CN109265530A - A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application - Google Patents
A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application Download PDFInfo
- Publication number
- CN109265530A CN109265530A CN201811177227.8A CN201811177227A CN109265530A CN 109265530 A CN109265530 A CN 109265530A CN 201811177227 A CN201811177227 A CN 201811177227A CN 109265530 A CN109265530 A CN 109265530A
- Authority
- CN
- China
- Prior art keywords
- recombinant protein
- dust mite
- gene
- der
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43531—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/43504—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates
- G01N2333/43552—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from insects
- G01N2333/43582—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from invertebrates from insects from mites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/24—Immunology or allergic disorders
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Insects & Arthropods (AREA)
- Organic Chemistry (AREA)
- Hematology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of 29 gene recombinant protein of house dust mite allergen Der p and its applications.After the present invention is sequenced by transcript profile, carry out sequence alignment, obtain the sequence an of segment Yu 29 very high homology of dust mite Der f, the segment is expanded to come, then gene cloning and expression purifying is carried out, the protein of purifying and dermatophagoides pteronyssinus allergic patients sera are subjected to Western blotting, it is found that the protein of the fragment coding has the activity of height, the recombinant protein sequence is as shown in SEQ ID NO:1.29 gene order of dermatophagoides pteronyssinus Der p is obtained into its recombinant protein by gene cloning, expression, purifying, the recombinant protein is for allergic asthma infant caused by Western blotting experiment precisely 16 dermatophagoides pteronyssinus of detection, positive rate 100%, and control group is no positive.
Description
Technical field
The invention belongs to gene engineering technology field more particularly to a kind of 29 genetic recombination eggs of house dust mite allergen Der p
Its application of bletilla.
Background technique
Common dust mite includes two kinds, and one kind is named dust mite (Dermatophagoides farinae), and another kind is room dirt
Mite (Dermatophagoides pteronyssinus).Dermatophagoides pteronyssinus and dust mite can cause anaphylactia, previous literature
Show that dust mite positive rate is 59.0%, dermatophagoides pteronyssinus positive rate is 57.6%, illustrates dermatophagoides pteronyssinus and dust mite is two different
Sensitization mite kind.
As a kind of biology, every kind of mite body contains thousands of kinds of albumen, has plenty of anaphylactogen, some not sensitization bodies.It has demonstrate,proved
In real dust mite crude extract containing multiple components can with human serum IgE antibody ining conjunction with, but disease because may with it is therein certain
Or certain compositions are related, these compositions are called " component (Groups) ".So far, reagent for clinical diagnosis is all made of dust mite crude extract.
Due to having cross reaction between different mite kinds, dust mite and cockroach, pollen etc. also have cross reaction, therefore using thick
Extract, which carries out diagnosis, can cause mistaken diagnosis, side reaction.Moreover, because same component exists containing there are many allergenic components in crude extract
Content is inhomogenous in different batches of product, it is difficult to realize the standardization of product.Therefore, it is necessary to understand the anaphylactogen of every kind of mite at
Part, anaphylactogen one-component recombinant protein is prepared, detection dust mite slightly proposes immersion liquid skin test positive patient blood serum special IgE content, from
And can clearly cause the anaphylactogen one-component of body sensitization, it lays the foundation for precisely detection anaphylactia, is worked out to be clinical
Accurate desensitization treatment scheme provides foundation.
GenBank has issued for former 29th component (Der f29) gene order of dust mite allergy, the 29th component of dermatophagoides pteronyssinus
But there are no announcements, but former 29th component of dust mite allergy can not but substitute the 29th component of house dust mite allergen, this is because
Even if the two has certain sequence similar, even if but only 1 amino acid of difference can also cause clinical misdiagnosis, and it is still more not
With the protein between species with similar sequences.
Summary of the invention
The purpose of the present invention is to provide a kind of 29 gene recombinant protein of house dust mite allergen Der p and its applications, it is intended to
Solve the problems, such as that anaphylactia caused by existing dust mite is unable to get accurate medicine detection.
The invention is realized in this way a kind of 29 gene recombinant protein of house dust mite allergen Der p, the sequence of the gene
As shown in SEQ ID NO:1.
The present invention further discloses above-mentioned 29 gene recombinant proteins of house dust mite allergen Der p to be used to prepare precisely
The diagnostic reagent or the application in terms of biological products that medicine detects anaphylactia caused by dermatophagoides pteronyssinus.
Preferably, the diagnostic reagent or biological products are that 29 gene of house dust mite allergen Der p is expressed, after purification
Recombinant protein or the diagnostic reagent or biological products include that 29 gene of house dust mite allergen Der p is expressed, purified
Recombinant protein afterwards.
