CN106967696B - Allergen of artemisia pollen and application thereof - Google Patents
Allergen of artemisia pollen and application thereof Download PDFInfo
- Publication number
- CN106967696B CN106967696B CN201710097440.7A CN201710097440A CN106967696B CN 106967696 B CN106967696 B CN 106967696B CN 201710097440 A CN201710097440 A CN 201710097440A CN 106967696 B CN106967696 B CN 106967696B
- Authority
- CN
- China
- Prior art keywords
- pro
- gly
- ala
- leu
- thr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03009—Galactose oxidase (1.1.3.9)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention discloses an allergen of artemisia pollen and application thereof. An allergen of Artemisia pollen is galactose oxidase of Artemisia, and the amino acid sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or SEQ ID No. 7. The allergen of artemisia pollen is a newly found allergen, namely galactose oxidase of the artemisia, and is the 7 th allergen found in the artemisia. The allergen can be used for preparing medicines for treating or preventing allergy, or used for preparing allergen detection kits.
Description
Technical Field
The invention relates to the technical field related to biotechnology, in particular to an allergen of artemisia pollen and application thereof.
Background
Type i allergy is also known as type i hypersensitivity disease, and the associated diseases include atopic disease, allergic rhinitis, allergic conjunctivitis, atopic dermatitis and allergic asthma (extrinsic) and some urticaria, gastrointestinal food reactions and systemic anaphylaxis, etc. Type i allergy is widespread worldwide, and patients with atopic diseases develop IgE antibody-mediated hypersensitivity to inhaled or ingested substances (allergens) that are harmless to people without atopic diseases. In addition to atopic dermatitis, generally IgE antibodies mediate hypersensitivity reactions.
The substance that causes type i allergy is called allergen and is a protein, glycoprotein or polypeptide. After uptake from the mucosa, these allergens react with IgE antibodies bound to the surface of mast cells in sensitized individuals. If two IgE antibodies are cross-linked to each other by an allergen, the effector cells are caused to release mediators (such as histamine, prostaglandins) and cytokines, thereby causing the corresponding clinical symptoms.
The Nomenclature of allergens is based on the rules of the system established by the Allergen Nomeformat Sub-committee for Allergen Nomenclature (http:// www.allergen.org) under the Association of the genus and International society of immunology (I.U.I.S.). The nomenclature is mainly based on the Latin name of the allergen source species, the first three letters of the genus name plus the 1-2 letters of the species, and then the allergen code number is added, such as Art v 1-Art v 6 as the allergen of Artemisia princeps (Artemisia vulgaris) and Art an 1-Art an 6 as the similar allergen of Artemisia annua (Artemisia annua).
Artemisia flower powder is a main inhalation allergen in northern and western China, and causes allergic diseases such as rhinitis, conjunctivitis, rash, asthma and the like of allergic people in summer and autumn. Currently 6 allergen proteins (Art v 1-Artv 6) have been identified in Europe with Artemisia princeps. In vitro diagnosis is mainly performed using pollen extracts. The protein components have two scientific research applications (Art v 1 and Artv 3) abroad. In 1996, some serum immune protein researches at home and abroad find that a 60-70 kDa protein is a potential allergen, but the protein and a specific amino acid sequence are not clear. The main types of Chinese Artemisia (Artemisia) allergens are Artemisia annua (A.annua), Artemisia argyi (A.arygi), Artemisia capillaris (A.capillaries), Artemisia parviflora (A.gmelinii), Artemisia verniciosa (A.lavandulifolia), Artemisia delphinium (A.sieveersiana), and the European Artemisia plants are mainly Artemisia selengensis (A.vulgaris), and are only distributed in small quantities in northwest of Ningxia in China, so that the material used by the reagent ImmunoCAP of the foreign brand Sammer Feishal scientific and technology company entering the market of Chinese Artemisia diagnostic reagents is Artemisia selengensis.
Disclosure of Invention
The invention provides an allergen of artemisia pollen and application thereof.
An allergen of Artemisia pollen is galactose oxidase of Artemisia, and the amino acid sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or SEQ ID No. 7. The artemisia plant is a plant belonging to the artemisia genus in plant taxonomy, and includes artemisia annua (a.annua), artemisia argyi (a.arygi), artemisia capillaris (a.capillaries), artemisia sempervirens (a.gmelinii), artemisia mugwort (a.lavandulifolia), artemisia macrophylla (a.sieveersiana), artemisia nigra (a.vulgaris), and the like. The 7 sequences are respectively the amino acid sequences of galactose oxidase of the 7 artemisia plants listed above, the sequences have high conservation, and the sequence similarity (Identity) reaches 94.1%. Galactose oxidase from various species has similar allergenicity.
The invention also provides a DNA molecule for coding the allergen, and the nucleotide sequence is SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14. The DNA molecules are genes for coding the 7 amino acid sequences, the genes have high conservation, and the sequence similarity (Identity) reaches 92.2 percent.
The invention also provides a recombinant expression vector containing the DNA molecule. The recombinant expression vector may be a variety of plasmids for protein expression.
The invention also provides a host organism comprising said DNA molecule or comprising said recombinant expression vector. The host organism can be Escherichia coli for prokaryotic expression, yeast for eukaryotic expression, insect cells, mammalian cells (such as CHO cells) and other protein expression systems.
The invention also provides application of the allergen or the DNA molecule in preparing a medicament for treating or preventing allergy.
The invention also provides a medicament for treating or preventing allergy, comprising at least one of the allergen or the DNA molecule.
Preferably, the medicament is a vaccine.
The traditional approach to effectively treat allergy is specific immunotherapy or desensitization, i.e. the subcutaneous injection of a natural allergen extract in increasing doses to allergic patients.
The invention also provides application of the allergen or the DNA molecule in preparation of an allergen detection kit.
The invention also provides a kit for allergen detection comprising at least one of the allergen or the DNA molecule.
For patients with allergy, an important means is to detect the allergen causing the allergy, and the occurrence of the allergy can be effectively prevented by reducing the contact with the allergen in a targeted manner. The allergen or the DNA molecule of the invention can be used alone or together with other allergens to prepare a kit for screening allergen of an allergic patient.
The allergen of artemisia pollen is a newly found allergen, namely galactose oxidase of the artemisia, and is the 7 th allergen found in the artemisia. The allergen can be used for preparing medicines for treating or preventing allergy, or used for preparing allergen detection kits.
Drawings
FIG. 1 is a diagram showing the detection of pollen protein extracts of 7 kinds of Artemisia, wherein, diagram A is an electrophoresis diagram, diagram B is an immunoblotting diagram, and lanes 1-7 are Artemisia annua, Artemisia argyi, Artemisia capillaris, Artemisia spicata, Artemisia mugwort, Artemisia sieboldii and Artemisia beiyi, respectively.
FIG. 2 is an immunoblot of the effect of Artemisia annua pollen extract and Artemisia annua pollen allergy positive serum of 15 individual sera, wherein S is Artemisia annua pollen protein extract, p 49-60, 88-90 are experimental groups, and N is negative control group.
FIG. 3 is an electrophoretogram of the purified Artemisia annua galactose oxidase protein of example 3.
FIG. 4 is the mass spectrum of the total protein molecular weight of the purified Artemisia annua galactose oxidase protein in example 3.
FIG. 5 is a diagram showing the matching sequence of the peptide fragment in example 3.
Fig. 6 is a graph of the results of skin test experiments, in which 1: histamine positive control (10. mu.g/mL); 2: artemisia annua pollen protein extract (1 μ g/mL); 3: mugwort pollen protein extract (1. mu.g/mL); 4: artemisia sieboldii pollen protein extract (1. mu.g/mL); 5: purifying the native galactose oxidase nATtan 7 (0.25. mu.g/mL); 6: the native galactose oxidase nATtan 7 (0.5. mu.g/mL) was purified.
Detailed Description
Material
Artemisia annua, Artemisia argyi, Artemisia capillaris, Artemisia spicata, and Artemisia Selengensis: collected from Shanxi province;
wild mugwort: collected from Zhejiang province;
and (3) north wormwood: purchased from merck, germany.
Artemisia pollen allergy positive serum: clinical cases of the third people hospital in Taiyuan City of Shanxi province, originated from the second hospital affiliated to the medical college of Zhejiang university and scientific research cooperation, ethical batch No.2011-R-1, patients agree and sign informed consent.
Example 1
Extracting proteins from 7 representative species (Artemisia annua, Artemisia argyi, herba Artemisiae Scopariae, herba Lysimachiae Viridis, Artemisia mugwort, semen Artemisiae Argyi, and Artemisia Selengensis) pollen of Artemisia. The protein extraction and purification method comprises the following steps: 2g pollen was dissolved in 35mL PBS (pH 7), shaken overnight at 4 ℃ for 12 hours, centrifuged at 10000g for 10 minutes (4 ℃) and filtered through a 0.22 μm Millipore membrane to obtain a pollen protein extract.
Pollen protein extracts of 7 Artemisia plants, 50. mu.g each, were separated by 12% SDS PAGE, and the proteins were then blotted onto PVDF membrane and blocked with 5% skimmed milk. And mixing 35 cases of the artemisia pollen allergy positive serum into a serum pool for incubation. The results of detection of bound IgE by goat anti-human IgE HRP (1: 3000), chemiluminescence detection with substrate ECL (BioRadChemiDoc), SDS PAGE gel staining and immunoblotting are shown in FIG. 1, and three consistent reactive protein bands were identified, of which 10 and 25kD correspond to known non-specific lipid transfer protein (nsLTP) and similar protective protein, and one is unknown at 60-70 kD.
The artemisia annua pollen allergy positive serum of 15 cases of single serum is used for further verification of the artemisia annua pollen protein extract, and the immunoblot detection result is shown in figure 2 and is consistent with the detection result of a mixed serum pool.
Example 2
mRNA is extracted from fresh frozen pollen of artemisia annua and is reversely transcribed into cDNA, and IlluminaHiseq2000 is used for RNA-seq sequencing. Gene annotation was performed by soapdenov sequence assembly. The full spectrum of proteins in the pollen was determined by tryptic peptide cleavage followed by mass spectrometry using Q-EXACTIVE (ThermoFisher, USA). Mass matching of peptide fragments was performed with Mascot, set at 20ppm and 0.6 Da. Through the combination of transcriptome RNA-seq and total protein spectrum, over 2000 proteins in the artemisia annua pollen are identified.
A protein band with the molecular weight of 60-70 kD, which is identified and separated by SDS PAGE in example 1, is subjected to a proteolysis mass spectrometry test, and a protein which is annotated as galactose oxidase is obtained as a candidate, the isoelectric point of the candidate is 4.9, and the protein is acidic by referring to all possible protein amino acid sequences identified by a transcriptome and a proteome.
Example 3
50mL of artemisia annua pollen protein extract (extracted as described in example 1) was purified by separation on an AKTA protein purification system using an anion exchange column (Explorer 100, GE) and a protein molecular sieve (Super 7510/300 GL type, GE) to obtain a protein of about 62kDa in size (FIG. 3).
The mass spectrum analysis of the target protein obtained by purification shows that the total protein molecular weight mass spectrum is 61.95kDa (figure 4), and the difference of 1 per thousand from the theoretical calculation is that the amino acid coverage (underlined part) matched with the mass spectrum of the tryptic peptide fragment reaches 62 percent of the length of the whole amino acid sequence (figure 5). Corresponding to the amino acid sequence, obtaining the full-length SEQ ID No.8 of the coding gene.
Example 4
Native galactose oxidase protein (Art an7) isolated and purified from artemisia annua pollen protein extract as described in example 3 was biotinylated and the purified galactose oxidase protein bound to streptavidin ImmunoCAPs (Phadia, Uppsala, Sweden).
Serum specific IgE was tested with ImmunoCAP 100. The serum of 100 artemisia allergy patients is tested, the IgE titer is more than 0.35kUA/L and is positive, the result is shown in table 1, and the positive rate of the detection result is more than 95%.
TABLE 1
Note: abbreviations for symptoms: AS-asthma; c-conjunctivitis; r-rhinitis; u-rash. N1-N5 are negative control sera.
Example 5
The accurate galactose oxidase amino acid sequences of 7 kinds of artemisia are obtained through PCR primer clone sequencing and the RNA-seq of the artemisia pollen.
The galactose oxidase coding gene in mugwort, artemisia capillaries, artemisia schizophylla, mugwort and mugwort pollen is cloned and sequenced by a primer (an upstream primer: ATGGCTTCATCAATTAAAACA; a downstream primer: TAACCCAAGTGTAGCTGATT) to obtain a gene sequence SEQ ID No. 9-14 (the sequence of the coding signal peptide is removed).
