstream primer is as follows from the 5 'end to the 3' end: 5 '-forward linker sequence-tag sequence 1-forward sequencing primer sequence-specific forward primer sequence-3' for thyroid cancer associated gene amplification;
the nucleotide sequence of the downstream primer is as follows from the 5 'end to the 3' end: 5 '-reverse linker sequence-tag sequence 2-reverse sequencing primer sequence-specific reverse primer sequence-3' for thyroid cancer associated gene amplification;
the tag sequence 1 and the tag sequence 2 are mutually different nucleotide fragments of 6-10 bp.
2. The method of claim 1, wherein the forward linker sequence is set forth in SEQ ID No:1 is shown in the specification; the reverse linker sequence is shown in SEQ ID No: 2.
3. The method of claim 1, wherein the forward sequencing primer sequence is set forth in SEQ ID No:3 is shown in the figure; the reverse sequencing primer sequence is shown in SEQ ID No: 4.
4. A method according to any one of claims 1 to 3, wherein the 5' end of the upstream primer and/or the downstream primer has a phosphorylation modification.
5. The method according to claim 4, wherein the number of thyroid cancer-associated genes in the same sample is 1 or more;
preferably, the number of thyroid cancer associated genes in the same sample is > 1, and the upstream primer and the downstream primer used for different thyroid cancer associated genes have the same tag sequence combination.
6. The method of claim 4, wherein the upstream primer and the downstream primer used in different samples have different combinations of tag sequences.
7. The method of claim 1, wherein the sample comprises a DNA sample or an RNA sample derived from whole blood, plasma, saliva, tissue, formalin-fixed sample, paraffin-embedded sample, or a puncture sample.
8. The method of claim 1, wherein the multiplex PCR reaction procedure comprises, in order:
reacting at 98 ℃ for 5min and circulating for 1 time;
reacting for 10s at 98 ℃, 15s at 60 ℃ and 20s at 72 ℃ and circulating for 30 times;
reacting for 5min at 72 ℃, and circulating for 1 time;
preserving heat at 4 ℃ and circulating for 1 time;
the system of the multiplex PCR reaction comprises a PCR reaction premix, a primer mixture, a DNA template and enzyme-free water.
9. A multiplex PCR primer pair for thyroid cancer-associated genes, wherein the multiplex PCR primer pair is applied to the preparation method according to any one of claims 1 to 8, for preparing a thyroid cancer-associated gene amplicon library;
the multiple PCR primer pair targeting genes are BRAF genes and/or TERT genes;
preferably, the multiplex PCR primer pair targeting the BRAF gene comprises a nucleotide sequence shown in SEQ ID No:5 or SEQ ID No:6, and the nucleotide sequence of at least one forward primer is shown as SEQ ID No:7 or SEQ ID No:8, at least one of the reverse primers shown in FIG. 8;
preferably, the multiplex PCR primer pair targeting the TERT gene comprises a nucleotide sequence as set forth in SEQ ID No:9 or SEQ ID No:10, and the nucleotide sequence of at least one forward primer is shown as SEQ ID No:11 or SEQ ID No:12, and at least one of the reverse primers shown in FIG. 12.
10. Use of an amplicon library obtained by the preparation method according to any one of claims 1 to 8 or of the multiplex PCR primer pair according to claim 9 for the amplification of thyroid cancer associated genes for non-diagnostic purposes;
preferably, the amplification for non-diagnostic purposes comprises enrichment or purification of thyroid cancer associated genes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310210770.8A CN116144736A (en) | 2022-12-02 | 2022-12-02 | Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202310210770.8A CN116144736A (en) | 2022-12-02 | 2022-12-02 | Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202211539419.5A CN116121338A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library, multiplex PCR primer pair and application |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211539419.5A Division CN116121338A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library, multiplex PCR primer pair and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116144736A true CN116144736A (en) | 2023-05-23 |
Family
ID=86097366
Family Applications (8)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241214.7A Pending CN116121342A (en) | 2022-12-02 | 2022-12-02 | Preparation method of microsatellite instability related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202211539419.5A Pending CN116121338A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310228914.2A Pending CN116218954A (en) | 2022-12-02 | 2022-12-02 | Preparation method of breast cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310228905.3A Pending CN116445581A (en) | 2022-12-02 | 2022-12-02 | Preparation method of oligodendroglioma related gene high-throughput amplicon library, multiple PCR primer pair and application |
| CN202310229131.6A Pending CN116287119A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library of chemotherapeutic drug related genes, multiplex PCR primer pair and application |
| CN202310210770.8A Pending CN116144736A (en) | 2022-12-02 | 2022-12-02 | Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310210609.0A Pending CN116024308A (en) | 2022-12-02 | 2022-12-02 | Preparation method of lung cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310234321.7A Pending CN116162686A (en) | 2022-12-02 | 2022-12-02 | Preparation method of intestinal cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