The present invention overcome the deficiencies of the prior art and provide a kind of 29 gene recombinant protein of house dust mite allergen Der p and its
Using.After the present invention is sequenced by transcript profile, sequence alignment is carried out, a segment and dust mite Der f29 very high homology are obtained
Sequence, by the segment expand come, then carry out gene cloning and expression purifying, by the protein of purifying and dermatophagoides pteronyssinus autopath
Serum carries out Western blotting, it is found that the protein of the fragment coding has the activity of height, and finally determine the sequence
29 coding gene sequence of house dust mite allergen Der p is classified as shown in SEQ ID NO:2 and house dust mite allergen Der p
29 gene recombinant protein sequences are as shown in SEQ ID NO:1.
Compared with prior art the shortcomings that and deficiency, the invention has the following advantages: present invention firstly discovers that dermatophagoides pteronyssinus
29 gene order of Der p, and its recombinant protein is obtained by gene cloning, expression, purifying, which is used for Western
The accurate medicine of blotting testing detects allergic asthma infant caused by 16 dermatophagoides pteronyssinus, positive rate 100%, and control group without
It is positive.
Detailed description of the invention
Fig. 1 is dermatophagoides pteronyssinus Total RNA electrophoretogram (1% agarose)；Wherein, swimming lane M is DL2000DNA Marker, swimming
Road 1 is dermatophagoides pteronyssinus Total RNA；
Fig. 2 is to carry out the postdigestive electrophoresis knot of DNaseI to dermatophagoides pteronyssinus Total RNA using Recombinant DNase I
Fruit figure；Wherein, swimming lane M1 is DL2000DNA Marker, and swimming lane 1 is Total RNA-XH after purification；
Fig. 3 is pcr amplification product agarose gel electrophoresis figure；Wherein, swimming lane M is DL2000DNA Marker, and swimming lane 1 is
Pcr amplification product；
Fig. 4 is 29 plasmid expression SDS-PAGE image of pET28 (a)-Der p；Wherein, swimming lane M is Protein MW
Marker (Broad), swimming lane 1 are that pET28 (a) empty plasmid converts the full cell after Escherichia coli, and swimming lane 2 is the empty matter of pET28 (a)
Supernatant after grain conversion Escherichia coli, swimming lane 3 are that pET28 (a) empty plasmid converts the precipitating after Escherichia coli, and swimming lane 4 is pET28
(a) the full cell after 29 plasmid of-Der p conversion Escherichia coli, swimming lane 5 are that 29 plasmid of pET28 (a)-Der p converts large intestine bar
Supernatant after bacterium, swimming lane 6 are that 29 plasmid of pET28 (a)-Der p converts the precipitating after Escherichia coli；
Fig. 5 is the 500ml expression SDS-PAGE image after the conversion of 29 plasmid of pET28 (a)-Der p；Wherein, swimming lane M is
Protein MW marker (Broad), swimming lane 1 are that 29 plasmid of pET28 (a)-Der p converts the full cell after Escherichia coli,
Swimming lane 2 is that 29 plasmid of pET28 (a)-Der p converts the supernatant after Escherichia coli, and swimming lane 3 is 29 plasmid of pET28 (a)-Der p
Precipitating after converting Escherichia coli；
Fig. 6 is SDS-PAGE verifying 29 affinitive layer purification result of recombinant protein rDer p, wherein swimming lane M is
Protein MW marker (Broad), swimming lane 1~10 are to be purified the recombinant protein rDer p 29 for being collected into each pipe, swimming
Road BSA is the albumen of control；
It is that secondary antibody is roared by Western-blotting detection dermatophagoides pteronyssinus anaphylaxis that Fig. 7, which is with recombinant protein rDer p 29,
Breathe heavily infant SERUM IgE Percentage bound.
Specific embodiment
In order to make the objectives, technical solutions, and advantages of the present invention clearer, with reference to the accompanying drawings and embodiments, right
The present invention is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, and
It is not used in the restriction present invention.
One, Total RNA is extracted
Client's dermatophagoides pteronyssinus is subjected to Total RNA extraction using RNAiso Plus (Code No.9108), 1ul is taken to carry out
1% agarose gel electrophoresis, as a result as shown in Figure 1.
Two, target gene obtains
2.1, design of primers and synthesis
1 design primer of table
| Title | Sequence (5'-3') | Length (mers) |
| F1 | AATATCTACGCGGTTTGTGTTTGA | 24 |
| F2 | TAATCATCATCATTCTTATCATCG | 24 |
| R1 | TTTTTCGGAAGGATATATTGAGTT | 24 |
2.2, reverse transcription
Use TaKaRa PrimeScriptTMRT-PCR Kit (Code No.RR014A) synthesizes cDNA.It sets up just simultaneously
Negative control.Reaction system: 1 μ L Total RNA, 1 μ L Random 6mers (20 μM), 1 μ L Oligo dT Primer (2.5 μ
M), 1 μ L dNTP Mixture (10mM each), adds RNase Free dH2O to 10 μ L.Reaction condition: 65 DEG C are set 5min, so
Stand 2min on ice afterwards.Then following component: 4 μ L 5x PrimeScript RT Buffer, 0.5 μ L RNase is added
Inhibitor (40U/ul), 0.5 μ LPrimeScript RTase (for 2Step), 20 μ L of total reaction volume.Reaction condition:
30℃10min、45℃30min、70℃15min。
2.3, the 1st PCR amplification
Using the cDNA of above-mentioned reverse transcription as template, TaKaRa Tks Gflex DNA Polymerase (Code is used
No.R060A PCR amplification) is carried out, respectively using F1/R1 as primer.Reaction system: 1 μ L reverse transcription cDNA, 25 2 × Gflex of μ L
PCR Buffer(Mg2+, dNTP plus), 1 μ LTks Gflex DNA Polymerase (1.25units/ μ l), 1 μ
LPrimer*1(20uM)(F1)、1μLPrimer*2(20μM)(R1)、21μL dH2O, 50 μ L of total reaction volume.Reaction condition: 94
Then DEG C 1min sets 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 60sec and carries out 35 circulations.
2.4, the 2nd PCR amplification
With the 1st PCR product amplification for template, TaKaRa Tks Gflex DNA Polymerase (Code is used
No.R060A PCR amplification) is carried out, the 2nd PCR amplification is carried out with F2/R1 respectively, reaction system: 1 μ L reverse transcription cDNA, 25 μ L2
×Gflex PCR Buffer(Mg2+, dNTP plus), 1 μ L Tks Gflex DNA Polymerase (1.25units/ul),
1μL Primer*1(20μM)(F2)、1μLPrimer*2(20μM)(R1)、21μL dH2O, 50 μ L of total reaction volume.Reaction condition:
Then 94 DEG C of 1min set 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 60sec and carry out 30 circulations.
2.5, PCR product purifies
Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code
No.9762) gel extraction, product about 0.6kbp are named as PCR-product respectively.
2.6, sequencing analysis
PCR-product is sequenced using primers F 2, sequencing result and the 29th component of dust mite (Der f 29) gene
Sequence alignment has similitude.
Analysis: analyzed according to sequencing result: the sequence of acquisition has the possibility from DNA, and trial carries out Total RNA
After DNaseI digestion, then carries out target gene and obtain verifying.
Three, Total RNA digests
Using Recombinant DNase I (RNase Free) (Code No.2270A) to dermatophagoides pteronyssinus Total RNA into
Row DNaseI digestion, as a result as shown in Figure 2.
Four, target gene obtains (the 2nd time)
4.1, reverse transcription
Use TaKaRa PrimeScriptTMRT-PCR Kit (Code No.RR014A) synthesizes cDNA.It sets up just simultaneously
Negative control.1μL Total RNA,1μL Random 6mers(20μM),1μL Oligo dT Primer(2.5μM),1μL
DNTP Mixture (10mM each), adds RNase Free dH2O to 10 μ L.Reaction condition: 65 DEG C are set 5min, then on ice
Stand 2min.Then following component: 4 μ 5 × PrimeScript of L RT Buffer, 0.5 μ L RNase Inhibitor is added
(40U/ μ l), 0.5 μ L PrimeScript RTase, 20 μ L of total reaction volume.Reaction condition: 30 DEG C of 10min, 45 DEG C of 30min,
70℃15min。
4.2, the 1st PCR amplification
Using the cDNA of above-mentioned reverse transcription as template, TaKaRa Tks Gflex DNA Polymerase (Code is used
No.R060A PCR amplification) is carried out, respectively using F1/R1 as primer.Reaction system: 1 μ L reverse transcription cDNA, 25 μ L2 × Gflex
PCR Buffer(Mg2+, dNTP plus), 1 μ LTks Gflex DNA Polymerase (1.25units/ μ l), 1 μ L
Primer*1(20uM)(F1)、1μLPrimer*2(20uM)(R1)、21dH2O, 50 μ L of total reaction volume.Reaction condition: 94 DEG C
Then 1min sets 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 60sec and carries out 35 circulations.
4.3, the 2nd PCR amplification
With the 1st PCR product amplification for template, TaKaRa Tks Gflex DNA Polymerase (Code is used
No.R060A PCR amplification) is carried out, carries out the 2nd PCR amplification by primer of F2/R1 respectively, reaction system: 1 μ L reverse transcription
cDNA、25μL2×Gflex PCR Buffer(Mg2+, dNTP plus), 1 μ LTks Gflex DNA Polymerase
(1.25units/ul)、1μLPrimer*1(20μM)(F2)、1μLPrimer*2(20μM)(R1)、21μL dH2O, total reaction volume
50μL.Reaction condition: then 94 DEG C of 1min set 98 DEG C of 10sec, 55 DEG C of 15sec, 68 DEG C of 60sec and carry out 30 circulations.
Electrophoresis detection the result shows that: using by the postdigestive Total RNA of DNase I as template, RT-PCR expands to obtain
29 genetic fragment of Der p shows from RNA.
4.4, PCR product purifies
Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code
No.9762) gel extraction PCR product, the band of about 0.4kbp.
4.5, sequencing analysis
PCR product is sequenced using primer R1, sequencing result and reference sequences compare unanimously.
Five, full-length gene is cloned
Target gene Der p 29 is cloned into pET-28a (+) plasmid, 2 plasmid order-checkings are extracted.
5.1, design of primers and synthesis
2 design primer of table
5.2, PCR amplification
Using above-mentioned PCR product as template, TaKaRa Tks Gflex DNA Polymerase (Code is used
No.R060A PCR amplification) is carried out.Reaction system: 1 μ L PCR product, 25 μ L 2 × Gflex PCR Buffer (Mg2+, dNTP
plus)、1μL Tks Gflex DNA Polymerase(1.25units/μL)、1μL Primer*1(20μM)(InF)、1μ
LPrimer*2(20μM)(InR)、21μL dH2O, 50 μ L of total reaction volume.Reaction condition: then 94 DEG C of 1min set 98 DEG C
10sec, 55 DEG C of 15sec, 68 DEG C of 60sec carry out 35 circulations.5 μ LPCR products are taken to carry out 1% agarose gel electrophoresis, as a result
As shown in Figure 3.
5.3, PCR product purifies
Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (Code
No.9762) the amplified product band of difference gel extraction PCR product about 0.4kbp, is named as Insert.
5.4, carrier preparation
Plasmid pET28a (+) is subjected to digestion, reaction system: 10 μ L pET28a (+) (50ng/ μ using BamH I/NotI
L), 5 μ L 10 × Quick CutBuffer, 1 μ L BamH I (10U/ul), 1 μ L Not I (10U/ul), add dH2O to 50 μ L.
Reaction condition: 37 DEG C 2 hours.10 μ L are taken to carry out 1% agarose gel electrophoresis.Use TaKaRa MiniBEST Agarose
The DNA fragmentation of Gel DNA Extraction KitVer.4.0 (Code No.9762) gel extraction about 5.3kbp, is named as
Vector DNA。
5.5, In-Fusion clone, conversion, positive colony screening and plasmid order-checking
It usesHD Cloning Kit (Clontech Code No.639650), respectively by Insert with
Vector DNA connection, reaction system are as follows: 3 μ L Vector DNA (about 50ng/ul), 3 μ L CTG0579-Insert are (about
50ng/ μ L), 2 μ L 5 × In-Fusion HD Enzyme Premix, add dH2O to 10 μ L.Reaction condition: 50 DEG C of 15min.
Take each 2.5 μ L thermal transition of above-mentioned In-Fusion connection product to E.coli Competent Cells respectively
In JM109 (Code No.9052), spread plate, 37 DEG C are incubated overnight.It selects positive bacterium colony and plants bacterium, extract plasmid；Using drawing
2 plasmids are sequenced in object T7, and sequence is surveyed logical.Sequencing result and PCR product sequencing are consistent, after selecting 1 plasmid to carry out
Continuous protein expression assay.
Six, destination protein is expressed
Plasmid is transferred in Rosetta2 (DE3) plysS competent cell, inducing expression is carried out to positive colony, simultaneously
Carry out pET-28a empty vector control.
6.1, it converts
29 plasmid of pET28 (a)-Der p, 1 μ L is taken to be transferred in Competent cell Rosetta2 (DE3) plysS；Make
With LB antibiotic Kana (50 μ g/mL)+Cm (34 μ g/mL) plate, the coating of 100ul conversion fluid, 37 DEG C of O/N cultures.PET-28a into
The same operation of row.
6.2, it cultivates and induces
6.2.1, kind culture
Picking single bacterium drops down onto 2ml LB/Kana (50 μ g/ml)+Cm (34 μ g/ml) culture medium, 37 DEG C of O/N cultures.
6.2.2, main culture induction
5ml LB/Kana (50ug/ml)+Cm (34ug/ml) culture medium, addition are added when main culture in Glass tube
Kind culture 100 μ l of bacterium solution.37 DEG C of culture to OD600nm values are about 0.6.Add 33 μ L (final 1mM of 150mM IPTG
IPTG it) is induced, 37 DEG C are cultivated 4 hours.Absorbance value is 0.60 before pET-28a is induced, and absorbance value is 1.35 before collecting bacterium；
Absorbance value is 0.60 before the Escherichia coli of 29 plasmid of pET28 (a)-Der p conversion induce, and absorbance value is 2.20 before collecting bacterium.
6.2.3, protein extracting
Collect the comparable thallus of 2.0OD after bacterium be added 320 μ lPBS it is suspended after carry out ultrasonic disruption, to bacterial cell disruption liquid into
Row centrifuge separation (12,000 × rpm, 5min).
6.2.4, extract electrophoresis
8 μ L (0.05OD is suitable) of each extract (holoprotein, supernatant, precipitating) is taken, 2 μ 4 × SDS of L Loading are added
Buffer, 95 DEG C are heated 10 minutes, carry out SDS-PAGE electrophoresis.Deposition condition: 25mA/ pieces of (c.c.), about 70 points, gel is used；
12.5%/15%polyacrylamide gel.After electrophoresis, CBB-R250 dyeing is decolourized using destainer.SDS-
PAGE/CBB coloration result is as shown in Figure 4.Target gene has expression in 37 DEG C of inducible systems of pET-28a, and essentially solvable
Property expression.
Seven, 500mL mass propgation
It is protected using 29 plasmid glycerol stock of pET28 (a)-Der p and carries out 500ml culture, to carry out destination protein from thallus
Purifying.
7.1, kind culture
50 μ l are taken to be implanted into 10ml LB/Kana (50ug/ml)+Cm (34ug/ml) culture medium respectively in glycerol stock guarantor's sample
In, 37 DEG C of O/N cultures.
7.2, main culture and induction
10ml kind culture bacterium solution is implanted into 500ml LB/2L Flask, 37 DEG C, 200rpm cultivates to OD600 ≈ 0.6
When, addition 100mM IPTG 5ml (final 1mM IPTG) is induced, and absorbance value is 0.60 before inducing, and collects extinction before bacterium
Angle value is 3.35, continues culture 4 hours.It is centrifuged after culture, collects thallus.It is centrifuged after cleaning thallus using PBS, it is wet to weigh thallus
Weight 2.20g.Absorbance measurement is as shown in table 3 below:
7.3, SDS-PAGE electrophoresis
(1) protein extracts
Take the comparable thallus of 2.0OD be added 320ul PBS it is suspended after carry out ultrasonic disruption, to bacterial cell disruption liquid carry out from
The heart separates (12,000 × rpm, 5min).
(2) extract electrophoresis
8 μ l (0.05OD is suitable) of each extract (holoprotein, supernatant, precipitating) is taken, 2 μ 5 × SDS of l Loading are added
Buffer, 95 DEG C are heated 10 minutes, carry out SDS-PAGE electrophoresis.Deposition condition: 25mA/ pieces of (c.c.), about 80 points, gel is used；
12.5%polyacrylamide gel.After electrophoresis, CBB-R250 dyeing is decolourized using destainer.SDS-PAGE/CBB
Coloration result is as shown in figure 5, destination protein is indicated with arrow.
Eight, recombinant protein purification
8.1, buffer
Sonication buffer/Wash buffer/Buffer A pH 8.0(4℃)
50mM Sodium phosphate pH 8.0
300mM NaCl
5mM Imidazole
BufferB pH 8.0(4℃)
50mM Sodium phosphate pH 8.0
300mM NaCl
300mM Imidazole
It dialyses Buffer:TaKaRa PBS (Code No.T900)
8.2, bacterial cell disruption
(1) thallus weight in wet base 2.2g after cultivating
(2) Sonication buffer 25ml is added.
(3) 4 DEG C of abundant suspended, Sonication 180w, 10min.Broken liquid 27ml.
(4) S112,000rpm, 30min, 4 DEG C of centrifugations obtain supernatant 27ml, precipitate 0.3g.
(5) S2 is filtered using 0.45 μm of 1000ml Vacuum filter/Storage bottle system, is obtained
To sample 27ml；
8.3, column chromatographic purifying
(1) GE HiTrap TALON crude, 5ml TALON Superflow (Code No.28-9537-66) is used
Column chromatographic runs；
(2) equilibrating of resin
Use the sterilizing MilliQ H of 10 times of column volumes2The Buffer A 50ml balanced tree of O 50ml and 10 times of column volumes
Rouge, flow velocity 1ml/min；
(3) loading
Loading after BufferA equilibrating, flow velocity 0.5ml/min；
(4) resin wash and albumen dissolution
1. resin wash
After protein adsorption, resin is cleaned using the BufferA of 10 times of column volumes, 50ml；
Flow velocity 1ml/min, W1:10ml, W2:20ml, W3:20ml.
2. albumen dissolves out
Elution:BufferA:50ml, BufferB:50ml, gradient dissolution, flow velocity 1ml/min, Fraction
1.1ml/tube×90tubes。
8.4, it collects
It collects destination protein and amounts to about 11 ml.Take a small amount of progress SDS-PAGE electrophoresis and with BSA standard concentration for ginseng
It examines.Running gel: the dyeing of 12.5%SDS PAGE/ coomassie brilliant blue staining liquid, as a result as shown in Figure 6, wherein swimming lane M is
Protein MW marker (Broad), swimming lane 1 are 29 recombinant protein of rDer p, 2.0 μ L loading, and swimming lane 2 is 29 weight of rDer p
Histone 4 .0ul loading, swimming lane 3 are BSA200ng, and swimming lane 4 is BSA 400ng, and swimming lane 5 is BSA 600ng, and swimming lane 6 is BSA
800ng, swimming lane 7 are BSA 1000ng.
8.5, it dialyses
Buffer dialysis is carried out using PBS, is repeated 3 times.Dialyse Buffer:PBS；Replacement rate: 1:1000；Dialysis
Film: 10000 MWCO of SnakeSkin Dialysis Tubing (Cat No.68035 Lot No.MH160055).It uses
ImageMaster 1D version 3.0 parses soft and carries out quantitative analysis to sample after concentration, as a result as shown in table 4 below:
4 quantitative analysis results of table
Nine, the recombinant protein of Western blotting detection after purification is in conjunction with serum specificity
9.1, Western blotting sample electrophoresis compares
Take about 1 ug of protein sample after purification, PBS Buffer be added by volume and complements to 16ul, be added 4 ul 4 ×
SDS Loading Buffer, 95 DEG C are heated 10 minutes, and SDS-PAGE electrophoresis is carried out.Deposition condition；(c.c.) 25mA/ pieces, about
70 points；Use gel；12.5%polyacrylamide gel；After electrophoresis, CBB-R250 dyeing is decolourized using destainer.
9.2、Western Blotting
By pvdf membrane, filter paper cut into respectively with gel same size, using transferring film buffer handle after, by filter paper,
Pvdf membrane, gel, filter paper sequence be successively placed between transferring film instrument electrode plate, setting transferring film instrument parameter it is as follows: 42 mA of electric current,
Transfer time 70min.Pvdf membrane is placed in the 12ml Blocking buffer containing 1.5%BSA, 37 DEG C lay flat 1 hour envelope
It closes.Serum solution 6ml after being diluted using 1:10, carries out an antibody response 1 hour.TBST buffer (25ml) washs 1 time；
TBS buffer is washed to rinse 2 times.Use 1；Ms mAb to Hu IgE (HRP) antibody-solutions 6ml after 4000 dilutions, carries out
Secondary antibodies are reacted 1 hour.TBST buffer (25ml) washs 1 time；TBS buffer is washed to rinse 2 times.1ml TrueBlue
Peroxidase Substrate colour developing 1min.Pvdf membrane after colour developing is as shown in fig. 7, as seen from Figure 7, the recombinant protein is positive
Property rate be 100%.
Ten, recombinant protein rDer p 29 detects the SERUM IgE positive reaction of dermatophagoides pteronyssinus allergic asthma infant
As a result as shown in table 6 below:
The application of table 6 recombinant protein rDer p 29 detects dermatophagoides pteronyssinus allergic asthma infant SERUM IgE positive reaction rate
Note: a01-17 is dermatophagoides pteronyssinus allergic asthma/rhinitis infant, and UniCAP is detected to dust mite allergy；B01-04 is strong
Health normal person, UniCAP detect it to dust mite not allergy."+" is positive to recombinant protein rDer p 29, and "-" is to recombinant protein
RDer p 29 is negative.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all in essence of the invention
Made any modifications, equivalent replacements, and improvements etc., should all be included in the protection scope of the present invention within mind and principle.
Sequence table
<110>Wuxi City the People's Hospital
<120>a kind of 29 gene recombinant protein of house dust mite allergen Der p and its application
<141> 2018-09-30
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 130
<212> PRT
<213> Dermatophagoides pteronyssinus
<400> 1
Met Ser Trp Gln Ser Tyr Val Asp Asn Gln Ile Cys Gln His Val Asp
1 5 10 15
Cys Thr Leu Ala Ala Ile Ala Asn Ile Gln Asp Gly Ser Ile Trp Ala
20 25 30
Lys Phe Glu Lys Asp Asp Lys Lys Ile Ser Pro Lys Glu Leu Lys Thr
35 40 45
Ile Ala Asp Thr Ile Arg Gln Asn Pro Asn Gly Phe Leu Glu Thr Gly
50 55 60
Ile His Ile Gly Gly Glu Lys Tyr Ile Cys Ile Gln Ala Asp Asn Gln
65 70 75 80
Leu Val Arg Gly Arg Arg Gly Ser Ser Ala Leu Cys Ile Val Ala Thr
85 90 95
Asn Thr Cys Leu Leu Ala Ala Ala Thr Val Asp Gly Tyr Pro Ala Gly
100 105 110
Gln Leu Asn Asn Val Ile Glu Lys Leu Gly Asp Tyr Leu Arg Ser Asn
115 120 125
Asn Tyr
130
<210> 2
<211> 407
<212> DNA
<213> Dermatophagoides pteronyssinus
<400> 2
ggatccatgt cttggcaatc atatgtcgat aatcaaatct gccaacatgt tgattgtacg 60
cttgctgcta tagccaatat tcaagatggt tctatttggg ccaaatttga aaaagatgat 120
aaaaagatca gtccaaaaga attgaaaaca attgccgata caattagaca gaatccaaat 180
ggatttttag aaaccggtat acatattggt ggtgaaaaat atatttgtat tcaagctgat 240
aatcaattgg tacgtggtcg tcgtggttca tcagcattgt gtatcgttgc aaccaataca 300
tgccttttag cggccgcaac agtcgatggt tatccggctg gacaacttaa taatgttatt 360
gaaaaattgg gtgattattt gagatccaat aattattgag cggccgc 407
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 3
aatatctacg cggtttgtgt ttga 24
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 4
taatcatcat cattcttatc atcg 24
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 5
tttttcggaa ggatatattg agtt 24
<210> 6
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 6
aatgggtcgc ggatccatgt cttggcaatc atatgtc 37
<210> 7
<211> 38
<212> DNA
<213> Artificial Sequence
<400> 7
tgctcgagtg cggccgctca ataattattg gatctcaa 38
Claims (3)
1. a kind of 29 gene recombinant protein of house dust mite allergen Derp, which is characterized in that the sequence of the recombinant protein such as SEQ ID
Shown in NO:1.
2. 29 gene recombinant protein of house dust mite allergen Derp described in claim 1 is being used to prepare accurate medicine detection room
The diagnostic reagent of anaphylactia caused by dust mite or the application in terms of biological products.
3. application as claimed in claim 2, which is characterized in that the diagnostic reagent or biological products are house dust mite allergen
29 gene of Derp includes house dust mite allergen through expression, recombinant protein after purification or the diagnostic reagent or biological products
29 gene of Derp is through expression, recombinant protein after purification.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811177227.8A CN109265530A (en) | 2018-10-10 | 2018-10-10 | A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application |
| PCT/CN2019/085831 WO2020073645A1 (en) | 2018-10-10 | 2019-05-07 | Dermatophagoides pteronyssinus allergen der p 29 gene recombinant protein and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811177227.8A CN109265530A (en) | 2018-10-10 | 2018-10-10 | A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109265530A true CN109265530A (en) | 2019-01-25 |
Family
ID=65196855
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811177227.8A Pending CN109265530A (en) | 2018-10-10 | 2018-10-10 | A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109265530A (en) |
| WO (1) | WO2020073645A1 (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894089A (en) * | 2015-03-27 | 2015-09-09 | 深圳大学 | Dust mite allergen and application thereof |
| WO2018121637A1 (en) * | 2016-12-31 | 2018-07-05 | 江苏众红生物工程创药研究院有限公司 | Recombinant group 1 allergen protein from dermatophagoides pteronyssinus, and preparation method and application thereof |
| CN108892716A (en) * | 2018-06-12 | 2018-11-27 | 刘志刚 | Dermatophagoides pteronyssinus allergen Der p 29 and its preparation method and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2388268A1 (en) * | 2010-05-18 | 2011-11-23 | Stallergenes S.A. | Recombinant Der p 2 expressed in Pichia pastoris as a "natural-like" allergen for immunotherapy and diagnostic purposes |
| US20130302338A1 (en) * | 2012-05-14 | 2013-11-14 | Promd Biotech. Co., Ltd. | Dermatophagoid pteronyssinus (der p1) antigen epitope and anti-der p1 antibody |
-
2018
- 2018-10-10 CN CN201811177227.8A patent/CN109265530A/en active Pending
-
2019
- 2019-05-07 WO PCT/CN2019/085831 patent/WO2020073645A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104894089A (en) * | 2015-03-27 | 2015-09-09 | 深圳大学 | Dust mite allergen and application thereof |
| WO2018121637A1 (en) * | 2016-12-31 | 2018-07-05 | 江苏众红生物工程创药研究院有限公司 | Recombinant group 1 allergen protein from dermatophagoides pteronyssinus, and preparation method and application thereof |
| CN108892716A (en) * | 2018-06-12 | 2018-11-27 | 刘志刚 | Dermatophagoides pteronyssinus allergen Der p 29 and its preparation method and application |
Non-Patent Citations (7)
| Title |
|---|
| CONGLI JIANG ET AL.: "Characterization of Der f 29, a new allergen from dermatophagoides farina", 《AM J TRANSL RES.》 * |
| GENBANK: AIO08866.1: "Der f 29 allergen [Dermatophagoides farinae]", 《GENBANK-PROTEIN》 * |
| GENBANK: AUX14776.1: "Der f 29-like protein [Dermatophagoides pteronyssinus]", 《NCBI-NUCLEOTIDE》 * |
| XIAO-YU LIU ET AL.: "High-quality assembly of Dermatophagoides pteronyssinus genome and transcriptome reveals a wide range of novel allergens", 《J ALLERGY CLIN IMMUNOL》 * |
| YUBAO CUI ET AL.: "Consideration of methods for identifying mite allergens", 《CLIN TRANSL ALLERGY》 * |
| YU-BAO CUI ET AL.: "Expression, cloning, and IgE-binding of the full-length dust mite allergen Der f 8", 《IMMUNOL RES》 * |
| 周鹰 等: "粉尘螨变应原第10组分基因克隆表达及生物信息学分析", 《中国免疫学杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020073645A1 (en) | 2020-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106967696B (en) | Allergen of artemisia pollen and application thereof | |
| CN111398581B (en) | COVID-19 rapid diagnosis kit and preparation method thereof | |
| CN107533066A (en) | Mk system, particularly for baculovirus expression subunit antigen Mk system | |
| CN110244048A (en) | Application of the SERPING1 albumen as marker in exploitation diagnostic activities reagent lungy | |
| CN108314710B (en) | Mycoplasma pneumoniae recombinant antigen and application thereof | |
| CN106350522A (en) | Gene cloning and expression purification for recently found allergen of tyrophagus putrescentiae and application thereof | |
| CN108126190A (en) | The preparation and application of mycobacteriophage lyases Lysin-Guo1 | |
| CN107304231B (en) | Mycobacterium tuberculosis fusion protein and application thereof | |
| US5869288A (en) | Molecular cloning of cockroach allergens, amino acid and nucleotide sequences therefore and recombinant expression thereof | |
| CN108828235A (en) | Application of the PGLYRP1 albumen as marker in diagnostic activities tuberculosis | |
| CN109134638A (en) | A kind of 22 gene recombinant protein of house dust mite allergen Der p and its application | |
| CN102307894B (en) | A variant of mite allergen and uses thereof | |
| CN110746496B (en) | PAL recombinant protein of Acinetobacter baumannii, encoding gene thereof and application of PAL recombinant protein and encoding gene | |
| US5254459A (en) | Nucleotide and amino acid sequences of protein MTP40 of M. tuberculosis and synthetic peptides derived therefrom | |
| CN109265530A (en) | A kind of 29 gene recombinant protein of house dust mite allergen Der p and its application | |
| CN109265529A (en) | A kind of 33 gene recombinant protein of house dust mite allergen Der p and its application | |
| CN109061191A (en) | Application of the S100P albumen as marker in diagnostic activities tuberculosis | |
| CN106011281A (en) | Detection methods of intestinal segmented filamentous bacteria flagellin | |
| JP4852738B2 (en) | New protein derived from cedar pollen, gene encoding the protein, and use thereof | |
| JP4686710B2 (en) | New allergens from cedar pollen and their use | |
| CN102993283B (en) | Antigen protein for mycobacterium tuberculosis and application | |
| CN107501396A (en) | A kind of protein and its application for being used to diagnose SFTS patient's prognosis situation | |
| CN101477125A (en) | Composition based on tubercle bacillus antigenic polypeptide for diagnosing tuberculosis | |
| CN109734792A (en) | People CNTN1 antigen, people's CNTN1 antibody assay kit and the preparation method and application thereof | |
| CN101906420B (en) | Human filaggrin gene prokaryotic expression system and application of expressed protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190125 |
|
| RJ01 | Rejection of invention patent application after publication |