CN109265529A

CN109265529A - A kind of 33 gene recombinant protein of house dust mite allergen Der p and its application

Info

Publication number: CN109265529A
Application number: CN201811176762.1A
Authority: CN
Inventors: 崔玉宝; 杜晓燕; 钱俊; 周鹰; 吴国荣; 陈越新; 郁志伟
Original assignee: Wuxi Peoples Hospital
Current assignee: Wuxi Peoples Hospital
Priority date: 2018-10-10
Filing date: 2018-10-10
Publication date: 2019-01-25

Abstract

The invention discloses a kind of 33 gene recombinant protein of house dust mite allergen Der p and its applications.33 gene of house dust mite allergen Der p of the present invention is as shown in SEQ ID NO:2, which is obtained by 33 gene of house dust mite allergen Der p through expression, after purification, and sequence is as shown in SEQ ID NO:1.In terms of the recombinant protein is used to prepare the diagnostic reagent or biological products of anaphylactia caused by accurate medicine detection dermatophagoides pteronyssinus.Present invention firstly discovers that 33 gene order overall length of dermatophagoides pteronyssinus Der p, and its recombinant protein is obtained by gene cloning, expression, purifying, the recombinant protein tests accurate medicine for Western blotting and detects allergic asthma infant caused by 16 dermatophagoides pteronyssinus, positive rate 18.75% (3/16), and control group is no positive.

Description

A kind of 33 gene recombinant protein of house dust mite allergen Der p and its application

Technical field

The invention belongs to allergology field more particularly to a kind of 33 gene recombinant proteins of house dust mite allergen Der p And its application in terms of the diagnostic reagent or biological products for preparing anaphylactia caused by accurate medicine detection dermatophagoides pteronyssinus.

Background technique

Dust mite (House dust mite) refers to all mite class bred in dust, by boundary, mesh, guiding principle, door, section, genus and species Classify, it is many kinds of, it is common for dust mite (Dermatophagoides farinae) dermatophagoides pteronyssinus (D.pteronyssinus) and the most common two kinds of mites of China mainland.According to China's respiratory anaphylactic disease scientific research and stream Adjust cooperative groups (China Alliance of Research on Respiratory Allergic Disease, CARRAD) skin Skin Histamine positive illustrates that this is different sensitization mite as a result, dust mite positive rate is 59.0%, dermatophagoides pteronyssinus positive rate is 57.6% Kind, there is different clinical values to anaphylactia laboratory diagnosis.

Type Ⅰ allergy can occur after the catabolite of allergic constitution person sucking dust mite secretion, excreta and corpse, draw A variety of allergic diseases such as asthma, rhinitis and atopic dermatitis are played, use drug therapy can be with temporary relief of symptoms, still Disease cannot be eradicated.A large amount of clinical tests show using allergen specific immunization therapy (allergen-specific Immunotherapy, SIT) have many advantages, such as specificity, persistently improve the state of an illness.But it is clinical using allergen source material system It is standby go out slightly mention the mixture that immersion liquid is a variety of allergens, it is unstable that different batches slightly propose the allergen type that immersion liquid contains, main It wants the content of allergic effect stock blend unstable, and the relatively low allergen of non-allergenic substances, certain immunogenicities, toxicity may be contained Albumen etc. can cause adverse reaction or even threat to life locally and systemically for clinical treatment.

Every kind of mite can produce thousands of kinds of albumen, have plenty of anaphylactogen, and some is not.It can cause dust mite allergy disease The acarid composition for generating specific IgE antibody in patient's body and being combined in vivo with anaphylactia patients serum Referred to as allergenic components (Groups).It systematically identifies, characterize these components, there is important valence to the clinical application of two kinds of mites Value.

So far, clinical diagnosis is all made of dust mite and/or dermatophagoides pteronyssinus crude extract is that antigen establishes immunological detection.By Allergenic components there are many containing in mite body crude extract, same component content in different batches of product is inconsistent, is difficult to realize The standardization of product.Therefore, the allergenic components for understanding every kind of mite, prepare anaphylactogen one pack system biological products, are based on one pack system The method of inspection is established, precisely detecting anaphylactia patient is to work out essence because of certain component or certain component sensitization to be clinical Quasi- desensitization treatment scheme provides foundation.

Named dust mite allergy the 33rd component Der f 33 of original of international anaphylactogen naming committee, but without public affairs The 33rd component Der p 33 of cloth dermatophagoides pteronyssinus and its encoding gene.Dust mite allergy original can not but substitute house dust mite allergen, this is Because even if the two has certain sequence similar, even if but only 1 amino acid of difference can also cause clinical misdiagnosis, more how Condition is the protein between different plant species with similar sequences.

Summary of the invention

The purpose of the present invention is to provide a kind of 33 gene recombinant protein of house dust mite allergen Der p and its applications, this is heavy In terms of diagnostic reagent or biological products of the histone for anaphylactia caused by accurate medicine detection dermatophagoides pteronyssinus, it is intended to solve Anaphylactia caused by existing dust mite is unable to get the problem of accurate medicine detection.

The invention is realized in this way a kind of 33 gene recombinant protein of house dust mite allergen Der p, the DNA sequence of the gene Column are as shown in SEQ ID NO:1.

The present invention further discloses above-mentioned 33 gene recombinant proteins of house dust mite allergen Der p to detect in accurate medicine The diagnostic reagent or the application in terms of biological products that dermatophagoides pteronyssinus causes anaphylactia.

Preferably, the diagnostic reagent or biological products are that 33 gene of house dust mite allergen Der p is expressed, after purification Recombinant protein or the diagnostic reagent or biological products include that 33 gene of house dust mite allergen Der p is expressed, purified Recombinant protein afterwards.

The present invention provides a kind of 33 gene recombinant protein of house dust mite allergen Der p and its application.The present invention passes through transcription After group sequencing, sequence alignment is carried out, the sequence an of segment Yu 33 very high homology of the 33rd component Der f of dust mite is obtained, by this Segment expand come, then by the end cDNA rapid amplifying technology (rapid amplification of cDNA ends, RACE encoding gene overall length) is obtained, gene cloning and expression purifying is then carried out, by the protein of purifying and dermatophagoides pteronyssinus autopath Serum carries out Western blotting, it is found that the protein of gene coding has the activity of height, and finally determine the sequence It is classified as the 33rd component encoding gene of house dust mite allergen, as shown in SEQ ID NO:2,33 gene of Der p is obtained by the gene Recombinant protein, as shown in SEQ ID NO:1.

Compared with prior art the shortcomings that and deficiency, the invention has the following advantages: present invention firstly discovers that dermatophagoides pteronyssinus 33 gene order overall length of Der p, and its recombinant protein is obtained by gene cloning, expression, purifying, which is used for Western blotting tests accurate medicine and detects allergic asthma infant caused by 16 dermatophagoides pteronyssinus, positive rate 18.75% (3/16), and control group is no positive.

Detailed description of the invention

Fig. 1 is the verifying of 33 known array of house dust mite allergen Der p；Wherein, M:DL2,000 DNA Marker；1:F1/ R1 1st PCR product；2: negative control；3:F2/R2 2nd PCR product；4: negative control；

Fig. 2 is the sequence Ago-Gel electricity that 33 known segment of house dust mite allergen Der p is obtained through 3'RACE Swimming；Wherein, M:DL2,000 DNA Marker；The 1st PCR product of 1:3 ' RACE；The 2nd PCR product of 2:3 ' RACE；

Fig. 3 is house dust mite allergen Der p 33 through 3'RACE sequence verification agarose gel electrophoresis；Wherein, M:DL2, 000 DNA Marker；1:F1/R1 amplified production；2: negative control；3:F2/R2 amplified production；4: negative control；

Fig. 4 is 33 full-length gene pcr amplification product agarose gel electrophoresis of house dust mite allergen Der p；Wherein, M: DL2,000 DNA Marker；1: target gene pcr amplification product.

Fig. 5 is empty plasmid pET28a (+) through BamH I/Not I double digestion rear electrophoresis figure；Wherein, M2: λ-Hind III digest(Code No.3403)；1:pET28a (+) plasmid control；2:pET28a (+)-BamH I/Not I；

Fig. 6 is that pET28a (+)-Der p 33 converts Bacillus coli expression SDS-PAGE image；Wherein, M1 Protein MW marker (Broad), 1 is pET28a (+) full cell, and 2 be pET28a (+) supernatant, and 3 be pET28a (+) precipitating, and 4 are PET28a (+)-Der p 33 converts the full cell of Escherichia coli, and 5 convert the upper of Escherichia coli for pET28a (+)-Der p 33 Clearly, 6 for pET28a (+)-Der p 33 convert Escherichia coli precipitating；

Recombinant protein after Fig. 7 SDS-PAGE purification Identification；Wherein, M is Protein MW marker (Broad), and 1 is PET28a (+)-Der p 33 converts the expression product of Escherichia coli, 8 μ L loadings, and 2 convert greatly for pET28a (+)-Der p 33 The expression product of enterobacteria, 12 μ L loadings, 3 be BSA 200ng, and 4 be BSA 400ng, and 5 be BSA 600ng, and 6 be BSA 800ng, 7 be BSA 1000ng；

Recombinant protein after Fig. 8 Westernblotting purification Identification；Wherein, M1 is Precision Plus Protein Standards, 18 μ L recombinant protein loadings；M2 is Perfect protein marker；

Fig. 9 is WB detection recombinant protein rDer p 33 and anaphylactia patients serum IgE Percentage bound.7th, 11, No. 14 Serum sample has positive band.

Specific embodiment

In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right The present invention is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, and It is not used in the restriction present invention.

One, known array is verified

1, design of primers and synthesis

Title	Sequence (5 ' -3 ')	Length (mers)
			F1	TCGTCGTCTATTTCATCCAG	20
R1	ACCATTACGTGTATTACATT	20
			F2	TGAACAATGTTCCGGTTTAC	20
R2	AAGTACCAGTTATTTCGGCA	20

2, PCR amplification

PCR amplification is carried out using TaKaRa Tks Gflex DNA Polymerase (Code No.R060A).

1st PCR reaction system: 1 μ L inverse transcription reaction liquid, 25 μ L 2 × Gflex PCR Buffer (Mg²⁺, dNTP plus)、1μL Tks Gflex DNA Polymerase(1.25units/μl)、1μL F1 Primer(20μM)、1μL R1Primer(20μM)、21μL dH₂O, 50 μ L of total reaction volume.Reaction condition: then 94 DEG C of 1min set 98 DEG C of 10sec, 55 DEG C 15sec, 68 DEG C of 60sec carry out 30 circulations.

2nd PCR reaction: using above-mentioned 1st PCR product as template, carrying out the 2nd PCR amplification by primer of F2/R2, Reaction system and condition are same as above.PCR product respectively takes 5 μ L to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 1.

3, PCR product purifies

Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code No.9762) No. 3 swimming lanes of gel extraction, the amplified product band of about 0.5kbp.

4, sequencing analysis

Above-mentioned PCR product is sequenced using primers F 2, sequencing result is confirmed, continues RACE experiment.

Two, 3'RACE

1, design of primers and synthesis

Title	Sequence (5 ' -3 ')	Length (mers)
			F3	CATTTATGGTCGATAATGAAGC	22
F4	CATCAATAACAGCATCATTACG	22

2, PCR amplification

Use Clontech'sThe Kit of RACE 5 '/3 ' (Cat.Nos.634860) is tested.With above-mentioned PCR product is template, is expanded using TaKaRa Tks Gflex DNA Polymerase (Code No.R060A).

Outer PCR reaction system: the cDNA of 2 μ L reverse transcriptions, 25 μ L 2 × Gflex PCR Buffer (Mg²⁺, dNTP plus)、1μL Tks Gflex DNA Polymerase(1.25units/ul)、1μL F3Primer(20uM)、5μL UPM (10×)Primer、16μL dH₂O, 50 μ L of total reaction volume.Reaction condition: then 94 DEG C of 1min set 98 DEG C of 10sec, 55 DEG C 15sec, 68 DEG C of 60sec carry out 30 circulations.

Inner PCR reaction system: 1 μ L Outer PCR reaction solution, 25 μ L 2 × Gflex PCR Buffer (Mg²⁺, dNTP plus)、1μL Tks Gflex DNA Polymerase(1.25units/ul)、1μL F4 Primer(20uM)、1μL UPS(10μM)Primer、21μL dH₂O, 50 μ L of total reaction volume.Reaction condition: then 94 DEG C of 1min set 98 DEG C of 10sec, 55 DEG C 15sec, 68 DEG C of 60sec carry out 30 circulations.PCR product respectively takes 5 μ L to carry out 1% agarose gel electrophoresis, as a result such as Fig. 2.

3, PCR product purifies

Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code No.9762) the amplified product band of No. 2 swimming lane about 0.75kbp of gel extraction.

4, sequencing analysis

Above-mentioned PCR product (amplified product band of 0.75kbp) is sequenced using primers F 4, Fseq, sequencing slightly covers Peak needs to carry out TA cloning and sequencing.Primer sequence is as follows:

Title	Sequence (5 ' -3 ')	Length (mers)
			Fseq	GTACCTAATGGTGATCAAGC	20

5, TA cloning and sequencing

Above-mentioned PCR product (amplified product band of 0.75kbp) is used into DNA A-Tailing Kit (Code No.6109 on) after A processing, the connection in TaKaRa DNA Ligation Kit Ver.2.1 (Code No.6022) is used Enzyme, by PCR product and T-Vector pMD^TMAfter 20 (Code No.3270) connection, thermal transition to E.coli Competent In Cells JM109 (Code No.9052), spread plate, 37 DEG C are incubated overnight.It selects positive bacterium colony and plants bacterium, extract plasmid, Plasmid is sequenced using RV-M, CTG0572Fseq.Sequencing result shows: 3'RACE obtains sequence and known array is close It is related.

Three, sequence verification after RACE

1, design of primers and synthesis

2, PCR amplification

The cDNA of verifying reverse transcription uses TaKaRa Tks Gflex DNA as template before being tested using RACE Polymerase (Code No.R060A) is expanded.PCR reaction system: the inverse transcription reaction liquid verified before 1 μ L RACE, 25 μL 2×Gflex PCR Buffer(Mg²⁺, dNTP plus), 1 μ L Tks Gflex DNA Polymerase (1.25units/ μL)、1μL F5Primer(20μM)、1μL R6 Primer (20μM)、21μL dH₂O, 50 μ L of total reaction volume.React item Part: then 94 DEG C of 1min set 98 DEG C of 10sec, 60 DEG C of 15sec, 68 DEG C of 30sec and carry out 35 circulations.With above-mentioned 1stPCR product For template, F3/R7 is that primer carries out 2nd amplification, and reaction system and condition are same as above, and PCR product respectively takes 5 μ L to carry out 1% agarose Gel electrophoresis, as a result as shown in Figure 3.Electrophoresis detection the result shows that: amplify with estimated length target fragment of the same size, test It demonstrate,proves successfully.Verified 3 ' obtained RACE sequences are obtained according to known array.Obtain the end the 3' unknown nucleotide sequence of 568bp.

Four, full-length gene is cloned

It is reference with RACE result, carries out the area target gene CDS amplification (1386bp), In-Fusion is cloned into pET-28a In (+) plasmid (restriction enzyme site BamH I/Not I), 2 plasmid order-checkings are extracted.

1, design of primers and synthesis

Title	Sequence (5'-3')	Length (mers)
			F0	TCGACTAATGTAATGGCAATCA	22
R0	TTGTTGTTGTTGTTCTATTTCG	22
			InF	AATGGGTCGCGGATCCATGCGTGAATGTATATCATTAC	38
InR	TGCTCGAGTGCGGCCGCTCAAAATTCTTCACCATCCTG	38
			P1	AAAGTAAACAACATGCCATA	20

2, reverse transcription

Use TaKaRa PrimeScript^TMRT-PCR Kit (Code No.RR014A) synthesizes cDNA.It sets up just simultaneously Negative control.Reaction system: 1 μ L Total RNA, 1 μ L Random 6mers (20 μM), 1 μ L Oligo dT Primer (2.5 μ M), 1 μ L dNTP Mixture (10mM each), adds RNase Free dH₂O to 1 μ L.Reaction condition: 65 DEG C of 5min, then It sets and stands 2min on ice.Then following component: 4 μ L5 × PrimeScript RT Buffer, 0.5 μ LRNase is added Inhibitor (40U/ul), 0.5 μ LPrimeScript RTase (2 Step of for), 20 μ L of total reaction volume.Reaction condition: 30℃10min、45℃30min、70℃15min。

3, the 1st PCR amplification

Using the cDNA of above-mentioned reverse transcription as template, TaKaRa Tks Gflex DNA Polymerase (Code is used No.R060A PCR amplification) is carried out, using F0/R0 as primer.1st PCR reaction system: the above-mentioned reverse transcription cDNA of 1 μ L, 25 μ L 2 ×Gflex PCR Buffer(Mg²⁺, dNTP plus), 1 μ LTks Gflex DNA Polymerase (1.25units/ μ L), 1 μL F0(20μM)、1μL R0(20μM)、21μL dH₂O, 50 μ L of total reaction volume.Reaction condition: then 94 DEG C of 1min set 98 DEG C 10sec, 58 DEG C of 15sec, 68 DEG C of 60sec carry out 35 circulations.Reaction condition: then 94 DEG C of 1min set 98 DEG C of 10sec, 58 DEG C 15sec, 68 DEG C of 60sec carry out 35 circulations.

4, the 2nd PCR amplification

Using above-mentioned 1st PCR product as template, TaKaRa Tks Gflex DNA Polymerase (Code is used No.R060A PCR amplification) is carried out, carries out the 2nd PCR amplification by primer of InF/InR.Reaction system: 1 PCR of μ L the 1st time is produced Object, 25uL 2 × Gflex PCR Buffer (Mg²⁺, dNTPplus), 1 μ L Tks Gflex DNAPolymerase (1.25units/uL), 1 μ L primer I nF, 1 μ L primer I nR, 21uL dH₂O, total reaction volume 50uL.Reaction condition: 94 DEG C Then 1min sets 98 DEG C of 10sec, 58 DEG C of 15sec, 68 DEG C of 60sec and carries out 30 circulations.5 μ L PCR products are taken to carry out 1% agar Sugared gel electrophoresis, as a result as shown in Figure 4.

5, PCR product purifies

Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code No.9762) the amplified product band of gel extraction about 1.4kbp mesh.

6, prepared by carrier

Firstly, plasmid pET28a (+) is carried out digestion using BamH I/Not I, reaction system is as follows: 20 μ L PET28a (+) (about 50ng/ μ L), 5 μ 10 × Quick of L Cut Buffer, 1 μ L BamH I (10U/ μ L), 1uLNot I (10U/ μ L) plus dH₂O to 50 μ L.Digestion products take 10 μ L to carry out 1% agarose gel electrophoresis, as a result as shown in Figure 5.It uses TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code No.9762) gel extraction The DNA fragmentation of about 5.3kbp is named as Vector DNA.

7, In-Fusion, conversion, positive colony screening and plasmid order-checking

Use In-HD Cloning Kit (Clontech Code No.639648), by PCR product and carrier In-Fusion reaction is carried out, coupled reaction system is as follows: 2uL Vector DNA (about 50ng/ μ L), 2 μ LPCR products are (about 60ng/μL)、2μL 5×In-HD Enzyme Premix, adds dH₂O to 10 μ L.Reaction condition: 50 DEG C of 15min.

Take this each 2.5 μ L thermal transition of In-Fusion product reaction solution to E.coli Competent Cells JM109 In (Code No.9052), spread plate, 37 DEG C are incubated overnight.Select positive bacterium colony and plant bacterium, extract plasmid, using primer T7, T7terminator, P1 are sequenced, and two plasmid order-checking results comparisons are completely the same, and it is subsequent to select wherein 1 plasmid progress Protein expression assay.

Five, protein expression

Plasmid pET28a (+)-Der p 33 is transferred in Rosetta2 (DE3) plysS competent cell, to positive colony Inducing expression is carried out, while carrying out pET28a (+) empty vector control.

1, it converts

33 plasmid of pET28a (+)-Der p, 1 μ l is taken to be transferred in Competent cell Rosetta2 (DE3) plysS；Make With LB antibiotic Kana (50 μ g/ml)+Cm (34ug/ml) plate, the coating of 100 μ l conversion fluids, 37 DEG C of O/N cultures.pET28a(+) Equally operated.

2, it cultivates and induces

2.1 kinds of cultures

Picking single bacterium drops down onto 2mL LB/Kana (50 μ Lg/mL)+Cm (34uLg/mL) culture medium, 37 DEG C of O/N cultures.

2.2 main culture inductions

5mL LB/Kana (50 μ g/mL)+Cm (34 μ g/mL) culture medium, addition are added when main culture in Glass tube Kind culture 100 μ L of bacterium solution.37 DEG C of culture to OD600nm values are about 0.6.Add 33 μ l (final 1mM of 150mM IPTG IPTG it) is induced, 37 DEG C are cultivated 4 hours.Measure absorbance value: absorbance value is 0.6 before pET28a (+) is induced, before collecting bacterium Absorbance value is that absorbance value is 0.60 before 1.15, pET28a (+)-Der p 33 is induced, and absorbance value is 1.90 before collecting bacterium.

3, protein extracts

Collect the comparable thallus of 2.0OD after bacterium be added 320 μ LPBS it is suspended after carry out ultrasonic disruption, to bacterial cell disruption liquid into Row centrifuge separation (12000 × rpm, 5min).

4, extract electrophoresis

Each 8 μ L (0.05OD is suitable) of extract (holoprotein, supernatant, precipitating) is taken, 24 × SDS of μ l are added Loading Buffer, 95 DEG C are heated 10 minutes, and SDS-PAGE electrophoresis is carried out.Deposition condition；(c.c.) 25mA/ pieces, about 70 points Use gel；15%/and 10%polyacrylamide gel, after electrophoresis, CBB-R250 dyeing is decolourized using destainer. SDS-PAGE/CBB coloration result is as shown in Figure 6.

Six, 500mL pure culture

It is protected using 33 glycerol stock of pET28a (+)-Der p and carries out 500mL culture, it is pure to carry out destination protein from thallus Change.

1, kind culture

50 μ L are taken to be implanted into 10ml LB/Kana (50ug/ml)+Cm (34ug/ml) culture medium respectively in glycerol stock guarantor's sample In, 37 DEG C of O/N cultures.

2, main culture and induction

10mL kind culture bacterium solution is implanted into 500ml LB/2L Flask, 37 DEG C, 200rpm cultivates to OD600 ≈ 0.6 When, addition 100mM IPTG 5ml (final 1mM IPTG) is induced, and culture 4 hours is continued.It is centrifuged after culture, collects bacterium Body.It is centrifuged after cleaning thallus using PBS, weighs thallus weight in wet base.

Absorbance measurements

3, SDS-PAGE electrophoresis

3.1, protein extracts

Take the comparable thallus of 2.0OD be added 320 μ L PBS it is suspended after carry out ultrasonic disruption, to bacterial cell disruption liquid carry out from The heart separates (12,000 × rpm, 5min).

3.2, extract electrophoresis

8 μ L (0.05OD is suitable) of each extract (holoprotein, supernatant, precipitating) is taken, 2 μ 5 × SDS of L Loading are added Buffer, 95 DEG C are heated 10 minutes, carry out SDS-PAGE electrophoresis.

Deposition condition: 25mA/ pieces of (c.c.), about 80 points；

Use gel:12.5%polyacrylamide gel；

After electrophoresis, CBB-R250 dyeing is decolourized using destainer.

SDS-PAGE/CBB coloration result is as shown in Figure 7；Destination protein is indicated with arrow.

Seven, recombinant protein purification

1, buffer

Buffer A pH 8.0 (4 DEG C): 50mM Sodium phosphate (pH 8.0), 300mM NaCl, 5mM Imidazole；Sonication buffer/Wash buffer/4M Urea Buffer A:4M Urea, 50mMSodium Phosphate (pH 8.0), 300mM NaCl, 5 mMImidazole；4M UreaBuffer B pH 8.0(4℃): 4MUrea, 50mMSodium phosphate (pH 8.0), 300mM NaCl, 300mM Imidazole；Dialyse Buffer: TaKaRa PBS (Code No.T900), 4M Urea.

2, bacterial cell disruption

(1) thallus weight in wet base 2.23g after cultivating

(2) BufferA 40ml is added.

(3) 4 DEG C of abundant suspended, Sonication 180w, 10min.Obtain broken liquid 40ml.

(4) S18,000rpm, 30min, 4 DEG C of centrifugations obtain supernatant 40ml, precipitate 0.41g.

(5) using 40ml 4M Urea Buffer A again suspended precipitating, 40ml is obtained.

(6) 8,000rpm, 30min, 4 S2 DEG C are centrifuged, and obtain supernatant 40ml, precipitate 0.39g.

(7) S3 is filtered using 0.45 μm of 1000ml Vacuum filter/Storage bottle system, is obtained To sample 40ml.

3, column chromatographic purifying

3.1, using GE HiTrap TALON crude, 5ml TALON Superflow (Code No.28-9537-66) Column chromatographic runs.

3.2, the equilibrating of resin

Use the sterilizing MilliQ H of 10 times of column volumes₂The 4M Urea BufferA 50ml of O 50ml and 10 times of column volumes Balance resin.Flow velocity 1ml/min.

3.3, loading

Loading after 4M Urea Buffer A equilibrating, flow velocity 0.5ml/min；

Resin wash and albumen dissolution:

(1) resin wash

After protein adsorption, resin is cleaned using the 4M Urea BufferA 100ml of 20 times of column volumes.

Flow velocity 2ml/min W1:30ml W2:30ml W3:40ml.

(2) albumen dissolves out

Elution:4M Urea Buffer A:50ml, the dissolution of 4M Urea BufferB:50ml gradient.Flow velocity 2ml/ Min, Fraction 1.1ml/tube × 90tubes.

4, it collects and dialyses

Destination protein is collected, is dialysed, is repeated 3 times, sample 10.3ml after dialysis using dialysis Buffer.Dialysis Buffer:1M Urea PBS；Replacement rate: 1:1000；Dialysis membrane: SnakeSkin Dialysis Tubing 10000MWCO (Cat No.68035LotNo.MH160055)；Running gel: 12.5%SDS PAGE/ coomassie brilliant blue staining liquid dyeing；It takes Sample carries out SDS-PAGE electrophoresis after analysis, sees Fig. 7.Using 3.0 analysis software of ImageMaster 1D version to concentration after Sample carries out quantitative analysis, 10ml destination protein, concentration 0.01mg/ml, total amount 0.1mg, purity > 95%.

5、Western Blotting

By pvdf membrane, filter paper cut into respectively with gel same size, using transferring film buffer handle after, by filter paper, Pvdf membrane, gel, filter paper sequence be successively placed between transferring film instrument electrode plate, start transferring film, setting transferring film instrument parameter it is as follows: electricity Flow 25mA, transfer time 80min.

Pvdf membrane is placed in the 10ml Blockingbuffer containing 1.5%BSA, 37 DEG C lay flat 1 hour.Use dilution Penta-HisAntibody solution 5ml afterwards, carries out an antibody response 1 hour.TBST buffer (20ml) washs 2 times；It washes TBS buffer is washed to rinse 3 times.Using the HRP-Rabbit Anti-Mouse IgG antibody solution 5ml after dilution, carry out secondary Antibody response 1 hour.TBST buffer (20ml) washs 2 times；TBS buffer is washed to rinse 3 times.1ml TrueBlue Peroxidase Substrate colour developing 1min.Pvdf membrane, control are as shown in Figure 8 after colour developing.

Eight, the recombinant protein of Westernblotting detection after purification is in conjunction with serum specificity

About 1 μ g of protein sample after purification is taken, PBS Buffer is added by volume and complements to 16 μ l, 44 × SDS of μ l are added Loading Buffer, 95 DEG C are heated 10 minutes, and SDS-PAGE electrophoresis is carried out.Deposition condition；(c.c.) 25mA/ pieces, about 70 points； Use gel；12.5%polyacrylamide gel；After electrophoresis, CBB-R250 dyeing is decolourized using destainer.It will Pvdf membrane, filter paper cut into respectively with gel same size, using transferring film buffer handle after, by filter paper, pvdf membrane, gel, The sequence of filter paper is successively placed between transferring film instrument electrode plate, and setting transferring film instrument parameter is as follows: electric current 42mA, transfer time 70min. Pvdf membrane is placed in the 12ml Blocking buffer containing 1.5%BSA, 37 DEG C lay flat closing in 1 hour.It is diluted using 1:10 Serum solution 6ml afterwards, carries out an antibody response 1 hour.TBST buffer (25ml) washs 1 time；Wash the punching of TBS buffer It washes 2 times.It is small to carry out secondary antibodies reaction 1 by Ms mAb to Hu IgE (HRP) antibody-solutions 6ml after being diluted using 1:4000 When.TBST buffer (25ml) washs 1 time；TBS buffer is washed to rinse 2 times.1ml TrueBlue Peroxidase Substrate colour developing 1min.Pvdf membrane after colour developing is as shown in figure 9, positive rate 18.75% (3/16), and control group is no positive.

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.

Sequence table

<110>Wuxi City the People's Hospital

<120>a kind of 33 gene recombinant protein of house dust mite allergen Der p and its application

<141> 2018-09-30

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 460

<212> PRT

<213> D.pteronyssinus

<400> 1

Met Arg Glu Cys Ile Ser Leu His Val Gly Gln Ala Gly Val Gln Ile

1 5 10 15

Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile Gln Pro

20 25 30

Asp Gly Ile Leu Ser Pro Ile Asp Ser Thr Thr Thr Thr Glu Ser Ser

35 40 45

Leu Ser Ser Asn Asp Ser Phe Ser Thr Phe Phe Asn Glu Thr Gly Ser

50 55 60

Gly His Tyr Val Pro Arg Ser Ile Tyr Val Asp Leu Glu Pro Thr Val

65 70 75 80

Val Asp Glu Val Arg Thr Gly Glu Tyr Arg Arg Leu Phe His Pro Glu

85 90 95

Gln Leu Ile Thr Gly Lys Glu Asp Ala Ala Asn Asn Tyr Ala Arg Gly

100 105 110

His Tyr Thr Glu Gly Lys Ala Leu Ile Glu Pro Val Met Gln Arg Ile

115 120 125

Ala Lys Leu Ala Glu Gln Cys Ser Gly Leu Gln Gly Phe Leu Ile Phe

130 135 140

His Ser Phe Gly Gly Gly Thr Gly Ser Gly Phe Ser Ser Leu Leu Met

145 150 155 160

Glu Arg Leu Ser Val Glu Tyr Gly Lys Lys Ser Lys Leu Glu Phe Ala

165 170 175

Ile Tyr Pro Ala Pro Ala Ile Ser Thr Ala Val Val Glu Pro Tyr Asn

180 185 190

Ser Ile Leu Thr Thr His Asn Thr Leu Glu His Ser Asp Cys Ser Phe

195 200 205

Met Val Asp Asn Glu Ala Ile Tyr Asp Ile Cys Arg Arg Asn Leu Asn

210 215 220

Ile Glu Arg Pro Leu Tyr Met Asn Leu Asn Arg Met Ile Gly Gln Ile

225 230 235 240

Val Ser Ser Ile Thr Ala Ser Leu Arg Phe Asp Gly Ala Leu Asn Val

245 250 255

Asp Leu Thr Glu Phe Gln Thr Asn Leu Val Pro Tyr Pro Arg Ile His

260 265 270

Phe Pro Leu Val Ser Tyr Ala Pro Ile Val Ser Ser Glu Lys Ala Tyr

275 280 285

His Glu Gln Phe Ser Val Ala Glu Ile Thr Gly Thr Cys Phe Glu Pro

290 295 300

Ser Asn Gln Met Val Lys Cys Asn Thr Arg Asn Gly Lys Phe Met Ala

305 310 315 320

Cys Cys Leu Leu Tyr Arg Gly Asp Val Val Pro Lys Glu Val Asn Ala

325 330 335

Ala Ile Ala Ala Ile Lys Ala Lys Arg Thr Ile Gln Phe Val Asp Trp

340 345 350

Cys Pro Thr Gly Phe Lys Ile Gly Ile Asn Tyr Arg Pro Pro Thr Val

355 360 365

Val Pro Asn Gly Asp Gln Ala Lys Val Gln Arg Ala Val Cys Leu Leu

370 375 380

Ser Asn Thr Thr Ala Ile Ala Glu Ala Trp Ser Arg Leu Asn His Lys

385 390 395 400

Phe Asp Leu Met Tyr Ser Lys Arg Ala Phe Val His Trp Tyr Val Gly

405 410 415

Glu Gly Met Glu Glu Gly Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala

420 425 430

Ala Leu Glu Arg Asp Tyr Glu Glu Val Ala Ala Glu Tyr Asn Ala Asp

435 440 445

Asp Asp Asp Asp His Asp Gln Asp Gly Glu Glu Phe

450 455 460

<210> 2

<211> 1397

<212> DNA

<213> D.pteronyssinus

<400> 2

ggatccatgc gtgaatgtat atcattacat gttggtcaag ctggtgtaca gattggtaat 60

gcatgctggg aattatattg tcttgaacat ggaattcaac cggatggaat attatcacca 120

atcgattcaa caacaacaac agaatcatcg ttatcatcga atgattcatt ttcaacattt 180

ttcaatgaaa ctggtagcgg tcattatgta ccacgttcaa tttatgttga tcttgagcca 240

acggttgttg atgaagtacg tacaggtgaa tatcgtcgtc tatttcatcc agaacaatta 300

ataactggta aagaagatgc tgcaaataat tatgcacgtg gacattatac tgaaggcaaa 360

gcattaattg aaccagttat gcaacgtata gctaaattag ctgaacaatg ttccggttta 420

caaggatttc ttatatttca ttcatttggt ggtggtactg gatccggttt ttcatcatta 480

ttaatggaac gtttatctgt tgaatatggt aaaaaatcta aattagaatt tgccatttat 540

ccggcaccgg ctatttcaac cgctgttgtt gaaccatata attcaatatt aacaacacat 600

aatacacttg aacattcgga ttgttcattt atggtcgata atgaagctat ttatgatatt 660

tgtcgtcgta atctaaatat tgaacgtcca ttatatatga atctaaatcg tatgattgga 720

caaattgttt catcaataac agcatcatta cgttttgatg gtgcattaaa tgttgatttg 780

actgaatttc aaaccaattt agtaccatat ccacgaatac attttccatt agttagttat 840

gcaccaattg tatcaagtga aaaagcatat catgaacaat ttagtgttgc cgaaataact 900

ggtacttgtt ttgaaccatc aaatcaaatg gttaaatgta atacacgtaa tggtaaattt 960

atggcatgtt gtttacttta tcgtggtgat gttgtaccaa aagaagtgaa tgctgctatt 1020

gcagcgatta aagctaaacg tactatacaa tttgttgatt ggtgtccaac tggattcaaa 1080

atcggtatca attatcgtcc accaactgtt gtaccaaatg gtgatcaagc taaagttcaa 1140

cgtgctgttt gtttattatc aaatacaaca gctattgctg aagcatggtc aagattaaat 1200

cataaatttg atttaatgta ttcaaaacgt gcatttgttc attggtatgt tggtgaaggt 1260

atggaagaag gtgaatttag tgaagcacgt gaagatttag ctgcacttga acgtgattat 1320

gaagaagtgg ctgccgaata taatgccgat gatgatgatg atcatgatca ggatggtgaa 1380

gaattttgag cggccgc 1397

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 3

tcgtcgtcta tttcatccag 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 4

accattacgt gtattacatt 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

tgaacaatgt tccggtttac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

aagtaccagt tatttcggca 20

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 7

catttatggt cgataatgaa gc 22

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 8

catcaataac agcatcatta cg 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 9

gtacctaatg gtgatcaagc 20

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 10

ccggctattt caaccgctgt tg 22

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 11

atcatcggca ttatattcgg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 12

tccatacctt caccaacata 20

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 13

tcgactaatg taatggcaat ca 22

<210> 14

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 14

ttgttgttgt tgttctattt cg 22

<210> 15

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 15

aatgggtcgc ggatccatgc gtgaatgtat atcattac 38

<210> 16

<211> 38

<212> DNA

<213> Artificial Sequence

<400> 16

tgctcgagtg cggccgctca aaattcttca ccatcctg 38

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 17

aaagtaaaca acatgccata 20

Claims

1. a kind of 33 gene recombinant protein of house dust mite allergen Derp, which is characterized in that the protein sequence such as SEQ ID NO:1 It is shown.

2. 33 gene recombinant protein of house dust mite allergen Derp described in claim 1 is preparing accurate medicine detection dermatophagoides pteronyssinus The diagnostic reagent of caused anaphylactia or the application in terms of biological products.

3. application as claimed in claim 2, which is characterized in that the diagnostic reagent or biological products are house dust mite allergen 33 gene of Derp includes house dust mite allergen through expression, recombinant protein after purification or the diagnostic reagent or biological products 33 gene of Derp is through expression, recombinant protein after purification.