Family Applications Before (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310241214.7A Pending CN116121342A (en) | 2022-12-02 | 2022-12-02 | Preparation method of microsatellite instability related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202211539419.5A Pending CN116121338A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310228914.2A Pending CN116218954A (en) | 2022-12-02 | 2022-12-02 | Preparation method of breast cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310228905.3A Pending CN116445581A (en) | 2022-12-02 | 2022-12-02 | Preparation method of oligodendroglioma related gene high-throughput amplicon library, multiple PCR primer pair and application |
| CN202310229131.6A Pending CN116287119A (en) | 2022-12-02 | 2022-12-02 | Preparation method of high-throughput amplicon library of chemotherapeutic drug related genes, multiplex PCR primer pair and application |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202310210609.0A Pending CN116024308A (en) | 2022-12-02 | 2022-12-02 | Preparation method of lung cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
| CN202310234321.7A Pending CN116162686A (en) | 2022-12-02 | 2022-12-02 | Preparation method of intestinal cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (8) | CN116121342A (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117558380B (en) * | 2024-01-10 | 2024-04-09 | 中国科学院深圳先进技术研究院 | High-flux preparation method and system of magnetic micro-nano material based on artificial intelligence algorithm |
| CN117844933A (en) * | 2024-03-07 | 2024-04-09 | 上海复迪生生命科学有限公司 | Multiplex PCR primer group for detecting lung tumor related gene variation and application thereof |
-
2022
- 2022-12-02 CN CN202310241214.7A patent/CN116121342A/en active Pending
- 2022-12-02 CN CN202211539419.5A patent/CN116121338A/en active Pending
- 2022-12-02 CN CN202310228914.2A patent/CN116218954A/en active Pending
- 2022-12-02 CN CN202310228905.3A patent/CN116445581A/en active Pending
- 2022-12-02 CN CN202310229131.6A patent/CN116287119A/en active Pending
- 2022-12-02 CN CN202310210770.8A patent/CN116144736A/en active Pending
- 2022-12-02 CN CN202310210609.0A patent/CN116024308A/en active Pending
- 2022-12-02 CN CN202310234321.7A patent/CN116162686A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| CN116121342A (en) | 2023-05-16 |
| CN116287119A (en) | 2023-06-23 |
| CN116162686A (en) | 2023-05-26 |
| CN116445581A (en) | 2023-07-18 |
| CN116024308A (en) | 2023-04-28 |
| CN116218954A (en) | 2023-06-06 |
| CN116121338A (en) | 2023-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106555226B (en) | A kind of method and kit constructing high-throughput sequencing library | |
| CN116144736A (en) | Preparation method of thyroid cancer related gene high-throughput amplicon library, multiplex PCR primer pair and application | |
| US20150284769A1 (en) | Reduced representation bisulfite sequencing with diversity adaptors | |
| CN106554957B (en) | Sequencing library, preparation and application thereof | |
| CN109234356B (en) | Method for constructing hybridization capture sequencing library and application | |
| CN112176419B (en) | Method for detecting variation and methylation of tumor specific genes in ctDNA | |
| CN111471754B (en) | Universal high-throughput sequencing joint and application thereof | |
| JP2020536525A (en) | A method for concentrating the probe and the target region to which it is applied for high-throughput sequencing | |
| CN110603327A (en) | PCR primer pair and application thereof | |
| CN106554955A (en) | Build method and kit of the sequencing library of PKHD1 gene mutations and application thereof | |
| CN113502287A (en) | Molecular tag joint and construction method of sequencing library | |
| CN110669823A (en) | ctDNA library construction and sequencing data analysis method for simultaneously detecting multiple liver cancer common mutations | |
| CN109295500B (en) | Single cell methylation sequencing technology and application thereof | |
| CN112941147A (en) | High-fidelity target gene library building method and kit thereof | |
| CN113811618A (en) | Sequencing library constructed based on methylated DNA target region, system and application | |
| CN113913493B (en) | Rapid enrichment method of target gene region | |
| CN108753935A (en) | A kind of method that primer dimer expands in reduction multiplex polymerase chain re-action | |
| CN116065240A (en) | Method and kit for constructing RNA sequencing library in high throughput | |
| CN114774553A (en) | Method for detecting multigene site mutation by using high-throughput sequencing technology | |
| EP3845667A1 (en) | Method of amplifying and determining target nucleotide sequence | |
| CN114277114A (en) | Method for adding unique identifier in amplicon sequencing and application | |
| KR20220164753A (en) | floating barcode | |
| CN112063690A (en) | Construction method and application of single-molecule probe multi-target capture library | |
| CN114807324A (en) | Application of single primer amplification library construction technology in detecting fragment rare DNA molecular mutation and kit | |
| CN112458085A (en) | Novel molecular capture optimization probe and library construction method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |