CN104845982B - Babesiamicrofti Bm186 antigens and its application - Google Patents
Babesiamicrofti Bm186 antigens and its application Download PDFInfo
- Publication number
- CN104845982B CN104845982B CN201510270487.XA CN201510270487A CN104845982B CN 104845982 B CN104845982 B CN 104845982B CN 201510270487 A CN201510270487 A CN 201510270487A CN 104845982 B CN104845982 B CN 104845982B
- Authority
- CN
- China
- Prior art keywords
- babesiamicrofti
- seq
- antibody
- gene
- pet28a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention provides a kind of gene of separation, gene order such as SEQ ID NO：Shown in 3.The present invention also provides a kind of 186 antigen proteins of Babesiamicrofti Bm, by the coded by said gene of above-mentioned separation, amino acid sequence such as SEQ ID NO：Shown in 4.The present invention also provides a kind of antibody, a kind of its above-mentioned Babesiamicrofti Bm186 antigen proteins of specific combination.The present invention further established high specific and the Babesiamicrofti disease diagnostic method of sensibility, can be applied to the different aspects such as scientific research and the prevention of Babesiamicrofti by the expression and purification of Babesiamicrofti Bm186 antigens；The vaccine of the present invention has the effect of prevention infection by Babesia microti.The kit and colloidal gold immunochromatographimethod strip of the present invention can also be used to detect Babesiamicrofti.
Description
Technical field
The invention belongs to bioengineering fields, are related to a kind of parasite Babesiamicrofti, specifically a kind of vole bar
Shellfish worm Bm186 antigens and its application.
Background technology
Nineteen fifty-seven, Yugoslavia report the confirmed cases of the first human body babesiasis.Then, the multiple countries in Europe and U.S.
State reports many cases human body babesiasis, Japan, China's Mainland and the Taiwan in Asia, the South Africa in Africa and Egypt in succession
There is a small amount of case.Babesiasis is caused by the babe insect infection for parasitizing vertebrate red blood cell, be one kind by tick
The Amphixenosis of propagation.At present, the babesia of human body babesiasis can be led to by being accredited, including Babesiamicrofti
Grade a few Babesiidae based on (Babesia microti) and babesia divergens (Babesia divergens)
(Babesiidae) protozoon.
People generally causes to infect by biting with worm tick or clinical input symptomless infection person liquid of donating blood.The disease is faced
Bed Symptoms differ, and mostly asymptomatic subclinical infection, a small number of cases are to generate heat, haemolysis, anaemia, splenomegaly is Major Clinicals
Performance, splenectomy, old age and immunologic hypofunction person easily suffer from severe infections or even occur dead.
Statistics shows：Nearly 20 years of the U.S., the human body babesiasis based on Babesiamicrofti are in outbreak of epidemic trend.At me
State's babesiasis belongs to new hair parasitic disease, in recent years, when someone's body cases of infection report.Clinician recognizes due to lacking correlation
Know, the disease is easily ignored and leads to serious consequence.Therefore, it is prevention and control babesia to establish fast and accurately diagnostic method
The important means of disease.
At present, the diagnostic techniques of Babesiamicrofti disease mainly includes cause of disease, molecular biology and immunology diagnosis technology.Disease
Original diagnosis includes blood smear microexamination and animal inoculation pvaccination isolation technics.Microscopy is still the gold mark for diagnosing Babesiamicrofti disease
Standard, but it is easy to cause missed diagnosis in the case of low-density parasitemia.The method sensibility of animal inoculation pvaccination is high, but take (more than several weeks) and
Costliness can not meet the needs of quickly detecting.Protocols in Molecular Biology is to expand Babesiamicrofti specificity by PCR method
DNA fragmentation has higher sensibility and specificity, but more demanding to laboratory equipment technology, in addition, to symptomless infection
Person can not also obtain positive findings sometimes.In immunology diagnosis technology, indirect immunofluorescence assay is as currently the only standardization
Babesiamicrofti detection method, application by special installation and professional operation limited.ELISA method in recent years also by
For the detection of Babesiamicrofti disease, wherein, BmSA1 is one of antigen that diagnosis effect is best in current document report, however,
There are certain cross reactions with plasmodium falciparum for it.Therefore, it is to improve to find the better Babesiamicrofti antigen of diagnosis effect
The key of ELISA detection results.
Bioinformatic analysis is carried out to the diagnostic antigen of Babesiamicrofti reported, it is found that most of antigen has had
Whole or incomplete tandem sequence repeats polypeptide, and be secreted protein, i.e., contain signal peptide sequence simultaneously.Such as, BmP94,
The antigens such as BmIRA, BMN1-8, BmSA1, BMN1-17 and BMN1-2.
Invention content
The purpose of the present invention is to provide a kind of Babesiamicrofti Bm186 antigens and its application, this vole bar
It is not high that shellfish worm Bm186 antigens and its application solve the antigen of diagnosis Babesiamicrofti disease and method sensitivity in the prior art
The technical issues of.
The present invention provides a kind of gene of separation, gene order such as SEQ ID NO：Shown in 3.
The present invention provides a kind of 186 antigen proteins of Babesiamicrofti Bm, by the coded by said gene of above-mentioned separation,
Amino acid sequence such as SEQ ID NO：Shown in 4.
The present invention provides a kind of antibody, a kind of its above-mentioned Babesiamicrofti Bm186 antigen proteins of specific combination.
Further, the antibody is monoclonal antibody.
The present invention provides a kind of carrier, the carrier, which contains, encodes a kind of above-mentioned Babesiamicrofti Bm186 antigens
Gene.
The present invention provides a kind of host cell, the cell contains above-mentioned carrier or the cell is compiled
The genetic transformation or transfection of a kind of above-mentioned Babesiamicrofti Bm186 antigens of code.
The present invention provides a kind of vaccine, the gene including above-mentioned separation, a kind of above-mentioned Babesiamicrofti Bm186 resist
Former albumen or above-mentioned antibody or above-mentioned carrier.
Gene the present invention provides above-mentioned separation is in the drug for preparing treatment, diagnosis or prevention Babesiamicrofti disease
In application.
The present invention provides above-mentioned 186 antigen proteins of Babesiamicrofti Bm to prepare treatment, diagnosis or prevention vole
Application in the drug of babesiasis.
The present invention provides above-mentioned antibody answering in the drug for preparing treatment, diagnosis or prevention Babesiamicrofti disease
With.
The present invention provides application of the above-mentioned vaccine in the drug for preparing treatment or prevention Babesiamicrofti disease.
The present invention provides a kind of kit, the gene containing above-mentioned separation, above-mentioned 186 antigens of Babesiamicrofti Bm
Albumen or above-mentioned antibody.
The present invention provides a kind of recombinant proteins, contain SEQ ID NO：28 or/and SEQ ID NO：Shown in shown in 29
Amino acid sequence.
Further, the amino acid sequence of above-mentioned a kind of recombinant protein such as SEQ ID NO：6 or SEQ ID NO：8、
Or SEQ ID NO：Shown in 10.
The present invention provides a kind of colloidal gold immunochromatographimethod strips, contain above-mentioned recombinant protein.
The present invention provides a kind of antibody, its above-mentioned recombinant proteins of specific combination.
The present invention provides a kind of kits, contain above-mentioned recombinant protein or above-mentioned antibody.
Term " carrier " herein refers to bacterial plasmid commonly used in the art, yeast plasmid and other various viruses
Carrier.The carrier being applicable in the present invention includes but not limited to：The carrier (prokaryotic expression carrier) of the expression in bacterium, in yeast
The carrier (such as pichia vector) of middle expression, in mammalian cell expression carrier (retroviral vector, gland
Viral vectors etc.).In a preferred embodiment, the expression vector is coli expression carrier.Those skilled in the art
Using a series of technologies such as DNA recombinant techniques, build the DNA sequence dna containing encoding fusion protein of the present invention, suitably turn
The expression vector of the particular elements such as record and translational control sequence, promoter and selected marker.Above-mentioned carrier can be used to turn
Change, transfect suitable host cell, to obtain required fusion protein.
The host cell of the present invention can be prokaryotic cell or eukaryocyte, e.g., bacterial cell, mammal
Cell etc..Host cell forms engineering after converting or transfecting the gene order containing encoding fusion protein of the present invention
Cell or cell strain, available for fusion protein needed for production.Those skilled in the art can properly select appropriate carrier, place
Chief cell, and know and how by carrier high-efficiency to convert or be transfected into host cell, method therefor includes but not limited to：Chlorination
Calcium method, electroporation are for bacterial cell, and liposome, electro fusion method are for eukaryocytes such as mammalian cells.
The host cell of the present invention can be cultivated, induce to express required fusion protein by conventional method, including
Fermentation process and purifying process.The albumen of above-mentioned expression can in the cell, on cell membrane or be secreted into periplasmic, extracellular.
As needed, it using physics, the chemical and other biological characteristics of fusion protein, is isolated and purified.Method packet
It includes but is not limited to：Bacterium is split, centrifugation is saltoutd, molecular sieve chromatography, ion-exchange chromatography, adsorption chromatography, reverse chromatograms and routine
Denaturation, renaturation process etc., these methods are well-known to those skilled in the art.
The present invention searches for the Babesiamicrofti transcript profile number of erythrocytic stage with the double characteristic of tandem sequence repeats polypeptide and signal peptide
According to；It is identified simultaneously by immunological method, it was found that a new Babesiamicrofti antigen-Bm186.The present invention is vole bar
The diagnosis of shellfish parasitosis provides new technology and means.By the expression and purification of Babesiamicrofti Bm186 antigens, further establish
The Babesiamicrofti disease of high specific and sensibility diagnosis elemental method；And more/monoclonal antibody is easily prepared, it can be applied to field
The different aspects such as the scientific research and prevention of Babesia muris；The vaccine of the present invention has the effect of prevention infection by Babesia microti.This hair
Bright kit and colloidal gold immunochromatographimethod strip can also be used to detect Babesiamicrofti.
Description of the drawings：
Fig. 1 is total serum IgE and mRNA agarose gel electrophoresis figures, M：DNA markers, 1：Total serum IgE, 2：mRNA.
Fig. 2 is 2 groups of tandem repetitive sequence schematic diagrames, adds frame for first group of tandem repetitive sequence, and underscore is the second string formation
Join repetitive sequence.
Fig. 3 is signal peptide prediction result.
Fig. 4 is the blastx sequence alignment analysis figures of Isotig00186.
Fig. 5 is the RTPCR of Bm186 genes as a result, M：DNA Marker；1-3：RTPCR products.
Fig. 6 is the TMHMM analysis results of Bm186 albumen.
Fig. 7 is the expression identification of pET28a-Bm186DST Rosetta2 (DE3) recombinant protein.
Fig. 8 is that pET28a-Bm186DST Rosetta2 (DE3) recombinant proteins denaturation way purifies 12% polyacrylamide
Gel electrophoresis figure.
Fig. 9 is the expression identification figure of pET28a-Bm186MT BL21 (DE3) recombinant protein.
Figure 10 is that pET28a-Bm186MT BL21 (DE3) recombinant proteins denaturation way purifies 12% polyacrylamide gel
Electrophoretogram.
Figure 11 is the expression identification figure of pET28a-Bm186S BL21 (DE3) recombinant protein.
Figure 12 is that the non denatured mode of pET28a-Bm186S BL21 (DE3) recombinant protein purifies 12% polyacrylamide gel
Electrophoretogram.
Figure 13 .Bm186MT recombinant protein ELISA method detection mouse serum specific antibody scatter plots.
Figure 14 is Bm186S recombinant protein ELISA method detection mouse serum specific antibody scatter plots.
Figure 15 is Bm186S- colloidal gold immunochromatographimethods strip detection mouse serum result；Upper row is the detection of normal mouse serum
As a result, lower row is the testing result of infection by Babesia microti mouse serum.
Specific embodiment：
The collection of 1 Babesiamicrofti of embodiment：
Babesiamicrofti selects the Babesia microti that experimental zoology research institute of the Chinese Academy of Medical Sciences providesPRA-99TMWorm strain.Through Babesiamicrofti is injected intraperitoneally, BALB/c mouse is inoculated with, after about 4 days, parasitemia infects
For rate up to 20%, anti-freezing takes whole blood.Leucocyte and red blood cell are layered using Percoll density gradient centrifugations, except leucocyte-removing.Add
Enter erythrocyte cracked liquid splitting erythrocyte, precipitation is collected after centrifugation, babesia polypide is determined as by microscopy.
2 mRNA's of embodiment isolates and purifies：
Babesiamicrofti total serum IgE is extracted with Invitrogen company's T RIzol reagents, by Oligitex mRNASpin-
Column Kit kit specification methods, isolate and purify mRNA from total serum IgE.And pass through agarose gel electrophoresis and ultraviolet point
Analysis measures, and detects the quality (as shown in Figure 1) of mRNA.
The transcript profile sequencing and analysis of 2 Babesiamicrofti of embodiment：
The sequencing and analysis of the transcript profile are completed by Shanghai Ou Yi biomedicines Science and Technology Ltd..Use Clontech public affairs
SMART cDNA Library construction Kit kits are taken charge of, build the SMART cDNA libraries of sequencing.Use Roche
454 sequenators complete the sequencing of Large Scale Transcriptional group.
The initial data of the transcript profile of acquirement is pre-processed, removes joint sequence and primer sequence, removes low quality
With short length sequence.Obtain treated sequence totally 708175.
Sequence after above-mentioned processing is spliced using Newbler softwares (2.6 version), " Use duplicate are set
Reads ", " Extend low depth overlaps ", " Minimus read length " are 45bp, " Reads limited
To one contig ", " Single ACE file " are finally assembled into 9377 Isotig and 23088 Singlets.
The searching of 3 candidate antigen genes of embodiment：
To 9377 Isotig and 23088 Singlets of transcript profile, first using Tandem Repeats Finder
Software (3.3.0.0 versions) finds tandem repetitive sequence, parameter setting：" Alignment Parameters [match,
Mismatch, indel] " it is 2,7,7；" Minimum Alignment Score To Report Repeat " is 50；
" Maximum Period Size " is 2000.Then by Minimum Alignment Score To Report Repeat values
CDNA sequence more than 50 uses the Open Reading Frame Finder (http of NCBI://
Www.ncbi.nlm.nih.gov/projects/gorf/ open reading frame sequence) is found；Finally amino acid sequence is used
4.1 software (http of SignalP://www.cbs.dtu.dk/services/SignalP/) it predicts whether containing signal peptide sequence
Row.
Using above-mentioned strategy, found altogether in Babesiamicrofti transcript profile 8 assembling sequences contain tandem repetitive sequence and
Signal peptide sequence structure, wherein, Isotig00186 sequences are compared through BLAST, are a novel gene.The sequence
2864bp, 402-2804bp are open reading frame.The nucleotide sequence of Isotig00186 such as SEQ ID NO：Shown in 1.
The amino acid sequence such as SEQ ID NO that Isotig00186 is derived：Shown in 2.
(the results are shown in Table 1) is analyzed by Tandem Repeats Finder softwares, Isotig00186 sequences share 2 string formations
Join repetitive sequence, first group is located at 1674-2013bp, and (i.e. 48 aa, the amino acid sequence of derivation are repetitive unit for 144bp
EENAIGENGDYDSDEDIDTNDVKEDHENAIDSEYTVSSTGDVLEDEVV), 2.4 repetition (such as SEQ ID NO：28 institutes
Show).Second group is located at 2089-2301bp, and for 72bp, (i.e. 24 aa, amino acid sequence are repetitive unit
DTTPTENVDTIPTKNANTTPTKNA), 3 repetition (such as SEQ ID NO：Shown in 29).2 groups of tandem repetitive sequences such as Fig. 2 institutes
Show.The amino acid sequence derived as the open reading frame sequence contained by Isotig00186, it is online using 4.1 softwares of SignalP
Analysis, D values (1-23) are 0.606, show that 1-23aa is signal peptide structure in the amino acid sequence (see Fig. 3).
1. TRF analysis result tables of table
| Indices | 1674--2013 | 2082--2318 | 2089—2301 |
| Period Size | 144 | 24 | 72 |
| Copy Number | 2.4 | 9.9 | 3 |
| Consensus Size | 144 | 24 | 72 |
| Percent Matches | 96 | 86 | 90 |
| Percent Indels | 1 | 0 | 0 |
| Score | 619 | 303 | 345 |
The blastx sequence alignment analysis of 4 Isotig00186 of embodiment：
By the nucleotide sequence of Isotig00186, online blastx sequence alignment analysis (Fig. 4) is carried out in NCBI.Through
Blastx sequence alignment analysis, by the Isotig00186 amino acid sequences derived and 4 hypothesis albumen homologies, wherein, with
unnamed protein product[Babesia microti strain RI](GenBank：CCF72660 homology)
It is 98%, is less than 37% with the homology of remaining 3 hypothesis albumen.However, unnamed protein product [Babesia
Microti strain RI] RI plants of progress gene order-checkings of Babesiamicrofti are derived by scholars such as Cornillot E
It is assumed that albumen, does not make further identification and functional study.
The clone of 5 Bm186 genes of embodiment：
According to the nucleotide sequence of Isotig00186ORF, design reverse transcription primer (Bm186GSP：
GTACCAGATATGTCC), forward primer (Bm186F：) and reverse primer (Bm186R ATGTGTTTAAAGCAAATCATCAAT：
CTAACAATCTACATCGGTGAC).Use the SuperScript of invitrogen companiesTMII RT reverse transcriptases are to extraction
Babesiamicrofti total serum IgE carries out reverse transcription, and the cDNA of gained is as template, further PCR amplification, reaction condition：95℃5min；
94℃l min；55℃1min；72 DEG C of 3min, totally 35 recycle；72℃7min.RTPCT results are shown in Fig. 5.Obtained PCR fragment
It is connect with pGEM T-easy carriers, builds T_Bm186 plasmids, convert into E.coli DH5 α, select the sequencing of monoclonal bacterium colony
(by Hua Da gene sequencing), obtains the complete sequence of target gene.According to the Isotig serial numbers of transcript profile sequencing analysis, ordered
Entitled Bm186.The sequence for the Isotig00186 that the nucleotide sequence of Bm186 genes is assembled with transcript profile sequencing analysis differs only by
One base (the 1059th bit base becomes C from A).The amino acid sequence (Bm186 albumen) of derivation is made of 801 amino acid,
The amino acid sequence derived with Isotig00186 is completely the same.The albumen n end has the signal peptide structure of a 23aa, 726-
748aa regions are transmembrane region (see Fig. 6).There are two groups of tandem sequence repeats peptide sequences in entire sequence, 424-537aa regions are the
One group of tandem sequence repeats peptide sequence, 563-634aa regions are second group of tandem sequence repeats peptide sequence.The nucleotide of Bm186 genes
Sequence such as SEQ ID NO：Shown in 3.The amino acid sequence of Bm186 albumen such as SEQ ID NO：Shown in 4.
The expression of 6 Bm186 recombinant proteins of embodiment
1. the expression of pET28a-Bm186DST recombinant proteins：
According to Bm186 gene orders, design forward primer (PBm186F：
) and reverse primer (PBm186R CATGCCATGGAAACACTTGTATCTAAAATTACA：
CCGCTCGAGATCATATGAAGCAATACCGGC).Using T_Bm186 plasmids as template, PCR amplification (reaction condition is carried out：95℃
5min；94℃l min；56℃1min；72 DEG C of 3min, totally 30 recycle；72℃7min).PCR product is with the bis- enzymes of NcoI/XhoI
It cuts, is connect with the pET28a plasmids through NcoI/XhoI double digestions, successfully build pET28a-Bm186DST expression vectors.Further
Conversion expands, extraction plasmid, after sequence verification, Transformed E .coli Rosetta 2 (DE3) competence is thin to E.coli DH5a
Born of the same parents.The bacterium of conversion is transferred to LB culture mediums (50ug/ml containing kanamycins and chloramphenicol 34ug/ml) in 37 DEG C of cultures to extinction
When degree (A595 values) is 0.6, adds in IPTG (final concentration of 1mmol/L) and continue to cultivate 4h, collect thalline.Insolubility recombinates egg
It is carried out in vain according to histidine-tagged protein expression and purification kit (Qiagen companies) albuminous degeneration purification process method.Fig. 7
It is the expression identification of pET28a-Bm186DSTRosetta2 (DE3) recombinant protein；Fig. 8 is pET28a-Bm186DST
Rosetta2 (DE3) recombinant proteins denaturation way purifies 12% polyacrylamide gel electrophoresis figure, M：Protein marker；F：
Efflux (pH8.0)；C1-C4：Buffer C liquid (pH6.3)；D1-D4：Buffer D liquid (pH5.9)；E1-E5：Buffer E
Liquid (pH4.5).The pET28a-Bm186DST recombinant proteins of insolubility are concentrated in the eluent of Buffer E (E1 pipes).
The nucleotide sequence of pET28a-Bm186DST such as SEQ ID NO：Shown in 5.The amino acid of pET28a-Bm186DST recombinant proteins
Sequence such as SEQ ID NO：Shown in 6.
2. the expression of pET28a-Bm186MT recombinant proteins：
To improve the expression quantity of destination protein, according to Bm186 gene orders, design forward primer (PBm186MF：
) and reverse primer (PBm186MTR CATGCCATGGTTTTATTGTTTAAGAACGTG：
CCGCTCGAGAATGGTGAATAATAAATTAACATCA).Using T_Bm186 plasmids as template, PCR amplification (reaction condition is carried out：
95℃5min；94℃l min；55℃1min；72 DEG C of 3min, totally 30 recycle；72℃7min).PCR product is with NcoI/XhoI
Double digestion is connect with the pET28a plasmids through NcoI/XhoI double digestions, successfully builds pET28a-Bm186MT expression vectors.Into
One step is converted to E.coli DH5a, is expanded, extraction plasmid, and after sequence verification, Transformed E .coli BL21 (DE3) competence is thin
Born of the same parents.It is 0.6 that the bacterium of conversion, which is transferred to LB culture mediums (containing kanamycins 50ug/ml) and is cultivated in 37 DEG C to absorbance (A595 values),
When, it adds in IPTG (final concentration of 1mmol/L) and continues to cultivate 4h, collect thalline.Insolubility recombinant protein is according to histidine mark
Protein expression and purification kit (Qiagen companies) the albuminous degeneration purification process method of label carries out.Fig. 9 .pET28a-Bm186MT
The expression identification of BL21 (DE3) recombinant protein；Figure 10 is that pET28a-Bm186MT BL21 (DE3) recombinant protein denaturation way is pure
Change 12% polyacrylamide gel electrophoresis figure, M：Protein marker；C2, C4：Buffer C liquid (pH6.3)；D1-D4：
Buffer D liquid (pH5.9)；E1-E5：Buffer E liquid (pH4.5).The pET28a-Bm186MT recombinant protein collection of insolubility
In in the eluent of Buffer E (E1 pipes).The nucleotide sequence of pET28a-Bm186MT such as SEQ ID NO：Shown in 7.
The amino acid sequence of pET28a-Bm186MT recombinant proteins such as SEQ ID NO：Shown in 8.
3. the expression of pET28a-Bm186S recombinant proteins：
To realize the solubility expression of recombinant protein, according to Bm186 gene orders, design forward primer (PBm186SF：
) and reverse primer (PBm186SR CATGCCATGGTCGAAGATGGACAATCAATC：
CCGCTCGAGATATGTCGAATTTTTATCTTCCAA).Using T_Bm186 plasmids as template, PCR amplification (reaction condition is carried out：
95℃5min；94℃l min；56℃1min；72 DEG C of 3min, totally 30 recycle；72℃7min).PCR product is with NcoI/XhoI
Double digestion is connect with the pET28a plasmids through NcoI/XhoI double digestions, successfully builds pET28a-Bm186S expression vectors.Into one
Step is converted to E.coli DH5a, is expanded, extraction plasmid, after sequence verification, Transformed E .coli BL21 (DE3) competent cell.
The bacterium of conversion is transferred to LB culture mediums (containing kanamycins 50ug/ml) when 37 DEG C of cultures to absorbance (A595 values) are 0.6,
It adds in IPTG (final concentration of 1mmol/L) to continue to cultivate 4h, collects thalline.Soluble recombinant protein is according to histidine-tagged protein
Expression and the non denatured purification process method of purification kit (Qiagen companies) albumen carry out.Figure 11 is pET28a-Bm186S
The expression identification of BL21 (DE3) recombinant protein；Figure 12 is that the non denatured mode of pET28a-Bm186S BL21 (DE3) recombinant protein is pure
Change 12% polyacrylamide gel electrophoresis figure, M：Protein marker；1：Ni-NTA purifies efflux；2-3：Imidazoles containing 20mM
Cleaning solution the 2nd, 4 is managed；4-6：The 1-3 of imidazole elution containing 50mM is managed；7-9：The 1-3 of imidazole elution containing 100mM is managed；10-13：
The 1-4 of imidazole elution containing 250mM is managed.PET28a-Bm186S soluble recombinant proteins concentrate on washing for the imidazoles containing 50-100mM
In de- liquid.
The nucleotide sequence of pET28a-Bm186S such as SEQ ID NO：Shown in 9.The ammonia of pET28a-Bm186S recombinant proteins
Base acid sequence such as SEQ ID NO：Shown in 10.
7 Bm186 recombinant proteins of embodiment detect the evaluation of antibody effects：
BALB/c mouse 30 is taken, after intraperitoneal injection inoculation Babesiamicrofti 7 days, blood is taken to prepare infection by Babesia microti
Mouse serum, and 6 parts of infected mice serum are mixed at random, as the positive mouse serum of mixing.Equally, 30 parts of normal mouse serums are prepared, and
6 parts of normal mouse serums of mixing at random, as the negative mouse serum of mixing.
With recombinant protein difference coated elisa plate (Nunc companies, 96 orifice plates), 4 DEG C are overnight, pET28a-Bm186DST,
PET28a-Bm186MT and pET28a-Bm186S recombinant proteins coating concentration is 0.5 μ g/ml, per 100 μ l of hole, drying.It adds in
200 μ l of 1%BSA, 37 DEG C are closed 1 hour, and PBST is washed three times.Add in 1：200 diluted 100 μ l of mouse serum, 37 DEG C of reactions 1
Hour, PBST is washed three times.Add in 100 μ l HRP label sheep anti-mouse igg (Sigma companies, 1：5000 dilutions), 37 DEG C of reactions 1
Hour, PBST is washed four times.It adds in substrate TMB (Tiangeng company) to develop the color, microplate reader 450nm reading numerical values.
Using above-mentioned indirect ELISA method, to mix the antigen reactivity of three kinds of Bm186 recombinant proteins of mouse Virus monitory.
As a result such as table 2, the OD values for mixing positive serum are several times as much as mixing negative serum.Show three kinds of Bm186 recombinant proteins be respectively provided with compared with
High antigen reactivity.
The ELISA testing results of the antigen reactivity of 2. 3 kinds of Bm186 recombinant proteins of table
Using pET28a-Bm186MT and pET28a-Bm186S recombinant proteins, respectively with above-mentioned indirect ELISA method
(pET28a-Bm186MT and pET28a-Bm186S recombinant proteins coating concentration is respectively 0.5 and 1.0 μ g/ml), 30 parts of detection is just
Normal mouse serum and 30 parts of infection by Babesia microti mouse serum evaluate the diagnostic value of Bm186 recombinant proteins.
It is by the ELISA results for detecting antigen of pET28a-Bm186MT：30 parts of normal mouse serum mean OD values are 0.012
±0.007；The mean OD value of 30 parts of infected mices is 0.333 ± 0.091.4 times of SD are added as criterion using average value, OD values are big
It is the positive in 0.042, then 30 parts of infected mice serum are all positive, and 30 parts of normal mouse serums are feminine gender.The ELISA method it is quick
Perception and specificity are 100%.PET28a-Bm186MT recombinant proteins have high diagnostic value.The result is shown in Figure 13.
It is by the ELISA results for detecting antigen of pET28a-Bm186S：30 parts of normal mouse serum mean OD values are 0.006
±0.003；The mean OD value of 30 parts of infected mices is 0.303 ± 0.079.4 times of SD are added as criterion using average value, OD values are big
It is the positive in 0.020, then 30 parts of infected mice serum are all positive, and 30 parts of normal mouse serums are feminine gender.The ELISA method it is quick
Perception and specificity are 100%.PET28a-Bm186S recombinant proteins have high diagnostic value.The result is shown in Figure 14.
The detection of the immunogenicity of 8 Bm186MT recombinant proteins of embodiment
With pET28a-Bm186MT recombinant proteins, 6 BALB/c mouses are immunized.Per 30 μ g of mouse antigen inoculation, it is inoculated with for the first time
Using Freund's complete adjuvant (Sigma companies), it is subcutaneously injected；Every 3 weeks, freund 's incomplete adjuvant is mixed into using 30 μ g antigens
(Sigma companies) strengthens, intraperitoneal injection, altogether reinforced immunological 4 times.Mouse tail blood is taken to prepare serum.PET28a-Bm186MT is recombinated
Albumen coated elisa plate detects mouse immune effect with indirect ELISA method.It the results are shown in Table 3.The OD values of immune mouse serum are notable
Higher than normal mice.The experimental results showed that pET28a-Bm186MT recombinant proteins, the very strong immunogenicity of tool, BALB/c mouse pair
Recombinant antigen can generate strong immune response, easily prepare more/monoclonal antibody.It is prepared by monoclonal antibody.
The indirect ELISA testing result of 3. pET28a-Bm186MT recombinant protein immunogenicities of table
| #1 mouse | 0.348 |
| #2 mouse | 0.329 |
| #3 mouse | 0.300 |
| #4 mouse | 0.304 |
| #5 mouse | 0.310 |
| #6 mouse | 0.277 |
| Normal mice | 0.061 |
| PBST | 0.056 |
The development of the colloidal gold immunochromatographimethod strip of 9 Babesiamicrofti detection of specific antibody of embodiment
Nitrocellulose filter (NCM) is affixed on to the centre of plastic bottom board, then absorbing membrane and reagent pad are pasted on NCM respectively
Longitudinal both ends.Therebetween, absorbing membrane has Chong Die connection with NCM and NCM with reagent pad in its intersection.In NCM and reagent pad
Junction rubberizing paper as flow control.At the nearly absorbing membrane of NCM, laterally with linear coating staphylococcal protein A (SPA),
As Quality Control (Control, C) line.At the nearly reagent pad of NCM, laterally with linear coating pET28a-Bm186S solubility weights
Histone (concentration 0.2mg/ml), as detection (Test, T) line.3.5mm wide slittings, for use.
The Nucleation for the Regulation of of the document Controlled as written by Frens G the
Particle Size in Monodisperse Gold Suspensions (Nat Phys, 1973,241：Side 20-22)
Method with three sodium reduction gold chloride of citric acid, prepares the colloidal gold solution that particle diameter is 15nm, the document as written by Hayat MA
Colloidal Gold,Volume 1:Principles,Methods and Applications(Colloidal Gold:
Principles,Methods and Application)(Academic press.San Diego,U.S.A.1989：1-39)
Method, prepare SPA- colloidal gold conjugates.
Colloidal gold immunochromatographimethod strip is positioned over plane, 2 drop (80 μ l) SPA- colloid gold reagents are added in the examination of strip
Agent pad, the former quickly enters NCM.After colloid gold reagent enters NCM, 3.5 μ l test serums are added on flow control gummed paper end
NCM.Observation (or scanning achieves) is as a result, only C lines person is judged to feminine gender in 5-10 minutes；There are C and T line persons to be judged to the positive；Without C lines
Person is judged in vain.
Using Bm186S recombinant proteins-colloidal gold immunochromatographimethod strip, to 30 parts of normal mouse serums and 30 parts of vole babe
Insect infection mouse serum is detected, and as a result the strip can accurately distinguish total positives and negative serum, and sensibility and specificity is equal
For 100% (Figure 15).Colloidal gold immunochromatographimethod strip have the characteristics that it is easy, quick, be particularly suitable in base and onsite application,
Diagnosis for Babesiamicrofti disease provides new technology.
The Preliminary Applications of 10 Bm186S- colloidal gold immunochromatographimethod strips of embodiment
The outpatient's blood being had a fever using Bm186S recombinant proteins-colloidal gold immunochromatographimethod strip to 2880 unknown causes
It is detected clearly, finds that 39 serum are positive altogether.The whole blood of above-mentioned 39 outpatients is acquired, passes through QIAGEN companies
DNeasy Blood＆Tissue kit extract DNA, using TaKaRa companies Ex Taq enzymes, carry out nest-type PRC, specific amplification
18S rDNA and the Tubulin genetic fragments of Babesiamicrofti.
With the 18S rDNA specific fragments of following primer amplification Babesiamicrofti and Tubulin genetic fragments.
18s rDNA:
Outer primer：Piro1F (sense primer)：CCATGCATGTCTWAGTAYAARCTTTTA
RRNA-3 ' (downstream primer)：ATCCTTCYGCAGGTTCACCTAC
Inner primer：Bab1A (sense primer)：GTCTTAGTATAAGCTTTTATACAGCG
Prio6R (downstream primer)：CTCCTTCCTYTAAGTGATAAGGTTCAC
Tubulin:
Outer primer：BmTubu93F (sense primer)：GAYAGYCCCTTRCAACTAGAAAGAGC
BmTubu897R (downstream primer)：CGRTCGAACATTTGTTGHGTCARTTC inner primers：BmTubu192F (upstreams
Primer)：ACHATGGATTCTGTTAGATCYGGC
BmTubu782R (downstream primer)：GGGAADGGDATRAGATTCACAGC,
First round reaction condition：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 1min, 50 DEG C of annealing 1min, 72 DEG C extend
1.5min, 35 cycles, 72 DEG C of extension 10min, 12 DEG C of preservations.
Second wheel reaction condition：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 1min, 55 DEG C of annealing 1min, 72 DEG C extend
1.5min, 35 cycles, 72 DEG C of extension 10min, 12 DEG C of preservations.
First round PCR reaction system：
Second wheel PCR reaction systems：
The expection amplified fragments size of 18S rDNA is about 1700bp, and Tubulin genes are expected amplified fragments size and are about
590bp。
Detect in verification outpatient's whole blood whether the 18S rDNA containing Babesiamicrofti are specific by this nest-type PRC
Segment or Tubulin genetic fragments.
As a result：4 there are 18S rDNA specific bands, and 9 Tubulin genetic fragments occur, and 1 18S occurs simultaneously
RDNA specific bands and Tubulin genetic fragments.Above-mentioned 5 18S rDNA specific bands and 10 Tubulin gene pieces
Section is completely the same with the sequence of 18S rDNA and the Tubulin genes of Babesiamicrofti through sequencing and BlastN sequence alignments.
Show：It is detected through PCR, contains Babesiamicrofti nucleic acid specific fragment in this 39 outpatients at least 14 whole bloods.
That is the colloidal gold immunochromatographimethod strip positive of at least 35.9% (14/39) has infected Babesiamicrofti.Show：Bm186S is recombinated
Albumen-colloidal gold immunochromatographimethod strip has preferably immune Effect of screening.
Claims (11)
1. a kind of gene of separation, it is characterised in that：Its gene order such as SEQ ID NO：Shown in 3.
2. a kind of 186 antigen proteins of Babesiamicrofti Bm, it is characterised in that：It is compiled by the gene of separation described in claim 1
Code, amino acid sequence such as SEQ ID NO：Shown in 4.
3. a kind of antibody, it is characterised in that：A kind of Babesiamicrofti Bm186 with reference to described in claim 2 of its specificity resists
Former albumen.
4. a kind of antibody as claimed in claim 3, it is characterised in that：The antibody is monoclonal antibody.
5. a kind of carrier, it is characterised in that：The carrier contains a kind of coding gene of separation described in claim 1.
6. a kind of host cell, it is characterised in that：The cell contains carrier described in claim 5 or described thin
Born of the same parents' genetic transformation or transfection for encoding a kind of separation described in claim 1.
7. a kind of kit, it is characterised in that：Vole bar described in gene, claim 2 containing separation described in claim 1
Antibody described in 186 antigen proteins of shellfish worm Bm or claim 3.
8. a kind of recombinant protein, it is characterised in that：Its amino acid sequence such as SEQ ID NO：6 or SEQ ID NO：8 or
SEQ ID NO：Shown in 10.
9. a kind of colloidal gold immunochromatographimethod strip, it is characterised in that：Contain recombinant protein according to any one of claims 8.
10. a kind of antibody, it is characterised in that：The combination recombinant protein according to any one of claims 8 of its specificity.
11. a kind of kit, it is characterised in that：Contain recombinant protein according to any one of claims 8 or according to any one of claims 10
Antibody.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510270487.XA CN104845982B (en) | 2015-05-25 | 2015-05-25 | Babesiamicrofti Bm186 antigens and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510270487.XA CN104845982B (en) | 2015-05-25 | 2015-05-25 | Babesiamicrofti Bm186 antigens and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104845982A CN104845982A (en) | 2015-08-19 |
| CN104845982B true CN104845982B (en) | 2018-06-19 |
Family
ID=53845971
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510270487.XA Active CN104845982B (en) | 2015-05-25 | 2015-05-25 | Babesiamicrofti Bm186 antigens and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104845982B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180372742A1 (en) * | 2015-12-10 | 2018-12-27 | Immport Therapeutics, Inc. | Babesia Biomarkers for Diagnostic and Screening In Vitro Diagnostic Test |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1649890A (en) * | 2002-03-01 | 2005-08-03 | 昆士兰医学研究所理事会 | Anti-protozoal vaccine |
| CN1665530A (en) * | 2002-07-10 | 2005-09-07 | 阿克佐诺贝尔公司 | Immunogenic composition |
-
2015
- 2015-05-25 CN CN201510270487.XA patent/CN104845982B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1649890A (en) * | 2002-03-01 | 2005-08-03 | 昆士兰医学研究所理事会 | Anti-protozoal vaccine |
| CN1665530A (en) * | 2002-07-10 | 2005-09-07 | 阿克佐诺贝尔公司 | Immunogenic composition |
Non-Patent Citations (4)
| Title |
|---|
| Sequencing of the smallest Apicomplexan genome from the human pathogen Babesia microti;Cornillot E.等;《Nucleic Acids Res.》;20121231;第40卷(第18期);9102-9114 * |
| Whole genome mapping and re-organization of the nuclear and mitochondrial genomes of Babesia microti isolates;Cornillot E.等;《PLOS ONE》;20131231;第8卷(第9期);E72657 * |
| 田鼠巴贝虫可溶性抗原组分分析及其初步应用;张加等;《中国人兽共患病学报》;20141231;第30卷(第5期);469-472 * |
| 田鼠巴贝虫感染诊断抗原的筛选及相关基因的克隆表达;孙嘉慧;《中国优秀硕士学位论文全文数据库》;20140315;摘要和表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104845982A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111239394B (en) | Novel coronavirus antibody rapid detection kit based on mixed antigens | |
| CN111285933A (en) | Novel coronavirus antigen colloidal gold diagnostic kit | |
| CN105384803B (en) | A kind of Schistosoma japonicum recombinant protein SjSAPLP4 and its encoding gene and application | |
| CN112920278B (en) | Novel coronavirus specific fusion protein antigen and preparation method and application thereof | |
| CN104845981B (en) | Babesiamicrofti Bm1524 antigens and its application | |
| CN107056898A (en) | 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application | |
| CN110684116B (en) | Mycobacterium tuberculosis EEC fusion protein, preparation method and application thereof | |
| AU2020102599A4 (en) | Indirect ELISA Detection Method and Application of DHAV-3 Antibody Based on VP2 or VP4 Recombinant Protein Antigen | |
| CN108680744B (en) | Indirect ELISA detection kit for detecting novel duck reovirus antibody and application thereof | |
| CN104650195A (en) | EV71 virus VP1 recombinant antigens as well as monoclonal antibody and application of eV71 virus VP1 recombinant antigens | |
| CN113637056A (en) | Kit for identifying Brucella melitensis and Brucella melitensis of other species | |
| CN111621506B (en) | Mycoplasma bovis secretory protein Mbovp0145 and application thereof | |
| CN112111006B (en) | Antibody for resisting bovine sarcoidosis virus, detection test paper and kit | |
| CN111548423B (en) | Mycoplasma pneumoniae fusion antigen and preparation method and application thereof | |
| CN104845982B (en) | Babesiamicrofti Bm186 antigens and its application | |
| JP2017531657A (en) | Recombinant Borrelia protein and method for its use | |
| CN111978410A (en) | Fusion protein of brucella outer membrane protein OMP25 and periplasmic protein BP26 as well as expression and application thereof | |
| CN108982847B (en) | Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis | |
| Yathi et al. | Determination of B cell epitopes and evaluation of antigen capture ELISA for the earlier diagnosis of CHIK virus using anti-rCHIK E1 rabbit antibodies | |
| CN105906716B (en) | Preparation and application of echovirus 9 type VP1 protein specific epitope and fusion protein thereof | |
| CN105254732B (en) | A kind of Schistosoma japonicum recombinant protein SjSAPLP5 and its encoding gene and application | |
| CN104710537A (en) | Coxsackie virus CA16 VP1 recombinant antigens, and monoclonal antibodies and application thereof | |
| CN106978425B (en) | The albumen of Babesia orientalis 1-deoxy-D-xylulose -5- phosphoric acid reduction isomerase gene and its coding | |
| WO2015172706A1 (en) | Screen of schistosoma mansoni diagnostic antigen and use | |
| CN113265005B (en) | Sore mouth disease virus antibody capture agent, kit, detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |