CN106350522A - Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof - Google Patents
Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof Download PDFInfo
- Publication number
- CN106350522A CN106350522A CN201610945970.8A CN201610945970A CN106350522A CN 106350522 A CN106350522 A CN 106350522A CN 201610945970 A CN201610945970 A CN 201610945970A CN 106350522 A CN106350522 A CN 106350522A
- Authority
- CN
- China
- Prior art keywords
- buffer
- protein
- lane
- bacterium
- flow velocity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43531—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from mites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/43504—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
- G01N2333/43552—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from insects
- G01N2333/43582—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from insects from mites
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a gene cloning and expression purification method for recently found allergen Try p28, Try p35 and Try p36 of tyrophagus putrescentiae and an application thereof. According to the invention, a specific primer and a specific purification method are adopted for preparing recombinant protein. The purified product prepared according to the method disclosed by the invention is high in purity, is high in positive rate, can be used as a reagent for clinical diagnosis and has wide application prospects.
Description
Technical field
The invention belongs to biology field and in particular to tyrophagus putrescentiae new anaphylactogen tyr p 28, tyr p 35,
The Prokaryotic expression, purification of tyr p 36 and its application.
Background technology
Acarid problem is increasingly severe, causes the highest attention of people！Expert points out: in the world in every five people just extremely
A rare people occurs allergy.And dust mite is anaphylactic arch-criminal.Do not look down upon these heights and only have 0.2 0.4mm
Little insect, the disease that they can cause can be definitely many.Even acarid allergic asthma can be caused, directly threaten life
Life.
Shown according to research, the risk that Allergic Rhinitis and non-allergic rhinitis patient obtain asthma is normal respectively
3.5 times of people and 2.7 times.Allergy is a key factor causing childhood asthma, child's isolated from allergic asthmatic patients mesh of China
Before have more than 800 ten thousand, central have 80% all to be caused by dust mite.
Tyrophagus putrescentiae is a kind of important allergenic source demodicid mite kind.Skin is carried out to 100 Britain's Bronchial Asthmas
Find fault test, have 34% tyrophagus putrescentiae is positive；Carry out skin to 72 London bronchial asthma/patients with rhinitis to choose
Thorn test, 51% is positive to tyrophagus putrescentiae；50% Southeast Asia Bronchial Asthmas are positive to tyrophagus putrescentiae
Reaction (arlian lg, geis dp, vyszenski-moher dl, bernstein il, gallagher js.cross
antigenic and allergeic properties of the house dust mite dermatophagoides
farinae and the storage mite tyrophagus putrescentiae.j allergy clin
immunol.1984,74:172-179.).But clinical diagnosises rely on the tyrophagus putrescentiae of import slightly to carry immersion mixture and diagnosed
Quick property Disease, wherein contains anaphylactogen, non-anaphylactogen, even proteins toxic, and disease because may only with slightly propose immersion
In certain or some allergens relevant, this means that this slightly puies forward immersion poor specificity.Obtained using technique for gene engineering
Quick former one-component, its composition is single, and purity is high, specificity is good, can improve the accuracy of diagnosis.Therefore, how to provide one
Plant tyrophagus putrescentiae allergen gene clone, expression, the method for purification, improve the purity of product, improving positive rate is this area skill
Art personnel technical problem urgently to be resolved hurrily.
Content of the invention
For deficiency of the prior art, the present invention has made intensive studies, there is provided a kind of tyrophagus putrescentiae is newly sent out
Existing allergen gene clonal expression purification process.
One aspect of the present invention is related to a kind of tyrophagus putrescentiae new discovery allergen gene clonal expression purification process, it include as
Lower step:
1 genes of interest obtains
1.1 design of primers and synthesis
With tyrophagus putrescentiae total rna as template, rt-pcr amplification kx060612 sequence cds area 1461bp is cloned into
Pet28a (+) carrier；
1.2 reverse transcriptions and pcr amplification, and use takara minibest agarose gel dna extraction
Kit ver.4.0 (code no.9762) cuts glue reclaim purpose product, is named as ctg0124-pcr；
2 clones
Design of primers and synthesis:
| Title | Sequence (5 ' -3 ') | Length (mers) |
| ctg0124p1 | cactgatgctcgcctggaag | 20 |
UseHd cloning kit (clontech code no.639633), by ctg0124-pcr and
Vector dna2 connects；To e.coli competent cells jm109 (code no.9052), coating is flat for thermal transition
Plate, 37 DEG C of incubated overnight.Select positive bacterium colony using t7/t7 terminator primer and plant bacterium, extract positive colony plasmid
ctg0124-1；
Plasmid ctg0124-1 is proceeded in bl21 (de3) t1r competent cell, positive colony is carried out abduction delivering and
Culture；
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, are named as exp0212-2,
Add iptg to be induced, 37 DEG C of cultures, before collection bacterium, absorbance is 2.65；Carry out ultrasonic disruption after collection bacterium, thalline is broken
Broken liquid is centrifuged；
Protected using exp0212-2 glycerol stock and carry out 500ml culture, to carry out destination protein purification from thalline: using ge
Hitrap talon crude, 5ml talon superflow (code no.28-9537-66) column chromatography and；Using 10 times of posts
The buffer a 50ml balance resin of the sterilizing milliq h2o 50ml of volume and 10 times of column volumes, flow velocity 1ml/min；On
Sample: loading after buffer a equilibrating, flow velocity is 0.5ml/min；After protein adsorption, using the buffer a of 10 times of volumes
50ml cleans resin, flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml；Albumen dissolution elution:buffer a
50ml, buffer b 50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes；
Collect destination protein fraction no.46～90, carry out quantitative analyses using nanodrop-100, obtain purification
Recombiant protein, purity of protein is 99%.
The invention still further relates to the restructuring obtained by above-mentioned tyrophagus putrescentiae new discovery allergen gene clonal expression purification process
Albumen.
The invention still further relates to application in preparing diagnostic reagent for the above-mentioned recombiant protein is it is preferred that described diagnostic reagent
For tyrophagus putrescentiae anaphylactogen clinical diagnosises.
This application discloses a kind of tyrophagus putrescentiae new discovery allergen gene clonal expression purification process, the method for the present invention
Purified product purity obtained by specific primer and specific purification process is high, and positive rate is high, can try as clinical diagnosises
Agent uses, and is with a wide range of applications.
Brief description
Agarose gel electrophoresiies after Fig. 1 tyrophagus putrescentiae transcript profile sequence cl2629.contig1_rna_1a full-length gene pcr
Figure.lane m,dl2,000 dna marker；Lane 1, pcr product.
Fig. 2 exp0212-2 expresses sds-page image.
The pvdf image of Fig. 3 exp0212-2.
lane m1,precision plus protein；Lane 1, pet28a (+) full cell；lane 2,pet28a
(+) supernatant；Lane 3, pet28a (+) precipitation；The full cell of lane 4, exp0212-2；Lane 5, exp0212-2 supernatant；lane
6, exp0212-2 precipitations.
The sds-page image of Fig. 4 500mlexp0230 expression.
Fig. 5: lane m, protein mw marker (broad)；Lane 1, exp0230 s5 1 μ l loading；lane 2,
Exp0230 s5 2 μ l loading；Lane 3, exp0230 s5 4 μ l loading；lane 4,bsa 200ng；lane 5,bsa
400ng；lane 6,bsa 600ng；lane 7,bsa 800ng；lane 8,bsa 1000ng.
Fig. 6: western blotting testing result.
Agarose gel electrophoresiies after Fig. 7-tyrophagus putrescentiae transcript profile sequence unigene7127_rna_1a full-length gene pcr
Figure.lane m,dl2,000 dna marker；Lane 1, pcr product.
Fig. 8-exp0207-2 expression sds-page image (15%polyacrylamide gel)
lane m,protein mw marker(broad)；Lane 1, pet28a (+) full cell；lane 2,pet28a
(+) supernatant；Lane 3, pet28a (+) precipitation；The full cell of lane 4, exp0207-2；Lane 5, exp0207-2 supernatant；lane
6, exp0207-2 precipitations.
The pvdf image of Fig. 9-exp0207-2
lane m1,precision plus protein standards；lane m2,perfect protein
marker；Lane 1, pet28a (+) full cell；Lane 2, pet28a (+) supernatant；Lane 3, pet28a (+) precipitation；lane
4, exp0207-2 full cells；Lane 5, exp0207-2 supernatant；Lane 6, exp0207-2 precipitate.
The sds-page image of Figure 10-500ml exp0228 expression
lane m,protein mw marker(broad)；Lane 1, pet28a (+) full cell；lane 2,pet28a
(+) supernatant；Lane 3, pet28a (+) precipitation；The full cell of lane 4, exp0228；Lane 5, exp0228 supernatant；lane 6,
Exp0228 precipitates；lane 7,bsa 200ng；lane 8,bsa 500ng；Lane 9, bsa 1000ng；Lane 10, bsa
1500ng；Lane 11, bsa 2000ng.
Figure 11: lane m, protein mw marker (broad)；Lane 1, exp0228 s5 1l loading；lane 2,
Exp0228 s5 2l loading；Lane 3, exp0228 s5 4l loading；lane 4,bsa 200ng；lane 5,bsa 400ng；
lane 6,bsa 600ng；lane 7,bsa 800ng；lane 8,bsa 1000ng.
Figure 12 western blotting testing result.
Figure 13 tyrophagus putrescentiae total rna agarose gel electrophoresis figure.Lane m, marker；Lane 1, tyrophagus putrescentiae
total rna.
Agarose gel electricity after Figure 14 tyrophagus putrescentiae transcript profile sequence cl2396.contig1_rna_1a full-length gene pcr
Swimming figure.lane m,dl2,000 dna marker；Lane 1, pcr product.
The sds-page image of Figure 15-exp0212-1 expression: lane m, protein mw marker (broad)；lane
1, pet28a (+) full cell；Lane 2, pet28a (+) supernatant；Lane 2, pet28a (+) precipitation；Lane 4, exp0212-1
Full cell；Lane 5, exp0212-1 supernatant；Lane 6, exp0212-1 precipitate.
Figure 16 exp0212-1 pvdf film image: lane m1, precison plus protein standards；
Lane 1, pet-28a (+) full cell；Lane 2, pet-28a (+) supernatant；Lane 3, pet-28a (+) precipitation；Lane 4,
The full cell of exp0212-1；Lane 5, exp0212-1 supernatant；Lane 6, exp0212-1 precipitate；Lane m2, perfect
protein marker.
Figure 17 exp0231 500ml expresses sds-page image: lane m, protein mw marker (broad)；
Lane 1, pet28a (+) full cell；Lane 2, pet28a (+) supernatant；Lane 3, pet28a (+) precipitation；Lane 4,
The full cell of exp0231；Lane 5, exp0231 supernatant；Lane 6, exp0231 precipitate；Lane 7, bsa 200ng；Lane 8,
bsa 500ng；Lane 9, bsa 1000ng；Lane 10, bsa 1500ng；Lane 11, bsa 2000ng.
The sds-page electrophoretogram of sample exp0231-s5 after Figure 18 dialysis: lane m, protein mw marker
(broad)；Lane 1,1l loading exp0231 s5；Lane 2,2l loading exp0231 s5；Lane 3,4l loading exp0231
s5；Lane 4, bsa 200ng；Lane 5, bsa 400ng；Lane 6, bsa 600ng；Lane 7, bsa 800ng；lane
8, bsa 1000ng.
Figure 19 exp0231-s5 recombiant protein western blotting testing result: 1-17 is positive serum, positive rate
For 47% (8/17).
Specific embodiment
With reference to embodiment, the present invention is described further, described below, is only the preferable enforcement to the present invention
Example, not does the restriction of other forms, any those skilled in the art are possibly also with the disclosure above to the present invention
Technology contents be changed to the Equivalent embodiments that change on an equal basis.Every without departing from the present invention program content, according to the present invention
Technical spirit following examples are made any simple modification or equivalent variations, all within the scope of the present invention.
Embodiment 1: tyrophagus putrescentiae anaphylactogen try p 35 gene cloning and expression purification and its application
Full-length gene amplification, clone and prokaryotic expression plasmid build
1 genes of interest obtains
1.1 design of primers and synthesis
With tyrophagus putrescentiae total rna as template, rt-pcr amplification kx060612 sequence cds area 1461bp is cloned into
Pet28a (+) carrier.
1.2 reverse transcription
Using 3 '-full race core set with primescripttmRtase (code no.6106) synthesizes
Cdna, set up simultaneously m-mlv (-) comparison.Reaction system: 1 μ g total rna, 1 μ l random 6 (20 μm), 1 μ l dntp
Mixture (10mm each), plus dh2o rnase free to 5 μ l.Reaction condition: 70 DEG C, 10min, put on ice immediately after
Put 2min.Be subsequently adding following component: 2 μ l 5 × m-mlv buffer, 0.25 μ l rnase inhibitor (40u/ μ l),
0.25μl reverse transcriptase m-mlv(rnase h-) (200u/ μ l), total reaction volume 10 μ l.Reaction bar
Part: 30 DEG C, 10min → 42 DEG C, 60min → 70 DEG C, 15min.
1.3 pcr amplifications
Carry out pcr amplification using takara tks gflex dna polymerase (code no.r060a).Reactant
System: 2 μ l inverse transcription reaction liquids, 25 μ l 2 × gflex pcr buffer (mg2+, dntp plus), 1 μ l tks gflex dna
polymerase(1.25units/μl)、1μl ctg0124 f primer(10μm)、1μl ctg0124 r primer(10μ
M), 20 μ l dh2o, total reaction volume 50 μ l.Reaction condition: 94 DEG C of denaturations 1min, then put 98 DEG C of 10sec, 55 DEG C
15sec, 68 DEG C of 2min react 30 circulations.5 μ l are taken to carry out 3% agarose gel electrophoresiies, result is shown in Fig. 1.
1.4 pcr product purifications
Using takara minibest agarose gel dna extraction kit ver.4.0 (code
No.9762) cut glue reclaim purpose product, be named as ctg0124-pcr.
2 cloning and sequencings
Design of primers and synthesis:
| Title | Sequence (5 ' -3 ') | Length (mers) |
| ctg0124p1 | cactgatgctcgcctggaag | 20 |
UseHd cloning kit (clontech code no.639633), by ctg0124-pcr and
Vector dna2 (ctg0009 project system is standby) connects；Thermal transition is to e.coli competent cells jm109 (code
No.9052 in), spread plate, 37 DEG C of incubated overnight.Select positive bacterium colony using t7/t7 terminator primer and plant bacterium, carry
Take positive colony plasmid ctg0124-1,2.Surveyed using the above-mentioned plasmid of t7, t7 terminator, ctg0124 p1 primer pair
Sequence.Obtain plasmid ctg0124-1.
2. destination protein expression and western blotting identification
Plasmid ctg0124-1 is proceeded in bl21 (de3) t1r competent cell, abduction delivering is carried out to positive colony.
2.1 conversion
Take in 1 μ l plasmid ctg0124-1 conversion competent cell bl21 (de3) t1r, using lb/ antibiotic amp
(100 μ g/ml) flat board, 35 μ l conversional solution coatings, 37 DEG C of o/n cultures, control pet28a (+) equally operated.
2.2 cultures and induction
2.2.1 plant culture
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, are named as respectively
exp0212-2.
2.2.2 main culture induction
Add in glass tube in 5ml lb/amp (100 μ g/ml) culture medium respectively, add kind of culture bacterium solution 100 μ
l.Cultivate for 37 DEG C and be about 0.6 to od600nm value, add 100mm iptg 50 μ l (final 1mm iptg) and induced, 37 DEG C
Culture 4h.Before induction, absorbance is 0.60, and before collection bacterium, absorbance is 2.65.
2.2.3 protein extracting
After collection bacterium, the suitable thalline of 2.0od carries out ultrasonic disruption after adding 320 μ l pbs suspended, and bacterial cell disruption liquid is entered
Row centrifugation (12000 × rpm, 5min).
2.2.4 extract electrophoresis
Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5 × sds loading
Buffer, 95 DEG C of heating 10min, carry out sds-page electrophoresis.Deposition condition: 25ma/ piece, about 80min, using 12.5%
Polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes, and is decoloured using destaining solution.Sds-page/cbb dyeing knot
Fruit sees Fig. 2.
lane m,protein mw marker(broad)；Lane 1, pet28a (+) full cell；lane 2,pet28a
(+) supernatant；Lane 3, pet28a (+) precipitation；The full cell of lane 4, exp0212-2；Lane 5, exp0212-2 supernatant；lane
6, exp0212-2 precipitations.
2.3 western blotting
Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5 × sds loading
Buffer, 95 DEG C of heating 10min, using colored marker and histidine-tagged marker, carry out sds-page electrophoresis, electrophoresis strip
Part: 25ma/ piece, 80min, using 12.5%polyacrylamide gel.After electrophoresis terminates, pvdf film, filter paper are cut respectively
It is cut into and gel formed objects, after being processed using transferring film buffer, be successively placed on by the order of filter paper, pvdf film, gel, filter paper
Between transferring film instrument battery lead plate, start transferring film, setting transferring film instrument parameter is as follows: electric current 50ma, transfer time 80min.By pvdf film
It is placed in the 10ml blocking buffer containing 1.5%bsa, 4 DEG C keep flat and overnight close.Using the pena-his after dilution
Antibody solution 5ml, carries out an antibody response 1h.Tbst buffer (20ml) washs 2 times, washs tbs wash buffer 3
Secondary.Using the hrp-rabbit anti-mouse igg antibody-solutions 5ml after dilution, carry out secondary antibodies reaction 1h.Tbst delays
Rush liquid (20ml) to wash 2 times；Washing tbs wash buffer 3 times.1ml trueblue peroxidase substrate develops the color
1min.After colour developing, pvdf film is shown in Fig. 3.Plasmid exp0212-2 (ctg0124-1) is part solubility expression as seen from the figure.
3. destination protein purification and identification
Protected using exp0212-2 glycerol stock and carry out 500ml culture, to carry out destination protein purification from thalline.
3.1 500ml cultures
3.1.1 plant culture
Exp0212-2 sample glycerol stock is taken to guarantee the quality in grain 50 μ l implantation 10ml lb/kana (50 μ g/ml) culture medium, 37 DEG C
O/n cultivates.
3.1.2 main culture and induction
By in 10ml kind culture bacterium solution implantation 500ml lb/2l flask, 37 DEG C, 200rpm cultivates to od600 about 0.6
When, add 100mm iptg 500 μ l (final 0.1mm iptg) and induced, 16 DEG C are continued culture 24h.It is centrifuged after culture,
Collects thalline.It is centrifuged using after pbs cleaning thalline, weigh thalline weight in wet base.Before induction, absorbance is for absorbance before 0.60, collection bacterium
For 3.75, thalline weight in wet base is 1.72g.
3.1.3 sds-page
Take the suitable thalline of 2.0od to carry out ultrasonic disruption after adding 320 μ l pbs suspended, bacterial cell disruption liquid is carried out from
The heart separates (12000 × rpm, 5min).Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5
× sds loading buffer, 95 DEG C of heating 10min, carry out sds-page electrophoresis.Deposition condition: 25ma/ piece, about 80min.
Using 12.5%polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes, and is decoloured using destaining solution.sds-page/
Cbb coloration result is shown in Fig. 4.Sds-page results expression 500ml culture thalline has expression, predominantly solubility expression.
lane m,protein mw marker(broad)；Lane 1, pet28a (+) full cell；lane 2,pet28a
(+) supernatant；Lane 3, pet28a (+) precipitation；The full cell of lane 4, exp0230；Lane 5, exp0230 supernatant；lane 6,
Exp0230 precipitates；lane 7,bsa 200ng；lane 8,bsa 500ng；Lane 9, bsa 1000ng；Lane 10, bsa
1500ng；Lane 11, bsa 2000ng.
3.2 recombinant protein purification
3.2.1 buffer
Sonication buffer/wash buffer/buffer a, ph8.0 (4 DEG C), by 50mm sodium
Phosphate (ph 8.0), 300mm nacl, 5mm imidazole composition；Buffer b, ph8.0 (4 DEG C), by 50mm
Sodium phosphate (ph 8.0), 300mm nacl, 300mm imidazole composition.Dialysis buffer is takara
pbs(code no.t900).
3.2.2 bacterial cell disruption
After culture, thalline weight in wet base is 1.72g, adds sonication buffer (10 times of thalline weight in wet base) 20ml；4 DEG C are filled
Divide suspended, sonication 180w, 10min, collect broken liquid 20ml (s1)；By s1 put 12000rpm, 4 DEG C centrifugation 30min,
Obtain supernatant 20ml (s2), precipitate 0.2g；S2 is taken to use 0.45 μm, 1000ml vacuum filter/storage bottle
System is filtered, and obtains sample 20ml (s3).
3.2.3 column chromatography purification
Using ge hitrap talon crude, 5ml talon superflow (code no.28-9537-66) post layer
Analysis and；Sterilizing milliq h using 10 times of column volumes2The buffer a 50ml balance resin of o 50ml and 10 times of column volumes,
Flow velocity 1ml/min.Loading: loading after buffer a equilibrating, flow velocity is 0.5ml/min.After protein adsorption, using 10 times of volumes
Buffer a 50ml cleaning resin, flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml.Albumen dissolution elution:
Buffer a 50ml, buffer b 50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes.
3.2.4 each stage sds-page electrophoresis and akta go out peak figure
Each purification each stage carries out sds-page electrophoresis, takes full cell (w), supernatant (s), infusible precipitate (p) each
0.05od600 electrophoresis, takes each 1 μ l electrophoresis of s1, s2, s3, pa stock solution, takes each 2.5 μ l electrophoresis of w1, w2, w3 stock solution, takes elution
The each 5 μ l electrophoresis of stock solution；Take bsa standard substance 500ng loading.Protein marker:broad weight marker (takara
Code:3452q), 5 μ l/well.Running gel is that 12.5%sds-page/ coomassie brilliant blue staining liquid contaminates.
3.2.5 collecting
Collect destination protein fraction no.46～90 about 48ml [s4] altogether.Take and carry out sds-page electrophoresis simultaneously in a small amount
With bsa standard concentration as reference.Using the dyeing of 12.5%sds-page/ coomassie brilliant blue staining liquid.
3.2.6 dialysis
Carry out buffer dialysis using pbs, be repeated 3 times, after dialysis, sample is [s5].Dialysis buffer is pbs, puts
Rate of changing is 1:1000, dialyzer: snakeskin dialysis tubing 3500 mwco (cat no.68035, lot
No.mh 160055), using the dyeing of 12.5%sds-page/ coomassie brilliant blue staining liquid, after taking dialysis, sample carries out sds-
Page electrophoresis, result is as shown in Figure 5.
Carry out quantitative analyses using nanodrop-100, obtain purification of recombinant proteins 50ml, concentration is 1.30mg/ml, altogether
65mg, purity of protein is 99%.
4.western blotting detects
Take recombiant protein 8 μ l (0.05od is suitable), add 2 μ l 5 × sds loading buffer, 95 DEG C of heating
10min, carries out sds-page electrophoresis.Deposition condition: 25ma/ piece, 70min.Using 12.5%polyacrylamide gel, electricity
After swimming terminates, cbb-250 dyes, and is decoloured using destaining solution.Pvdf film, filter paper are cut into and gel formed objects respectively, makes
After being processed with transferring film buffer, it is successively placed between transferring film instrument battery lead plate by the order of filter paper, pvdf film, gel, filter paper, 2
Film starts simultaneously at transferring film, and setting transferring film instrument parameter is as follows: electric current 52ma, transfer time 80min.Pvdf film is placed in containing 1.5%
In the 12ml blocking buffer of bsa, 37 DEG C keep flat 1h closing.Using the serum solution 10ml after 1:10 dilution, carry out
Antibody response 1h.Tbst buffer (25ml) washs 1 time；Washing tbs wash buffer 2 times.After 1:2500 dilution
Goat anti-human ige (hrp) antibody-solutions 9ml carry out secondary antibodies reaction 1h.Tbst buffer (25ml) washing 1
Secondary；Washing tbs wash buffer 2 times.1ml trueblue peroxidase substrate colour developing 1min.Pvdf after colour developing
Film is as shown in fig. 6, result shows that the recombiant protein of the present invention has higher positive rate.
Embodiment 2: tyrophagus putrescentiae anaphylactogen try p 36 gene cloning and expression purification and wb checking
1. full-length gene amplification, clone and prokaryotic expression plasmid build
With tyrophagus putrescentiae total rna as template, rt-pcr expands genbank no.kx060615 sequence cds area 396bp
Be cloned into pet28a (+) carrier.
1.1 genes of interest obtain
1.1.1 design of primers and synthesis
1.1.2 reverse transcription
Using 3 '-full race core set with primescripttmRtase (code no.6106) synthesizes
Cdna, set up simultaneously m-mlv (-) comparison.Reaction system: 1 μ g total rna, 1 μ l random 6 (20 μm), 1 μ l dntp
Mixture (10mm each), plus dh2o rnase free to 7.5 μ l.Reaction condition: 70 DEG C, 10min, immediately after on ice
Place 2min.Be subsequently adding following component: 2 μ l 5 × m-mlv buffer, 0.25 μ l rnase inhibitor (40u/ μ l),
0.25μl reverse transcriptase m-mlv(rnase h-) (200u/ μ l), total reaction volume 10 μ l.Reaction bar
Part: 30 DEG C, 10min → 42 DEG C, 60min → 70 DEG C, 15min.
1.1.3 pcr amplification
Carry out pcr amplification using takara tks gflex dna polymerase (code no.r060a).Reactant
System: 2 μ l inverse transcription reaction liquids, 25 μ l 2 × gflex pcr buffer (mg2+, dntp plus), 1 μ l tks gflex dna
polymerase(1.25units/μl)、1μl ctg0071 f primer(10μm)、1μl ctg0071 r primer(10μ
M), 20 μ l dh2o, total reaction volume 50 μ l.Reaction condition: 94 DEG C of denaturations 1min, then put 98 DEG C of 10sec, 55 DEG C
15sec, 68 DEG C of 1min react 30 circulations.5 μ l are taken to carry out 3% agarose gel electrophoresiies, result is shown in Fig. 7.
1.1.4 pcr product purification
Using takara minibest agarose gel dna extraction kit ver.4.0 (code
No.9762) cut glue reclaim purpose product, be named as ctg0071-pcr.
1.1.5 sequencing analysis
Using primer ctg0057 f1/r0, ctg0071-pcr product is sequenced.
1.2 cloning and sequencing
UseHd cloning kit (clontech code no.639633), by ctg0071-pcr and
Vector dna1 (ctg0006 project system is standby) connects；Thermal transition is to e.coli competent cells jm109 (code
No.9052 in), spread plate, 37 DEG C of incubated overnight.Select positive bacterium colony using t7/t7 terminator primer and plant bacterium, carry
Take positive colony plasmid ctg0071-1,2.Using t7, above-mentioned plasmid is sequenced.Obtain plasmid ctg0071-1 to meet the requirements.
2. destination protein expression and western blotting identification
Plasmid ctg0071-1 is proceeded in bl21 (de3) t1r competent cell, abduction delivering is carried out to positive colony.
2.1 conversion
Take in 1 μ l plasmid ctg0071-1 conversion competent cell bl21 (de3) t1r, using lb/ antibiotic amp
(100 μ g/ml) flat board, 35 μ l conversional solution coatings, 37 DEG C of o/n cultures, controlpet28a (+) equally operated.
2.2 cultures and induction
2.2.1 plant culture
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, are named as respectively
exp0207-2.
2.2.2 main culture induction
Add in glass tube in 5ml lb/amp (100 μ g/ml) culture medium respectively, add kind of culture bacterium solution 100 μ
l.Cultivate for 37 DEG C and be about 0.6 to od600nm value, add 100mm iptg 50 μ l (final 1mm iptg) and induced, 37 DEG C
Culture 4h.Exp0207-2 (ctg0070-73) induction before absorbance be 0.60, collection bacterium before absorbance be 1.60, compare pet28a
(+) induction before absorbance be 0.60, collection bacterium before absorbance be 1.35.
2.2.3 protein extracting
After collection bacterium, the suitable thalline of 2.0od carries out ultrasonic disruption after adding 320 μ l pbs suspended, and bacterial cell disruption liquid is entered
Row centrifugation (12000 × rpm, 5min).
2.2.4 extract electrophoresis
Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5 × sds loading
Buffer, 95 DEG C of heating 10min, carry out sds-page electrophoresis.Deposition condition: 25ma/ piece, about 80min, using 15%
Polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes, and is decoloured using destaining solution.Sds-page/cbb dyeing knot
Fruit sees Fig. 8.
2.3 western blotting
Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5 × sds loading
Buffer, 95 DEG C of heating 10min, using colored marker and histidine-tagged marker, carry out sds-page electrophoresis, electrophoresis strip
Part: 25ma/ piece, 80min, using 15%polyacrylamide gel.After electrophoresis terminates, pvdf film, filter paper are sheared respectively
Become with gel formed objects, using transferring film buffer process after, by filter paper, pvdf film, gel, filter paper order be successively placed on turn
Between film instrument battery lead plate, start transferring film, setting transferring film instrument parameter is as follows: electric current 39ma, transfer time 80min.Pvdf film is put
In the 10ml blocking buffer containing 1.5%bsa, 4 DEG C keep flat and overnight close.Using the pena-his after dilution
Antibody solution 5ml, carries out an antibody response 1h.Tbst buffer (20ml) washs 2 times, washs tbs wash buffer 3
Secondary.Using the hrp-rabbit anti-mouse igg antibody-solutions 5ml after dilution, carry out secondary antibodies reaction 1h.Tbst delays
Rush liquid (20ml) to wash 2 times；Washing tbs wash buffer 3 times.1ml trueblue peroxidase substrate develops the color
1min.After colour developing, pvdf film is shown in Fig. 9.Plasmid exp0207-2 (ctg0071-1) is mainly solubility expression as seen from the figure.
3. destination protein purification and identification
Protected using exp0207-2 glycerol stock and carry out 500ml culture, to carry out destination protein purification from thalline.Company orders
Entitled exp0228.
3.1 500ml cultures
3.1.1 plant culture
Exp0207-2 sample glycerol stock is taken to guarantee the quality in grain 50 μ l implantation 10ml lb/kana (50 μ g/ml) culture medium, 37 DEG C
O/n cultivates.
3.1.2 main culture and induction
By in 10ml kind culture bacterium solution implantation 500ml lb/2l flask, 37 DEG C, 200rpm cultivates to od600 about 0.6
When, add 100mm iptg 500 μ l (final 0.1mm iptg) and induced, continue culture 4h.It is centrifuged after culture, collect
Thalline.It is centrifuged using after pbs cleaning thalline, weigh thalline weight in wet base.Before induction, for 0.60, before collection bacterium, absorbance is absorbance
1.95, thalline weight in wet base is 1.15g.
3.1.3 sds-page
Take the suitable thalline of 2.0od to carry out ultrasonic disruption after adding 320 μ l pbs suspended, bacterial cell disruption liquid is carried out from
The heart separates (12000 × rpm, 5min).Take each 8 μ l (0.05od is suitable) of extract (whole protein, supernatant, precipitation), add 2 μ l 5
× sds loading buffer, 95 DEG C of heating 10min, carry out sds-page electrophoresis.Deposition condition: 25ma/ piece, about 80min.
Using 15%polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes, and is decoloured using destaining solution.sds-page/
Cbb coloration result is shown in Figure 10.Sds-page results expression 500ml culture thalline has expression, essentially solubility expression.
4.2 recombinant protein purification
4.2.1 buffer
Sonication buffer/wash buffer/buffer a, ph8.0 (4 DEG C), by 50mm sodium
Phosphate (ph 8.0), 300mm nacl, 5mm imidazole composition；Buffer b, ph8.0 (4 DEG C), by 50mm
Sodium phosphate (ph 8.0), 300mm nacl, 300mm imidazole composition.Dialysis buffer is takara
pbs(code no.t900).
4.2.2 bacterial cell disruption
After culture, thalline weight in wet base is 1.15g, adds sonication buffer (10 times of thalline weight in wet base) 10ml；4 DEG C are filled
Divide suspended, sonication 180w, 10min, collect broken liquid 10ml (s1)；By s1 put 12000rpm, 4 DEG C centrifugation 30min,
Obtain supernatant 15ml (s2), precipitate 0.31g；S2 is taken to use 0.45 μm, 1000ml vacuum filter/storage bottle
System is filtered, and obtains sample 10ml (s3).
4.2.3 column chromatography purification
Using ge hitrap talon crude, 5ml talon superflow (code no.28-9537-66) post layer
Analysis；Sterilizing milliq h using 10 times of column volumes2The buffer a 50ml balance resin of o 50ml and 10 times of column volumes, stream
Fast 1ml/min.Loading: loading after buffer a equilibrating, flow velocity is 0.5ml/min.After protein adsorption, using 10 times of volumes
Buffer a 50ml cleans resin, flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml.Albumen dissolution elution:
Buffer a 50ml, buffer b 50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes.
4.2.4 each stage sds-page electrophoresis and akta go out peak figure
Each purification each stage carries out sds-page electrophoresis, takes full cell (w), supernatant (s), infusible precipitate (p) each
0.05od600 electrophoresis, takes each 1 μ l electrophoresis of s1, s2, s3, pa stock solution, takes each 2.5 μ l electrophoresis of w1, w2, w3 stock solution, takes elution
The each 5 μ l electrophoresis of stock solution；Take bsa standard substance 500ng loading.Protein marker:broad weight marker (takara
Code:3452q), 5 μ l/well.Running gel is that 15%sds-page/ coomassie brilliant blue staining liquid contaminates.
4.2.5 collecting
Collect destination protein fraction no.40～65 about 28ml [s4] altogether.Take and carry out sds-page electrophoresis simultaneously in a small amount
With bsa standard concentration as reference.Using the dyeing of 15%sds-page/ coomassie brilliant blue staining liquid.
4.2.6 dialysis
Carry out buffer dialysis using pbs, be repeated 3 times, after concentration, sample is [s5].Dialysis buffer:pbs.Put
Change rate: 1:1000.Dialyzer: snakeskin dialysis tubing 10000 mwco (cat no.68035, lot
no.mh1600).Using the dyeing of 15%sds-page/ coomassie brilliant blue staining liquid, after taking dialysis to concentrate, sample carries out sds-page
Electrophoresis, as shown in figure 11.Carry out quantitative analyses using nanodrop-1000: obtain exp0228-s5, volume 30ml, albumen altogether
Concentration is: 0.94mg/ml, and Tot Prot is 28.2mg, and purity of protein is 99%.
4.western blotting detects
Take recombiant protein 8 μ l (0.05od is suitable), add 2 μ l 5 × sds loading buffer, 95 DEG C of heating
10min, carries out sds-page electrophoresis.Deposition condition: 25ma/ piece, 70min.Using 12.5%polyacrylamide gel, electricity
After swimming terminates, cbb-250 dyes, and is decoloured using destaining solution.Pvdf film, filter paper are cut into and gel formed objects respectively, makes
After being processed with transferring film buffer, it is successively placed between transferring film instrument battery lead plate by the order of filter paper, pvdf film, gel, filter paper, 2
Film starts simultaneously at transferring film, and setting transferring film instrument parameter is as follows: electric current 52ma, transfer time 80min.Pvdf film is placed in containing 1.5%
In the 12ml blocking buffer of bsa, 37 DEG C keep flat 1h closing.Using the serum solution 10ml after 1:10 dilution, carry out
Antibody response 1h.Tbst buffer (25ml) washs 1 time；Washing tbs wash buffer 2 times.After 1:2500 dilution
Goat anti-human ige (hrp) antibody-solutions 9ml carry out secondary antibodies reaction 1h.Tbst buffer (25ml) washing 1
Secondary；Washing tbs wash buffer 2 times.1ml trueblue peroxidase substrate colour developing 1min.Pvdf after colour developing
Film is as shown in figure 12.
Embodiment 3: tyrophagus putrescentiae anaphylactogen try p 28 gene cloning and expression purification and wb checking
1.total rna extracts
Extract the tyrophagus putrescentiae total rna being placed in trizol providing, then using recombinant dnase
(rnase free) (code no.2270a) carries out dnase process, is finally dissolved in depc and processes water.1 μ l is taken to carry out 1% agar
Sugared gel electrophoresiss, result is as shown in figure 13.
2. full-length gene amplification, clone and Prokaryotic expression vector construction
With tyrophagus putrescentiae total rna as template, rt-pcr expands genbank no.kx060611 sequence cds area
1980bp be cloned into pet28a (+) carrier.
2.1 genes of interest obtain
2.1.1 design of primers and synthesis
2.1.2 reverse transcription
Synthesized using 3 '-full race core set with primescripttm rtase (code no.6106)
Cdna, set up simultaneously m-mlv (-) comparison.Reaction system: 1 μ g total rna, 1 μ l random 6 (20 μm), 1 μ l dntp
Mixture (10mm each), plus rnase free dh2o to 7.5 μ l.Reaction condition: 70 DEG C of 10min, place 2 immediately on ice
Minute.Be subsequently adding following component: 2 μ l 5 × m-mlv buffer, 0.25 μ l rnase inhibitor (40u/ μ l), 0.25
μ l reverse transcriptase m-mlv (rnase h-) (200u/ μ l), cumulative volume 10 μ l.Reaction condition: 30 DEG C anti-
Answer 10min, 42 DEG C of reaction 60min, 70 DEG C of reaction 15min.
2.1.3 pcr amplification
Using takara tks gflex dna polymerase (code no.r060a), carry out pcr amplification.Reactant
System: the above-mentioned inverse transcription reaction liquid of 2 μ l, 25 μ l 2 × gflex pcr buffer (mg2+, dntp plus), 1 μ l tks gflex
dna polymerase(1.25units/μl)、1μl ctg0123 f primer(10μm)、1μl ctg0123 r primer
(10 μm), 20 μ l dh2o, total reaction volume 50 μ l.Reaction condition: 94 DEG C of denaturations 1min, 98 DEG C of degeneration 10sec, 55 DEG C move back
Fiery 15sec, 68 DEG C of extension 2min, 30 circulations.
5 μ l are taken to carry out 3% agarose gel electrophoresiies, result is shown in Figure 14.Using takara minibest agarose gel
Dna extraction kit ver.4.0 (code no.9762) cuts glue reclaim purpose product, is named as ctg0123-pcr.
2.2 full length gene cloning and sequencings
2.2.1 design of primers and synthesis
| Title | Sequence (5 ' -3 ') | Length (mers) |
| ctg0123p1 | tcaacgacagccagcgacag | 20 |
| ctg0123p4 | tccttcaccatgcgttcaat | 20 |
2.2.2 pcr product cloning and sequencing
UseHd cloning kit (clontech code no.639633), by ctg0070-pcr and
Vector dna2 (ctg0009 project system is standby) connects；Thermal transition is to e.coli competent cells jm109 (code
No.9052 in), spread plate, 37 DEG C of incubated overnight.Select positive bacterium colony using t7/t7 terminator primer and plant bacterium, carry
Take positive colony plasmid ctg0123-2,3.Above-mentioned using t7, t7terminator, ctg0123 p1, ctg0123 p4 primer pair
Plasmid is sequenced.Plasmid ctg0123-2 meets the requirements.
3. protein expression and western blotting
Plasmid ctg0123-2 is proceeded in bl21 (de3) t1r competent cell, abduction delivering is carried out to positive colony.
3.1 conversion
Take in plasmid 1 μ l conversion competent cell bl21 (de3) t1r, using lb/ antibiotic amp (100 μ g/ml)
Flat board, 35 μ l conversional solution coatings, 37 DEG C of o/n cultures, control pet28a (+) equally operated.
3.2 cultures and induction
Plant culture: to 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, name respectively
For exp0212-1.
Main culture induction: add 5ml lb/amp (100 μ g/ml) culture medium in glass tube respectively, add kind of a training
Bacteria liquid 100 μ l.Cultivate for 37 DEG C and be about 0.6 to od600nm value, add 100mm iptg 50 μ l (final 1mm iptg) and enter
Row induction, 37 DEG C of culture 4h.Pet28a induction before absorbance be 0.60, collection bacterium before absorbance be 1.15, exp0212-1
(ctg0123-2) induce before absorbance be 0.60, collection bacterium before absorbance be 2.45.
Protein extracts: after collection bacterium, the suitable thalline of 2.0od carries out ultrasonic disruption after adding 320 μ l pbs suspended, right
Bacterial cell disruption liquid is centrifuged (12000 × rpm, 5min).Take each 8 μ l of each extract (whole protein, supernatant, precipitation)
(0.05od is suitable), adds 2 μ l 5 × sds loading buffer, 95 DEG C of heating 10min, carries out sds-page electrophoresis.Electricity
Swimming condition: 25ma/ piece, about 80min, using 12.5%polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes,
Decoloured using destaining solution.Result is shown in Figure 15.
3.3 western blotting sample electrophoresis comparisons
Take each extract (whole protein, supernatant, precipitation) 8 μ l (0.05od is suitable), add 2 μ l 5 × sds loading
Buffer, 95 DEG C of heating 10min, using colored marker and histidine-tagged marker, carry out sds-page electrophoresis.Electrophoresis strip
Part: 25ma/ piece, about 80min, using 12.5%polyacrylamide gele, sds-page/cbb dyes.
Pvdf film, filter paper are cut into and gel formed objects respectively, using transferring film buffer process after, by filter paper,
Pvdf film, gel, the order of filter paper are successively placed between transferring film instrument battery lead plate, start transferring film, and setting transferring film instrument parameter is as follows: electricity
Stream 33ma, transfer time 88min.Pvdf film is placed in the 10ml blocking buffer containing 1.5%bsa, 4 DEG C kept flat
Night is closed.Using the penta-his antibody solution 5ml after dilution, carry out an antibody response 1h.Tbst buffer
(20ml) wash 2 times；Washing tbs wash buffer 3 times.Using the hrp-rabbit anti-mouse igg antibody after dilution
Solution 5ml, carries out secondary antibodies reaction 1h.Tbst buffer (20ml) washs 2 times；Washing tbs buffer washes 3 times.1ml
Trueblue peroxidase substrate colour developing 1min.After colour developing, pvdf film is as shown in figure 16.Result shows exp0212-
1 (ctg0123-2) is solubility expression.
4.exp0212-1 recombinant protein purification and identification
4.1 500ml cultures, expression and identification
Protected using exp0212-1 glycerol stock and carry out 500ml culture, to carry out destination protein purification from thalline.Concrete step
Suddenly as follows: (1) plants culture: exp0212-1 sample glycerol stock is protected and takes 50 μ l implantation 10ml lb/kana (50 μ g/ml) culture medium
In, 37 DEG C of o/n cultures.(2) main culture and induction: 10ml kind culture bacterium solution is implanted in 500ml lb/2l flask, 37 DEG C,
When 200rpm cultivates to od600 ≈ 0.6, add 100mm iptg 500 μ l (final 0.1mm iptg) and induced, 16 DEG C
Continue culture 24h.It is centrifuged after culture, collects thalline.It is centrifuged using after pbs cleaning thalline, weigh thalline weight in wet base.Before result induction
Absorbance is 0.60, and before collection bacterium, absorbance is 4.05, and thalline weight in wet base is 2.72g.(3) sds-page electrophoresis: take 2.0od phase
When thalline add 320 μ l pbs suspended after carry out ultrasonic disruption, bacterial cell disruption liquid is centrifuged (12000 ×
Rpm, 5min), this is protein extracting.Take each extract (whole protein, supernatant, precipitation) 8 μ l (0.05od is suitable), add 2 μ l
5 × sds loading buffer, 95 DEG C of heating 10min, carry out sds-page electrophoresis.Deposition condition: 25ma/ piece, about
80min, using 12.5%polyacrylamide gel, after electrophoresis terminates, cbb-r250 dyes, and is decoloured using destaining solution,
Sds-page/cbb coloration result is shown in Figure 17, shows there is protein expression in 500ml culture thalline.
5.2 column chromatography purification and identification
5.2.1 buffer
Sonication buffer/wash buffer/buffer a, ph8.0 (4 DEG C), by 50mm sodium
Phosphate (ph 8.0), 300mm nacl, 5mm imidazole composition；Buffer b, ph8.0 (4 DEG C), by 50mm
Sodium phosphate (ph 8.0), 300mm nacl, 300mm imidazole composition.Dialysis buffer is takara
pbs(code no.t900).
5.2.2 bacterial cell disruption
After culture, thalline weight in wet base is 2.72g, adds sonication buffer (10 times of thalline weight in wet base) 30ml；4 DEG C are filled
Divide suspended, sonication 180w, 10min, collect broken liquid 30ml (s1)；By s1 put 12000rpm, 4 DEG C centrifugation 30min,
Obtain supernatant 30ml (s2), precipitate 0.99g；S2 is taken to use 0.45 μm, 1000ml vacuum filter/storage bottle
System is filtered, and obtains sample 30ml.
5.2.3 column chromatography purification
Using ge hitrap talon crude, 5ml talon superflow (code no.28-9537-66) post layer
Analysis and；Sterilizing milliq h using 10 times of column volumes2The buffer a 50ml balance resin of o 50ml and 10 times of column volumes,
Flow velocity 1ml/min.Loading: loading after buffer a equilibrating, flow velocity is 0.5ml/min.After protein adsorption, using 10 times of volumes
Buffer a 50ml cleaning resin, flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml.Albumen dissolution elution:
Buffer a 50ml, buffer b 50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes.
5.2.4 each stage sds-page electrophoresis and akta go out peak figure
Each purification each stage carries out sds-page electrophoresis, takes full cell (w), supernatant (s), infusible precipitate (p) each
0.05od600 electrophoresis, takes each 1 μ l electrophoresis of s1, s2, s3, pa stock solution, takes each 2.5 μ l electrophoresis of w1, w2, w3 stock solution, takes elution
The each 5 μ l electrophoresis of stock solution；Take bsa standard substance 500ng loading.Protein marker:broad weight marker (takara
Code:3452q), 5 μ l/well.Running gel is that 12.5%sds-page/ coomassie brilliant blue staining liquid contaminates.
5.2.5 collecting
Collect destination protein fraction no.47～69, about 26ml (s4) altogether.Take and carry out sds-page electrophoresis in a small amount
And with bsa standard concentration as reference.Using the dyeing of 12.5%sds-page/ coomassie brilliant blue staining liquid.
5.2.6 dialysis
Carry out buffer dialysis using pbs, be repeated 3 times, after dialysis, sample is s5.Dialysis buffer is pbs, displacement
Rate is 1:1000, dialyzer: snakeskin dialysis tubing 3500 mwco (cat no.68035, lot no.mh
160055), dyeed using 12.5%sds-page/ coomassie brilliant blue staining liquid, after taking dialysis, sample carries out sds-page electrophoresis,
As shown in figure 18.
Carry out quantitative analyses using nanodrop-1000, the purity of destination protein: 99%, destination protein total amount: 3.9mg,
The concentration of destination protein: 0.15mg/ml.Volume: 26ml.
9.western blotting detects
Take recombiant protein 8 μ l (0.05od is suitable), add 2 μ l 5 × sds loading buffer, 95 DEG C of heating
10min, carries out sds-page electrophoresis.Deposition condition: 25ma/ piece, 70min.Using 12.5%polyacrylamide gel, electricity
After swimming terminates, cbb-250 dyes, and is decoloured using destaining solution.Pvdf film, filter paper are cut into and gel formed objects respectively, makes
After being processed with transferring film buffer, it is successively placed between transferring film instrument battery lead plate by the order of filter paper, pvdf film, gel, filter paper, 2
Film starts simultaneously at transferring film, and setting transferring film instrument parameter is as follows: electric current 52ma, transfer time 80min.Pvdf film is placed in containing 1.5%
In the 12ml blocking buffer of bsa, 37 DEG C keep flat 1h closing.Using the serum solution 10ml after 1:10 dilution, carry out
Antibody response 1h.Tbst buffer (25ml) washs 1 time；Washing tbs wash buffer 2 times.After 1:2500 dilution
Goat anti-human ige (hrp) antibody-solutions 9ml carry out secondary antibodies reaction 1h.Tbst buffer (25ml) washing 1
Secondary；Washing tbs wash buffer 2 times.1ml trueblue peroxidase substrate colour developing 1min.Pvdf after colour developing
Film is as shown in figure 19.
Embodiment 4: with recombiant protein as antigen, western blotting detects anaphylactic disease asthma/patients with rhinitis
Serological specificity ige, whether patient is to this recombiant protein allergy for diagnosis.Purification prepared by the present invention is verified by clinical experiment
Application in clinic for the albumen, application result is as follows:
specific ige-binding to recombinant allergens
the reactivities of the specific ige antibodies to recombinant
allergens were examined by western blotting.in brief,8μl of the recombinant
Allergens were electrophoresed on a 12.5%polyacrylamide gel and
electroblotted onto polyvinylidene difluoride(pvdf,millipore,code
No.ipvh20200) membrane.the membrane was blocked with 1.5%bovine serum albumin
in 1×tbs-t for 1h at room temperature.after overnight incubation with 1:10
dilution of the t.putrescentiae-positive human sera in blocking buffer at 4
℃,the membrane was incubated with 1:2500 dilution of goat anti-human ige-hrp
(secondary antibody,invitrogen,carlsbad,calif.,usa)for 1h.the membrane was
washed 1 times with tbs-t and tbs buffer 2 times.1ml of trueblue peroxidase
substrate was added to the membranes for coloration；2min after reaction,the
film was exposed and imaged.
Embodiment described above is the preferred embodiments of the present invention, without limiting the practical range of the present invention.Therefore, all
It is the equivalent modifications according to done by the essence of present invention, all should belong within the scope of the present invention.
<120> title :
<130> appfilereference :
<140> currentappnumber :
<141> currentfilingdate :
sequence
--------
<213> organismname :
<400> presequencestring :
aatgggtcgc ggatccatgt cccaagtacc gatcaa 36
<212> type : dna
<211> length : 36
sequencename : 1
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
atctcagtgg tggtggtggt ggtgctcgag tgcggccgct tactgcccgc cagcaagct 59
<212> type : dna
<211> length : 59
sequencename : 2
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
cactgatgct cgcctggaag 20
<212> type : dna
<211> length : 20
sequencename : 3
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
aatgggtcgcggatccatgtcttggcaatcctacgt 36
<212> type : dna
<211> length : 36
sequencename : 4
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
atctcagtggtggtggtggtggtgctcgagtcaatagttgttggctttca 50
<212> type : dna
<211> length : 50
sequencename :5
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
aatgggtcgcggatccatggccaacaagaagacgcc 36
<212> type : dna
<211> length : 36
sequencename :6
sequencedescription :
sequence
--------
<213> organismname :
<400> presequencestring :
atctcagtggtggtggtggtggtgctcgagtgcggccgcctagtccacttcctcaatgg 59
<212> type : dna
<211> length : 59
sequencename :7
sequencedescription :
Claims (5)
1. a kind of tyrophagus putrescentiae new discovery anaphylactogen try p 35 gene cloning and expression purification process, it comprises the steps:
1) genes of interest obtains
1.1) design of primers and synthesis
With tyrophagus putrescentiae total rna as template, rt-pcr amplification kx060612 sequence cds area 1461bp is cloned into pet28a
(+) carrier；
1.2) reverse transcription and pcr amplification, and use takara minibest agarose gel dna extraction kit
Ver.4.0 (code no.9762) cuts glue reclaim purpose product, is named as ctg0124-pcr；
2) gene cloning
Design of primers and synthesis:
UseHd cloning kit (clontech code no.639633), by ctg0124-pcr and
Vector dna2 connects；To e.coli competent cells jm109 (code no.9052), coating is flat for thermal transition
Plate, 37 DEG C of incubated overnight.Select positive bacterium colony using t7/t7terminator primer and plant bacterium, extract positive colony plasmid
Ctg0124-1, and by testing sequence verification.
3) gene expression and protein purification
Plasmid ctg0124-1 is proceeded in bl21 (de3) t1r competent cell, abduction delivering and culture are carried out to positive colony；
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, are named as exp0212-2, add
Iptg is induced, 37 DEG C of cultures, and before collection bacterium, absorbance is 2.65；Carry out ultrasonic disruption, to bacterial cell disruption liquid after collection bacterium
It is centrifuged；
Protected using exp0212-2 glycerol stock and carry out 500ml culture, to carry out destination protein purification from thalline: using ge
Hitrap talon crude, 5ml talon superflow column chromatography and；Sterilizing milliq h2o using 10 times of column volumes
The buffer a 50ml balance resin of 50ml and 10 times of column volume, flow velocity 1ml/min；Loading: loading after buffera equilibrating,
Flow velocity is 0.5ml/min；After protein adsorption, using 10 times of volumes buffer a 50ml clean resin, flow velocity 1ml/min,
W1:10ml, w2:20ml, w3:20ml；Albumen dissolution elution:buffer a 50ml, buffer b 50ml gradient dissolution,
Flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes；
Collect destination protein fraction no.46～90, carry out quantitative analyses using nanodrop-100, obtain purification of Recombinant
Albumen, purity of protein is 99%.
2. a kind of tyrophagus putrescentiae new discovery anaphylactogen try p 36 gene cloning and expression purification process, it comprises the steps:
1) genes of interest obtains
1.1) design of primers and synthesis
With tyrophagus putrescentiae total rna as template, rt-pcr amplification kx060615 sequence cds area 396bp be cloned into pet28a (+)
Carrier；
1.2) reverse transcription and pcr amplification, and use takara minibest agarose gel dna extraction kit
Ver.4.0 (code no.9762) cuts glue reclaim purpose product, is named as ctg0071-pcr；
2) gene cloning
UseHd cloning kit (clontech code no.639633), by ctg0071-pcr and
Vector dna1 connects；Thermal transition to e.coli competent cells jm109 (code no.9052), using t7/
T7terminator primer is selected positive bacterium colony and is planted bacterium, extracts positive colony plasmid ctg0071-1, and by testing sequence verification.
3) gene expression and protein purification
Plasmid ctg0071-1 is proceeded in bl21 (de3) t1r competent cell, abduction delivering is carried out to positive colony；
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, add iptg and are induced, and 37
DEG C culture, collection bacterium before absorbance be 2.65；Carry out ultrasonic disruption after collection bacterium, bacterial cell disruption liquid is centrifuged；
Using ge hitrap talon crude, 5ml talon superflow column chromatography and；Using going out of 10 times of column volumes
The buffera 50ml balance resin of bacterium milliq h2o 50ml and 10 times of column volumes, flow velocity 1ml/min；Loading: buffer a
Loading after equilibrating, flow velocity is 0.5ml/min；After protein adsorption, the buffer a 50ml using 10 times of volumes cleans resin,
Flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml；Albumen dissolution elution:buffer a 50ml, buffer b
50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes；
Collect destination protein fraction no.40～65, carry out quantitative analyses using nanodrop-100, obtain purification of Recombinant
Albumen, purity of protein is 99%.
3. a kind of tyrophagus putrescentiae new discovery anaphylactogen try p 28 gene cloning and expression purification process, it comprises the steps:
1) genes of interest obtains
1.1) design of primers and synthesis
With tyrophagus putrescentiae total rna as template, rt-pcr expands 1980bp gram of genbank no.kx060611 sequence cds area
Grand to pet28a (+) carrier；
1.2) reverse transcription and pcr amplification, and use takara minibest agarose gel dna extraction kit
Ver.4.0 (code no.2270a) cuts glue reclaim purpose product；
2) gene cloning
UseHd cloning kit (clontech code no.639633), by ctg0070-pcr and
Vector dna2 connects；Thermal transition to e.coli competent cells jm109 (code no.9052), using t7/
T7terminator primer is selected positive bacterium colony and is planted bacterium, extracts positive colony plasmid ctg0123-2, and by testing sequence verification.
3) gene expression and protein purification this
Plasmid ctg0123-2 is proceeded in bl21 (de3) t1r competent cell, abduction delivering is carried out to positive colony；
To 2ml lb/amp (100 μ g/ml) culture medium, 37 DEG C of o/n cultivate picking single bacterium colony, add iptg and are induced, and 37
DEG C culture, collection bacterium before absorbance be 2.65；Carry out ultrasonic disruption after collection bacterium, bacterial cell disruption liquid is centrifuged；
Using ge hitrap talon crude, 5ml talon superflow column chromatography and；Using going out of 10 times of column volumes
The buffer a 50ml balance resin of bacterium milliq h2o 50ml and 10 times of column volumes, flow velocity 1ml/min；Loading: buffer
Loading after a equilibrating, flow velocity is 0.5ml/min；After protein adsorption, the buffer a 50ml using 10 times of volumes cleans resin,
Flow velocity 1ml/min, w1:10ml, w2:20ml, w3:20ml；Albumen dissolution elution:buffer a 50ml, buffer b
50ml gradient dissolution, flow velocity 1ml/min, fraction 1.1ml/tube × 90tubes；
Collect destination protein fraction no.47～69, carry out quantitative analyses using nanodrop-100, obtain purification of Recombinant
Albumen, purity of protein is 99%.
4. the recombiant protein obtained by above-mentioned tyrophagus putrescentiae new discovery allergen gene clonal expression purification process.
5. application in preparing diagnostic reagent for the above-mentioned recombiant protein is it is preferred that described diagnostic reagent is used for tyrophagus putrescentiae mistake
The clinical diagnosises of quick source.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610945970.8A CN106350522A (en) | 2016-11-02 | 2016-11-02 | Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610945970.8A CN106350522A (en) | 2016-11-02 | 2016-11-02 | Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106350522A true CN106350522A (en) | 2017-01-25 |
Family
ID=57864401
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610945970.8A Pending CN106350522A (en) | 2016-11-02 | 2016-11-02 | Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106350522A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609654A (en) * | 2017-12-18 | 2019-04-12 | 江苏省农业科学院 | A kind of the LAMP test strips and its application of quick detection tyrophagus putrescentiae |
| CN109970854A (en) * | 2019-04-09 | 2019-07-05 | 江苏省农业科学院 | Hybridoma cell strain AntiTput-13 and its AntiTput-DP10 monoclonal antibody of secretion |
| CN110117666A (en) * | 2019-06-06 | 2019-08-13 | 中国农业大学 | Identify the primer pair and its application of tyrophagus putrescentiae and ellipse dispersion |
| CN113403317A (en) * | 2021-05-13 | 2021-09-17 | 无锡市儿童医院 | Casein allergen Tyr p12 coding gene, recombinant protein and application thereof |
-
2016
- 2016-11-02 CN CN201610945970.8A patent/CN106350522A/en active Pending
Non-Patent Citations (7)
| Title |
|---|
| CUI,Y.: "aldehyde dehydrogenase-like protein [Tyrophagus putrescentiae]", 《GENBANK》 * |
| GE HEALTHCARE: "《Affinity Chromatography》", 30 April 2016 * |
| YUBAO CUI: "Transcriptomic/proteomic identification of allergens in the mite Tyrophagus putrescentiae", 《ALLERYG》 * |
| 俞黎黎: "腐食酪螨cDNA 表达文库构建及初步鉴定", 《中国免疫学杂志》 * |
| 周鹰: "腐食酪螨主要过敏原Try p 35基因克隆、表达及其产物的Western blot分析", 《中国病原生物学杂志》 * |
| 易忠权: "腐食酪螨过敏原研究进展", 《中国病原生物学杂志》 * |
| 杨李: "腐食酪螨变应原 Tyr p 28 克隆、表达、纯化及免疫学特性鉴定", 《中国优秀硕士毕业论文全文数据库》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609654A (en) * | 2017-12-18 | 2019-04-12 | 江苏省农业科学院 | A kind of the LAMP test strips and its application of quick detection tyrophagus putrescentiae |
| CN109970854A (en) * | 2019-04-09 | 2019-07-05 | 江苏省农业科学院 | Hybridoma cell strain AntiTput-13 and its AntiTput-DP10 monoclonal antibody of secretion |
| CN110117666A (en) * | 2019-06-06 | 2019-08-13 | 中国农业大学 | Identify the primer pair and its application of tyrophagus putrescentiae and ellipse dispersion |
| CN110117666B (en) * | 2019-06-06 | 2022-04-26 | 中国农业大学 | Specific primer pair for identifying Tyrophagus putrescentiae and Tyrophagus ovatus and application thereof |
| CN113403317A (en) * | 2021-05-13 | 2021-09-17 | 无锡市儿童医院 | Casein allergen Tyr p12 coding gene, recombinant protein and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106350522A (en) | Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof | |
| CN111269313B (en) | Monoclonal antibody for detecting novel coronavirus and application of monoclonal antibody in preparation of kit | |
| Christie et al. | N-terminal amino acid sequence identity between a major allergen of Ascaris lumbricoides and Ascaris suum, and MHC-restricted IgE responses to it. | |
| CN111398581A (en) | COVID-19 rapid diagnosis kit and preparation method thereof | |
| CN114276445B (en) | Rotavirus recombinant protein specific antibody, plasmid vector and method | |
| CN106699899B (en) | Immunogen for obtaining Nrf1D protein antibody, Nrf1D protein antibody and Elisa detection kit | |
| CN102676568A (en) | Method for producing recombinant dermatophagoides farinae allergen Der f1 and Der f2 fusion protein | |
| CN106282213A (en) | A kind of method expressing also purification of soluble dermatophagoides pteronyssinus main allergen Der p 2 albumen | |
| CN109134638B (en) | House dust mite allergen Der p 22 gene recombinant protein and application thereof | |
| CN102279271A (en) | Indirect ELISA (Enzyme Linked Immunosorbent Assay) method for detecting anti-roundworm antibody by recombined roundworm ALAg protein antigen | |
| CN109734791B (en) | Human NF186 antigen, human NF186 antibody detection kit, preparation method and application thereof | |
| CN114195899B (en) | Anti-cocaine specific antibodies, plasmid vectors and methods | |
| WO2017107131A1 (en) | Tp recombinant antigen, and preparation method and application thereof | |
| CN101619313B (en) | Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof | |
| CN110066343A (en) | A kind of recombinant antigen and its application for detecting HIV new infections | |
| CN104531715A (en) | Preparation of human procalcitonin recombination expression monoclonal and polyclonal antibody and ELISA detection method | |
| CN109265529A (en) | A kind of 33 gene recombinant protein of house dust mite allergen Der p and its application | |
| CN111751526B (en) | Kit and method for detecting autoantibodies against GM, IIDD and NR in human body fluid | |
| CN111153996B (en) | Antibody of G protein coupled receptor, preparation method thereof and G protein coupled receptor kit | |
| CN100387709C (en) | Anti HBeAg monoclone antibody cell strain, preparation method and anti HBeAg monoclone antibody | |
| CN102993283B (en) | Antigen protein for mycobacterium tuberculosis and application | |
| CN102621311A (en) | Colloidal gold chromatography anti-SSB antibody detection test paper and preparation method thereof | |
| CN109796527A (en) | A kind of bluish dogbane mitochondrial protein COX3 antigen polypeptide and the methods and applications for preparing polyclonal antibody | |
| CN109734790A (en) | People Agrin antigen, people's Agrin antibody assay kit and the preparation method and application thereof | |
| WO2020073645A1 (en) | Dermatophagoides pteronyssinus allergen der p 29 gene recombinant protein and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170125 |
|
| RJ01 | Rejection of invention patent application after publication |