Example 6
In vivo assay (skin test) was carried out on pollen protein extracts of artemisia annua, artemisia argyi and artemisia sieversiana (prepared in example 1) and galactose oxidase protein isolated and purified from artemisia annua pollen protein extracts according to the method of example 3, as follows: selecting 0.5 mu g/mL galactose oxidase protein with diluted concentration for subcutaneous injection of 0.1 mL; diluting pollen protein extract of herba Artemisiae Annuae, folium Artemisiae Argyi, and semen Artemisiae Argyi to 1 μ g/mL, and subcutaneously injecting to 0.1 mL; the positive control is 0.1mL of histamine subcutaneous injection with the concentration of 10 mu g/mL; the negative control was subcutaneous injection of 0.1mL allergen vehicle. All diluted with allergen vehicle (tai yuan pharmaceutical factory). The skin test was judged positive if the diameter of the cumulus spot reached 1/3 of the histamine positive control. The subjects were tested on P54 in table 2.
As shown in FIG. 6 and Table 2, it was found that both the pollen protein extracts of Artemisia annua, Artemisia argyi, and Artemisia macrosperma and the isolated and purified Artemisia annua galactose oxidase protein can induce allergic reactions, and the allergic reactions induced by the isolated and purified Artemisia annua galactose oxidase protein are stronger. The negative control result has no hillock spots, is still a normal skin sample, and the picture is not shown.
Further skin tests of artemisia annua extract and purified protein were performed in 7 artemisia annua allergy cases (P101-107) and one negative control case, and when the newly found galactose oxidase IgE value was low (less than 0.68), the skin test was negative (table 2).
TABLE 2
Note: abbreviations for symptoms: AS-asthma; c-conjunctivitis; r-rhinitis; u-rash. N6 is a negative control serum.
SEQUENCE LISTING
<110> Hangzhou Allergy Biotechnology Ltd
<120> allergen of artemisia pollen and application thereof
<130>
<160>16
<170>PatentIn version 3.3
<210>1
<211>571
<212>PRT
<213> Artemisia annua (A. annua)
<400>1
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Glu Ile Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Phe Glu Pro Glu Phe Met Gly Ala Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Ile Asn Pro Asp Ala
85 90 95
Asn Asn Gln Pro Asp Cys Tyr Ala His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Lys
145 150 155 160
Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Lys Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250 255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Ile Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Gln Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Thr Pro Thr Thr Ile Ala Arg Met
405 410 415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Thr Glu Arg Thr Gln Ile Asp Pro Ala Asn Thr Asp Ala Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Ser Val Gln Asn Gly Val Ile Thr Ala Val Ala Pro Pro Ser Gly
530 535 540
Gln Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Val Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>2
<211>571
<212>PRT
<213> Artemisia princeps (A. arygi)
<400>2
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Gln Val Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Phe Glu Pro Glu Phe Met Gly Ala Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Asn Asn Pro Asp Ala
85 90 95
Asn Asn Gln Pro Asp Cys Tyr Val His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Asn
145 150 155 160
Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Arg Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250 255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Ile Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Lys Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Ser Pro Thr Thr Ile Ala Arg Met
405 410 415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Pro Glu Arg Thr Gln Ile Asp Pro Ala Asn Thr Asp Val Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Ser Val Glu Asn Gly Val Ile Thr Ala Ile Ala Pro Pro Ser Gly
530 535 540
Glu Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Val Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>3
<211>571
<212>PRT
<213> Artemisia capillaris (A. capellaries)
<400>3
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Leu Ile Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Ile Glu Pro Glu Phe Met Gly Glu Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Ile Asn Pro Asp Ala
85 90 95
Asn Asn Gln Pro Asp Cys Tyr Ala His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Asn
145 150 155 160
Gly Asp PheThr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ala Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Lys Arg Phe Asp Leu Pro Phe Leu Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Gln Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250 255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Val Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Gln Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu LysLys Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Leu His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Ser Pro Thr Thr Ile Ala Arg Met
405 410 415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Pro Glu Arg Thr Leu Ile Asp Pro Ala Asn Thr Asp Val Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe LysIle Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Gly Val Glu Asn Gly Val Ile Thr Ala Val Ala Pro Pro Ser Gly
530 535 540
Glu Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Val Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>4
<211>571
<212>PRT
<213> Artemisia sacrorum (A. gmelinii)
<400>4
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Glu Ile Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Ile Glu Pro Glu Phe Met Gly Ala Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Pro Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Ile Asn Pro Asp Ala
85 90 95
Asn Asn Gln Pro Asp Cys Tyr Ala His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Lys
145 150 155 160
Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Lys Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250 255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Ile Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Gln Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Thr Pro Thr Thr Ile Ala Arg Met
405 410 415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Thr Glu Arg Thr Gln Ile Asp Pro Ala Asn Thr Asp Val Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Ser Val Glu Asn Gly Val Ile Thr Ala Val Ala Pro Pro Ser Gly
530 535 540
Gln Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Val Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>5
<211>571
<212>PRT
<213> Artemisia argyi (A. lavandulifolia)
<400>5
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Gln Val Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Phe Glu Pro Glu Phe Met Gly Ala Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Asn Asn Pro Asp Ala
8590 95
Asn Asn Gln Pro Asp Cys Tyr Val His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Asn
145 150 155 160
Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Arg Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Ile Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Lys Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Ser Pro Thr Thr Ile Ala Arg Met
405 410415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Pro Glu Arg Thr Gln Ile Asp Pro Ala Asn Thr Asp Val Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Ser Val Glu Asn Gly Val Ile Thr Ala Ile Ala Pro Pro Ser Gly
530 535 540
Glu Ile Ala Pro Pro Gly Tyr Tyr Ile Leu Phe Val Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>6
<211>572
<212>PRT
<213> Artemisia Selengensis (A. sievessiana)
<400>6
Ala Pro Asp Ile Thr Asp Gly Ala Gly Asp Lys Pro Gly Pro Gln Val
1 5 10 15
Asp Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala
20 25 30
Ser Asp Tyr Ala Lys Pro Ala Ile Glu Ser Glu Phe Met Gly Gln Trp
35 40 45
Val Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu
50 55 60
Met Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala
65 70 75 80
Ser Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Ile Asn Pro Asp
85 90 95
Ala Asn Asn Gln Pro Asp Cys Tyr Val His Gly Ile Ala Tyr Asp Trp
100 105 110
Lys Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys
115 120 125
Ser Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly
130 135 140
Thr Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Pro Asn Asp Asp Pro
145 150 155 160
Asn Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp
165 170 175
Tyr Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly
180 185 190
Gly Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe
195 200 205
Lys Pro Lys Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro
210 215 220
Pro Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu
225 230 235 240
Phe Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala
245 250 255
Ile Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val
260 265 270
Leu Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu
275 280 285
Phe Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Val Pro Glu Ile
290 295 300
Val Ile Cys Gly Gly Asn Gln Pro Asn Ala Tyr Glu Leu Val Asp Ala
305 310 315 320
Arg His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn
325 330 335
Arg Ile Lys Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn
340 345 350
Met Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly
355 360 365
Asp Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu
370 375 380
Asp Ala Thr Glu Pro Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys
385 390 395 400
Pro Met Gly Gln Arg Phe Lys Glu Leu Arg Pro Thr Thr Ile Ala Arg
405 410 415
Met Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val
420 425 430
Ala Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro
435 440 445
Thr Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala
450455 460
Leu Glu Leu Glu Arg Ser Gln Ile Asp Pro Ala Asn Thr Asp Val Val
465 470 475 480
Leu Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Gly Leu Met Glu Lys
485 490 495
Gln Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro
500 505 510
Phe Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala
515 520 525
Ile Thr Ser Val Glu Asn Gly Val Ile Thr Ala Ile Ala Pro Pro Ser
530 535 540
Gly Glu Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Val Ser His Leu
545 550 555 560
Gly Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>7
<211>571
<212>PRT
<213> northern Asia (A. vulgaris)
<400>7
Ala Pro Asp Ile Thr Asp Gly Gly Asp Lys Pro Gly Pro Gln Val Asp
1 5 10 15
Asp Gly Gly Gly Asp Lys Pro Val Pro Gly Asn Asn Asp Gly Ala Ser
20 25 30
Asp Tyr Ala Lys Pro Ala Phe Glu Pro Glu Phe Met Gly Ala Trp Val
35 40 45
Ile Asp Asn Pro Asn Ala Gly Val Ala Ala Met Gln Leu Gln Leu Met
50 55 60
Pro Asn Asp Gln Ile Val Trp Phe Asp Thr Thr Ser Leu Gly Ala Ser
65 70 75 80
Gly Tyr Lys Leu Pro Glu Gly Thr Pro Cys Pro Asn Asn Pro Asp Ala
85 90 95
Asn Asn Gln Pro Asp Cys Tyr Val His Gly Ile Ala Tyr Asp Trp Lys
100 105 110
Thr Ser Lys Tyr Arg Pro Leu Thr Leu Gln Gly Asp Ala Trp Cys Ser
115 120 125
Ser Gly Asn Leu Trp Pro Asn Gly Asn Leu Met Ala Thr Gly Gly Thr
130 135 140
Phe Ser Gly Asp Lys Ala Ile Arg Val Ile Ala Asn Asp Asp Pro Asn
145 150 155 160
Gly Asp Phe Thr Thr Lys Ile Gly Ala Leu Ala Asp Thr Arg Trp Tyr
165 170 175
Ser Ser Asn Gln Val Leu Pro Asp Gly Ser Ser Val Val Leu Gly Gly
180 185 190
Arg Asp Ser Tyr Ser Tyr Glu Ile Val Pro Pro Gln Met Glu Phe Lys
195 200 205
Pro Arg Arg Phe Asp Leu Pro Phe Met Gln Gln Thr Thr Glu Pro Pro
210 215 220
Leu Gly Pro Gly Arg Pro Val Glu Asn Asn Leu Tyr Pro Phe Leu Phe
225 230 235 240
Leu Leu Pro Asp Gly Asn Ile Phe Leu Phe Ala Asn Asn Arg Ala Ile
245 250 255
Thr Phe Glu Pro Ala Thr Gly Lys Thr Val Lys Glu Phe Pro Val Leu
260 265 270
Pro Gly Gly Ser Arg Asn Tyr Pro Pro Ser Gly Ser Ala Ala Leu Phe
275 280 285
Pro Leu Lys Leu Thr Ala Asp Asn Ala Pro Val Ile Pro Glu Ile Val
290 295 300
Ile Cys Gly Gly Asn Lys Pro Asn Ala Tyr Glu Leu Val Asp Ala Arg
305 310 315 320
His Val Thr Glu Lys Gln Phe Leu Pro Ala Leu Gln Asp Cys Asn Arg
325 330 335
Ile Gln Pro Met Ala Ala Asp Ala Ala Trp Ile Pro Glu Gln Asn Met
340 345 350
Pro Ser Pro Arg Thr Met Gly Asp Leu Ile His Leu Ala Asn Gly Asp
355 360 365
Met Leu Met Leu Asn Gly Ala Lys Lys Gly Thr Ser Gly Trp Glu Asp
370 375 380
Ala Thr Glu Ala Asn Leu Thr Pro Val Leu Tyr Thr Pro Tyr Lys Pro
385 390 395 400
Met Gly Gln Arg Phe Lys Glu Leu Ser Pro Thr Thr Ile Ala Arg Met
405 410 415
Tyr His Ser Cys Ser Ala Leu Leu Pro Asp Thr Arg Val Leu Val Ala
420 425 430
Gly Ser Asn Met His Gln Phe Tyr Thr Phe Asp Thr Glu Phe Pro Thr
435 440 445
Glu Leu Arg Val Glu Lys Phe Ser Pro Pro Tyr Leu Asp Pro Ala Leu
450 455 460
Glu Pro Glu Arg Thr Gln Ile Asp Pro Ala Asn Thr Asp Val Val Leu
465 470 475 480
Lys Tyr Gly Lys Pro Phe Lys Ile Thr Ala Ala Leu Met Glu Lys Gln
485 490 495
Pro Leu Val Leu Gly Glu Val Lys Val Thr Leu Leu Tyr Pro Pro Phe
500 505 510
Thr Thr His Gly Phe Ser Gln Asn Gln Arg Met Ile Val Pro Ala Ile
515 520 525
Thr Ser Val Glu Asn Gly Val Ile Thr Ala Ile Ala Pro Pro Ser Gly
530 535 540
Glu Ile Ala Pro Pro Gly Tyr Tyr Ile Met Phe Leu Ser His Leu Gly
545 550 555 560
Ile Pro Gly Ala Gly Ile Trp Val His Ile Asp
565 570
<210>8
<211>1713
<212>DNA
<213> Artemisia annua (A. annua)
<400>8
ccggatataa ccgatggtgg cgacaaacct gggcccgaaa tcgatgatgg tggtggtgac 60
aaacctgtac ccggaaacaa cgatggtgca tcagattatg caaagccagc attcgagcct 120
gaatttatgg gtgcatgggt aattgacaat cctaacgctg gggttgctgc catgcaactc 180
cagttaatgc ctaatgatca gatcgtatgg tttgatacca cgtcactcgg ggcttcagga 240
tataaattac ctgagggaac tccttgccct attaacccag atgcaaataa tcagcctgat 300
tgttatgctc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgtta 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggctacg 420
ggaggtacct tcagtggtga taaagctatt cgagtgatcg ctaacgatga tcctaaagga 480
gactttacca ccaaaattgg tgctcttgct gatactagat ggtactcatc taaccaggtc 540
ttgccagacg gaagttcagt cgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa acccaagaga tttgatctcc ctttcatgca acaaacaact 660
gaacctcctt taggaccagg aagaccagtg gagaacaacc tgtacccgtt ccttttcctc 720
cttcctgatg gaaacatttt cctctttgct aacaatcgag ccatcacctt cgaaccagct 780
actggtaaaa ccgttaagga gttccccgtg ttacctggtg gctctcgtaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaag ctcactgctg ataatgcccc ggtcattcct 900
gagattgtaa tttgcggtgg taaccaacca aatgcatatg aactcgttga cgcaaggcat 960
gtcaccgaaa agcagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggattcc cgaacaaaac atgccatcac caagaacaat gggtgatttg 1080
atacatcttg ccaatggtga tatgttgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gactccaaca acaattgcta gaatgtatca ttcttgctcg 1260
gctttattgc ccgacactag agtcttggtc gcgggtagca acatgcacca gttctacacg 1320
ttcgacacgg agtttcctac agaattgagg gtagagaaat tctcaccacc ttacttggac 1380
ccagccctag aaacggaaag aacccagatc gatccagcta atacagatgc ggtcttgaag 1440
tacggaaaac catttaagat tacagctgct cttatggaaa aacagcccct ggtgcttggt 1500
gaggttaagg taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccggcaat aaccagtgtt cagaacggtg taatcacagc cgttgcacct 1620
ccttctggac agattgcacc accaggatac tacattatgt ttgtgagtca ccttggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>9
<211>1713
<212>DNA
<213> Artemisia princeps (A. arygi)
<400>9
ccagatataa ccgatggtgg cgacaaacct gggcctcaag tcgatgatgg tggtggtgac 60
aaacctgtac ccggaaacaa cgatggtgca tctgattatg caaagccagc attcgagcct 120
gaatttatgg gtgcatgggt aattgacaat cctaacgctg gtgttgctgc catgcagctc 180
cagttgatgc ctaatgatca aatcgtatgg tttgatacca cgtcacttgg ggcttcgggg 240
tataaattac ctgagggaac tccttgccct aataacccag atgcaaataa tcagcctgat 300
tgttatgttc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgtta 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggcgaca 420
ggcggcacct tcagtggtga taaagctatt cgagtgatcg ctaacgatga tcctaatgga 480
gactttacca ccaaaattgg tgctcttgct gatactagat ggtactcatc taaccaggtc 540
ttgcctgacg gaagttcagt cgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa accccggagg tttgatctcc ctttcatgca acaaacaact 660
gaacctcctt taggaccagg aagaccggtc gagaacaacc tgtacccatt ccttttcctc 720
cttcctgatg gaaacatttt cctctttgct aacaatcgtg ccatcacctt cgaaccagct 780
actggaaaaa ctgttaagga gttccccgtg ttacctggtg gctctcgcaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaaa ctcacggctg ataatgcccc ggtcattcct 900
gagattgtaa tttgcggtgg taacaaacca aatgcatatg aactcgttga cgcaaggcat 960
gtcaccgaaa agcagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggatccc cgaacaaaac atgccatcac caagaaccat gggtgatttg 1080
atacatcttg ccaatggtga tatgttgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gagtccaaca acaattgcta gaatgtatca ttcttgctcg 1260
gctttattgc ccgacactag agtcttggtc gcgggtagca acatgcacca gttctacacg 1320
tttgacaccg agtttcctac agaattgagg gttgagaaat tctcaccacc ttacttggac 1380
ccagccctag aaccagaaag aacccagatc gatccagcta atacggatgt ggtcctgaag 1440
tacggaaaac cattcaagat cacagctgct cttatggaaa aacaacccct ggtgcttggt 1500
gaggttaagg taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccggcaat aaccagtgtt gagaacggtg taatcacagc cattgcaccg 1620
ccttctggag agattgctcc accaggatac tacattatgt ttgtgagtca cctcggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>10
<211>1713
<212>DNA
<213> Artemisia capillaris (A. capellaries)
<400>10
ccagatataa ccgatggtgg cgacaaacct gggcctttaa tcgatgatgg tggtggtgac 60
aaacctgtac ctggaaacaa tgatggtgca tctgattatg caaagcctgc gatcgagcct 120
gaatttatgg gcgaatgggt aattgacaat cctaatgctg gtgttgctgc catgcaactc 180
cagttgatgc ctaatgatca gatcgtatgg tttgatacca cgtcacttgg ggcttcggga 240
tataaattac ctgagggaac tccttgccct attaacccag atgcaaataa ccagcctgat 300
tgttatgctc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgttg 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggctacg 420
ggaggtacct tcagtggtga taaagctatt cgagtgatcg ctaatgatga tcctaatgga 480
gactttacca ccaaaattgg tgctcttgct gatactagat ggtactcatc taaccaggtc 540
ttgccagatg gaagtgcagt tgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa acccaagaga tttgatctcc ctttcttgca acaaacaact 660
gaacctccct taggaccagg aagaccggtc gagaacaacc tgtacccgtt ccaattcctt 720
cttcctgatg gaaacatttt cctcttcgct aacaatcgtg ccatcacctt cgaaccagct 780
actggaaaaa ccgttaagga gttccccgtg ttacctggtg gctctcgcaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaag ctcacggctg ataatgcccc ggtcgttcct 900
gagattgtaa tttgcggtgg taaccagcca aatgcatatg aactcgttga cgcaaggcat 960
gtcaccgaaa agaagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggatccc cgaacaaaac atgccatcac caagaaccat gggtgatttg 1080
ctacatcttg ccaatggtga tatgctgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gagtccaaca acaattgcta gaatgtatca ttcttgctcg 1260
gctttattgc ccgacactag agtcttggtc gcaggtagca acatgcacca gttctacaca 1320
ttcgacactg agtttcctac agaattgagg gttgagaaat tctcaccacc ttacttggac 1380
ccagccctag aaccagaaag aaccctgatc gatccagcta atacggatgt ggtcttgaag 1440
tacggaaaac catttaagat tacagctgct cttatggaaa aacaacccct ggtgcttggt 1500
gaggttaagg taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccagcaat aaccggtgtt gagaacggtg taatcacagc cgttgcacct 1620
ccttctggag agattgctcc accaggatac tacattatgt ttgtgagtca cctcggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>11
<211>1713
<212>DNA
<213> Artemisia sacrorum (A. gmelinii)
<400>11
ccggatataa ccgatggtgg cgacaaacct gggcccgaaa tcgatgatgg tggtggtgac 60
aaacctgtac ccggaaacaa cgatggtgca tctgattatg caaagccagc aatcgagcct 120
gaatttatgg gtgcatgggt aattgacaat cctaacgctg gggttgctgc catgcaactc 180
cagttgatgc ctaatgatca gatcgtatgg tttgatacca cgtcacttgg gccttcagga 240
tataaattac ctgagggaac tccttgccct attaacccag atgcaaataa tcagcctgat 300
tgttatgctc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgtta 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggctacg 420
ggaggtacct tcagtggtga taaagctatt cgagtgatcg ctaacgatga tcctaaagga 480
gactttacca ccaaaattgg tgctcttgct gatactagat ggtactcatc taaccaggtc 540
ttgccagatg gaagttcagt cgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa acccaagaga tttgatctcc ctttcatgca acaaacaact 660
gaacctcctt taggaccagg aagaccggtg gagaacaacc tgtacccgtt ccttttcctc 720
cttcctgatg gaaacatttt cctctttgct aacaatcgag ccatcacctt cgaaccagct 780
actggtaaaa ccgttaagga gttccccgtg ttacctggtg gctctcgcaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaag ctcacggctg ataatgcccc ggtcattcct 900
gagattgtaa tttgcggtgg taaccaacca aatgcatatg aactcgttga cgcaaggcat 960
gtcactgaaa agcagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggattcc cgaacaaaac atgccatcac caagaaccat gggtgatttg 1080
atacatcttg ccaatggtga tatgttgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gactccaaca acaattgcta gaatgtatca ttcttgctcg 1260
gctttattgc ccgacactag agtcttggtc gcgggtagca acatgcacca gttctacacg 1320
ttcgacacgg agtttcctac agaattgagg gttgagaaat tctcaccacc ttacttggac 1380
ccagccctag aaacggaaag aacccagatc gatccagcta atacagatgt ggtcttgaag 1440
tacggaaaac cgtttaagat tacagctgct cttatggaaa aacagcccct ggtgcttggt 1500
gaggttaagg taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccggcaat aaccagtgtt gagaacggtg taatcacagc cgtcgcacct 1620
ccttctggac agattgctcc accaggatac tacattatgt ttgtgagtca ccttggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>12
<211>1713
<212>DNA
<213> Artemisia argyi (A. lavandulifolia)
<400>12
ccagatataa ccgatggtgg cgacaaacct gggcctcaag tcgatgatgg tggtggtgac 60
aaacctgtac ccggaaacaa cgatggtgca tctgattatg caaagccagc attcgagcct 120
gaatttatgg gtgcatgggt aatcgacaat cctaacgctg gtgttgctgc catgcaactc 180
cagttgatgc ctaatgatca aatcgtatgg tttgatacca catcacttgg ggcttcgggg 240
tataaattac ctgagggaac tccttgccct aataacccag atgcaaataa tcagcctgat 300
tgttatgttc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgtta 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggcgaca 420
ggcggcacct tcagtggtga taaagctatt cgagtgatcg ctaacgatga tcctaatgga 480
gactttacca ccaaaattgg tgcacttgct gatactagat ggtactcatc taaccaggtc 540
ttgcctgacg gaagttcagt cgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa accccggagg tttgatctcc ctttcatgca acaaacaact 660
gaacctcctt taggaccagg aagaccggtg gagaacaacc tgtacccatt ccttttcctc 720
cttcctgatg gaaacatttt cctctttgct aacaatcgtg ccatcacctt cgaacctgct 780
actggaaaaa ctgttaagga gttccccgtg ttacctggtg gctctcgcaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaaa ctcacggctg ataatgcccc ggtcattcct 900
gagattgtaa tttgcggtgg taacaaacca aatgcatatg aactcgttga cgcaaggcat 960
gtcaccgaaa agcagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggatccc cgaacaaaac atgccatcac caagaaccat gggtgatttg 1080
atacatcttg ccaatggtga tatgttgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gagtccaaca acaattgcta gaatgtatca ttcttgctca 1260
gctttattgc ccgacactag agtcttggtc gcgggtagca acatgcatca gttctacacg 1320
tttgacaccg agtttcctac agaattgagg gttgagaaat tctcaccacc ttacttggat 1380
ccagccctag aaccagaaag aacccagatc gatccagcta atacggatgt ggtcttgaag 1440
tacggaaaac cattcaagat cacagctgct cttatggaaa aacaacccct ggtgcttggt 1500
gaggttaaag taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccggcaat aaccagtgtt gagaacggtg taatcacagc cattgcaccg 1620
ccttctggag agattgctcc accaggatac tacattttgt ttgtgagtca cctcggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>13
<211>1716
<212>DNA
<213> Artemisia Selengensis (A. sievessiana)
<400>13
ccagatataa ccgatggtgc aggtgacaaa ccagggcccc aagtcgatga tggtggtggt 60
gacaaacctg tacccggaaa caacgatggt gcatctgatt acgcaaagcc agcaatcgag 120
tctgaattta tgggtcaatg ggtaattgac aatcctaacg ctggtgttgc tgccatgcaa 180
ctccagttga tgcctaatga tcagatcgta tggtttgata ccacgtcact tggggcttcg 240
ggatataaat tacctgaggg aactccttgc cctattaacc cagatgcaaa taaccagcct 300
gattgttatg ttcatggcat cgcttatgac tggaagacct caaaatacag gccgcttacg 360
ttacaaggtg atgcatggtg ctcgtcagga aacttgtggc caaatggtaa cctaatggct 420
acgggaggta ccttcagtgg tgataaagct attcgagtga tccctaacga tgatcctaat 480
ggagacttta ccaccaaaat tggtgctctt gctgatacaa gatggtattc atctaaccag 540
gtcttgccag acggaagttc agtcgtgttg ggaggcaggg attcctacag ctacgaaatc 600
gtaccaccac aaatggaatt caaacccaag agatttgatc tcccgttcat gcaacaaaca 660
actgaacctc ctttaggacc aggaagaccg gtcgagaaca acctgtaccc gttccttttc 720
ctccttcctg atggaaacat tttcctcttt gctaacaatc gtgccatcac cttcgaacca 780
gctacaggaa aaaccgtcaa ggagttcccc gtgttacctg gtggctctcg caactatcca 840
ccttcaggat cggcagctct tttcccattg aagctcacgg ctgataatgc cccggtcgtt 900
cctgagattg taatttgcgg tggtaaccaa ccaaatgcat atgaactcgt tgacgcaagg 960
catgtcaccg aaaagcagtt cctgcctgcc ctccaagatt gtaatagaat caaacccatg 1020
gcagctgatg cagcgtggat ccccgaacaa aacatgccat caccaagaac catgggtgat 1080
ttgatacatc ttgccaatgg tgatatgttg atgcttaatg gtgcgaaaaa aggtacttca 1140
ggttgggaag atgcgacaga gcctaaccta acacctgttt tatatacacc atacaaacct 1200
atgggacaaa gatttaaaga actgagacca acaacaattg ctagaatgta tcattcttgc 1260
tcggctttat tgcccgacac tagagtcttg gtcgcgggta gcaacatgca ccagttctat 1320
acgtttgaca ctgagtttcc tacagaattg agggttgaga aattctcacc accttacttg 1380
gacccagccc tagaactgga aagatcccag atcgatccag ctaatacgga tgttgtctta 1440
aagtacggaa aaccatttaa gattacagct ggtcttatgg aaaaacaacc cctggtgctt 1500
ggtgaggtta aggtaacctt gctatatcca ccattcacca ctcatggttt ctctcaaaac 1560
caaaggatga ttgttccggc aataaccagt gttgagaatg gtgtaatcac agccattgca 1620
cctccttctg gagagattgc tccaccagga tactacatta tgtttgtgag tcacctcggt 1680
attcctggtg cgggtatttg ggttcacatc gactaa 1716
<210>14
<211>1713
<212>DNA
<213> northern Asia (A. vulgaris)
<400>14
ccagatataa ccgatggtgg cgataaacct gggcctcaag tcgatgatgg tggtggtgac 60
aaacctgtac ccggaaacaa cgatggtgca tctgattatg caaagccagc attcgagcct 120
gaatttatgg gtgcatgggt aatcgacaat cctaacgctg gtgttgctgc catgcaactc 180
cagttgatgc ctaatgatca aatcgtatgg tttgatacca catcacttgg ggcttcgggg 240
tataaattac ctgagggaac tccttgccct aataacccag atgcaaataa tcagcctgat 300
tgttatgttc atggcatcgc ttatgactgg aagacctcaa aatacaggcc gcttacgtta 360
caaggtgatg catggtgctc gtccggaaac ttgtggccaa atggtaacct aatggcgaca 420
ggcggcacct tcagtggtga taaagctatt cgagtgatcg ctaacgatga tcctaatgga 480
gactttacca ccaaaattgg tgcacttgct gatactagat ggtactcatc taaccaggtc 540
ttgcctgacg gaagttcagt cgtgttggga ggcagggatt cctacagcta cgaaatcgta 600
ccaccacaaa tggaatttaa accccggagg tttgatctcc ctttcatgca acaaacaact 660
gaacctcctt taggaccagg aagaccggtc gagaacaacc tgtacccatt ccttttcctc 720
cttcctgatg gaaacatttt cctctttgct aacaatcgtg ccatcacctt cgaacctgct 780
actggaaaaa ctgttaagga gttccccgtg ttacctggtg gctctcgcaa ctatccacct 840
tcaggatcgg ccgctctttt cccattgaaa ctcacggctg ataatgcccc ggtcattcct 900
gagattgtaa tttgcggtgg taacaaacca aatgcatatg aactcgttga cgcaaggcat 960
gtcaccgaaa agcagttcct acctgccctc caagattgta atagaatcca acccatggca 1020
gctgatgcag cgtggatccc cgaacaaaac atgccatcac caagaaccat gggtgatttg 1080
atacatcttg ccaatggtga tatgttgatg cttaatggtg cgaaaaaagg tacatcaggt 1140
tgggaagatg cgacagaggc taaccttaca cctgttttat atacaccata caaacctatg 1200
ggacaaagat ttaaagaatt gagtccaaca acaattgcta gaatgtatca ttcttgctcg 1260
gctttattgc ccgacactag agtcttggtc gcgggtagca acatgcatca gttctacacg 1320
tttgacaccg agtttcctac agaattgagg gttgagaaat tctcaccacc ttacttggac 1380
ccagccctag aaccagaaag aacccagatc gatccagcta atacggatgt ggtcttgaag 1440
tacggaaaac cattcaagat cacagctgct cttatggaaa aacaacccct ggtgcttggt 1500
gaggttaagg taaccttgtt atatccacca ttcaccactc atggtttctc tcaaaaccaa 1560
aggatgattg taccggcaat aaccagtgtt gagaacggtg taatcacagc cattgcaccg 1620
ccttcgggag agattgctcc accaggatac tacattatgt ttctgagtca cctcggtatt 1680
cctggtgcgg gtatttgggt tcacatcgac taa 1713
<210>15
<211>21
<212>DNA
<213> Artificial sequence
<400>15
atggcttcat caattaaaac a 21
<210>16
<211>20
<212>DNA
<213> Artificial sequence
<400>16
Claims (9)
1. An allergen of Artemisia pollen is galactose oxidase of Artemisia, and the amino acid sequence is SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.6 or SEQ ID No. 7.
2. DNA molecule encoding the allergen of claim 1, wherein the nucleotide sequence is SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13 or SEQ ID No. 14.
3. A recombinant expression vector comprising the DNA molecule of claim 2.
4. A host organism comprising a DNA molecule according to claim 2 or comprising a recombinant expression vector according to claim 3.
5. Use of the allergen according to claim 1 or the DNA molecule according to claim 2 for the manufacture of a medicament for the treatment or prevention of allergy.
6. A medicament for the treatment or prevention of allergy comprising at least one of the allergen of claim 1 or the DNA molecule of claim 2.
7. The medicament of claim 6, wherein the medicament is a vaccine.
8. Use of the allergen according to claim 1 or the DNA molecule according to claim 2 for the preparation of a kit for the detection of an allergen.
9. A kit for the detection of an allergen comprising at least one of the allergen of claim 1 or the DNA molecule of claim 2.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710097440.7A CN106967696B (en) | 2017-02-22 | 2017-02-22 | Allergen of artemisia pollen and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710097440.7A CN106967696B (en) | 2017-02-22 | 2017-02-22 | Allergen of artemisia pollen and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN106967696A CN106967696A (en) | 2017-07-21 |
CN106967696B true CN106967696B (en) | 2020-01-14 |
Family
ID=59328531
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710097440.7A Active CN106967696B (en) | 2017-02-22 | 2017-02-22 | Allergen of artemisia pollen and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106967696B (en) |
Families Citing this family (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108265065B (en) * | 2016-12-31 | 2021-04-27 | 江苏众红生物工程创药研究院有限公司 | Recombinant artemisia annua 1-class allergen protein and application thereof |
CN109061184B (en) * | 2018-08-10 | 2021-07-20 | 杭州艾乐吉生物科技有限公司 | Artemisia pollen allergen combination, application and kit |
CN112710837B (en) * | 2020-11-03 | 2022-05-17 | 浙江大学 | Method for quantifying nsLTP allergen in artemisia pollen |
CN112725320A (en) * | 2021-01-06 | 2021-04-30 | 中国医学科学院北京协和医院 | Artemisia annua pollen pectin lyase and application thereof |
CN116554288A (en) * | 2022-01-29 | 2023-08-08 | 浙江大学 | Allergen of mango fruits and application thereof |
CN114685636B (en) * | 2022-03-04 | 2024-03-01 | 首都医科大学附属北京同仁医院 | Artemisia plant pollen allergen, application and kit |
CN114933642B (en) * | 2022-06-30 | 2023-09-12 | 吉林大学中日联谊医院 | Art v 1 recombinant protein and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102988979A (en) * | 2012-12-13 | 2013-03-27 | 北京新华联协和药业有限责任公司 | Artemisia pollen allergen vaccine lozenge and preparation method thereof |
-
2017
- 2017-02-22 CN CN201710097440.7A patent/CN106967696B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102988979A (en) * | 2012-12-13 | 2013-03-27 | 北京新华联协和药业有限责任公司 | Artemisia pollen allergen vaccine lozenge and preparation method thereof |
Non-Patent Citations (3)
Title |
---|
Allergens of weed pollen: an overview on recombinant and natural molecules;Gadermaier G等;《Methods》;20140301;第66卷(第1期);第55-66页 * |
Identification of a 62‐kDa major allergen from Artemisia pollen as a putative galactose oxidase;Wanyi Fu等;《Allergy》;20180530;第73卷(第5期);第1041-1052页 * |
Transcriptomic/proteomic identification of allergens in the mite Tyrophagus putrescentiae;Cui Y等;《Allergy》;20160825;第71卷(第11期);第1635-1639页 * |
Also Published As
Publication number | Publication date |
---|---|
CN106967696A (en) | 2017-07-21 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106967696B (en) | Allergen of artemisia pollen and application thereof | |
Palladino et al. | Peanut allergens | |
CN111548396B (en) | Novel coronavirus T cell epitope peptide, pMHC, preparation and application thereof | |
US20110150920A1 (en) | Allergy Vaccines Containing Hybrid Polypeptides | |
CA2634955C (en) | Hypoallergenic variants of the major allergen from betula verrucosa pollen | |
CN110642927B (en) | Application of protein in preparation of medicine for preventing cryptococcus pyogenes infection | |
CN111856006A (en) | Application of mycoplasma bovis secretory protein MbovP274 | |
CN109313182B (en) | Antigens of fish allergy | |
Rihs et al. | Recombinant Hev b 1: large‐scale production and immunological characterization | |
CN110585445A (en) | Application of mushroom serine protease inhibitor in preparing sobering-up and liver-protecting medicine and medicine for preventing and treating alcoholic liver injury | |
CN110746496A (en) | PAL recombinant protein of acinetobacter baumannii, coding gene thereof and application thereof | |
ES2328050T3 (en) | ALLERGY VARIANTS OF GROUP 1 OF POACEAE WITH REDUCED ALLERGENCITY AND A REACTIVITY MAINTAINED TO T-CELLS. | |
JP5937970B2 (en) | New cypress pollen allergen | |
KR20170074241A (en) | Novel dermatophagoides farinae protein | |
CN114685636B (en) | Artemisia plant pollen allergen, application and kit | |
JP4852738B2 (en) | New protein derived from cedar pollen, gene encoding the protein, and use thereof | |
JP3823268B2 (en) | Helicobacter pylori cell death inducer | |
KR102634321B1 (en) | Composition for diagnosing deer antler allergy comprising albumin as an active ingredient | |
CN116790560A (en) | Chitinase allergen of mango fruits and application thereof | |
CN104845982B (en) | Babesiamicrofti Bm186 antigens and its application | |
CN115058409B (en) | Triose phosphate isomerase as French phoenix tree pollen allergen and application thereof | |
Chen et al. | Purification and identification of 72 kDa and 15 kDa allergens from Broussonetia papyrifera pollen | |
CN116554288A (en) | Allergen of mango fruits and application thereof | |
ES2280905T3 (en) | NATURAL RUBBER ALLERGEN PROTEIN. | |
ITMI20001985A1 (en) | VARIATIONS OF THE MAJOR ALLERGEN PAR J 2 OF PARIETARIA JUDAICA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |