JP2017531657A - Recombinant Borrelia protein and method for its use - Google Patents

Abstract

A method for determining a sample for the presence of an antibody against a Borrelia burgdorferi recombinant protein and a protein of Borrelia burgdorferi is described, and a method for diagnosing Lyme disease is also described. A microarray of Borrelia burgdorferi proteins is also described.

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is filed in US Provisional Patent Application No. 62 / 076,059 filed on November 6, 2014 and US Provisional Patent Application No. 62/0 filed on October 7, 2014. Claims the benefit of 060,867. The entire teachings of the above applications are incorporated herein by reference.

INCORPORATION BY REFERENCE OF MATERIALS IN ASCII TEXT FILE This application incorporates by reference the sequence listing contained in the following ASCII text file filed concurrently therewith.
a) File name: 43381001002_SEQUENCELISTING. txt: Created on October 6, 2015, size 120KB.

Government Support This invention was made with government support under CK000150 from the Centers for Disease Control (CDC). The government has certain rights in the invention.

  Lyme disease is the most common vector-borne disease in North America and Europe, and its scope and incidence is increasing. Human Lyme disease is caused by several members of a closely related group of spirochetes belonging to the bacterial complex that causes Lyme disease (Borrelia burgdorferi sen lato species complex). Spirochetes are transmitted to humans through ticks of the tick genus (Steel, AC, N. Engl. J. Med. 1989; 321: 586-96). It is a progressive multi-organ disorder characterized by early skin infections that can spread early in infection to secondary sites including the nervous system, heart, and joints (Maszawa, T. et al., Microbiol. Immunol. 1996; 40: 539-45; Stanek, G., Infection 1991; 19: 263-7). Accurate diagnosis and treatment of Lyme disease is an objective clinical abnormality. Rely on correlating with serological evidence of exposure to burgdorferi.

  The present invention encompasses novel recombinant Borrelia burgdorferi proteins and their use in a very sensitive and specific method for diagnosing Lyme disease in a subject. In particular, the present invention relates to a recombinant Borrelia fusion protein construct comprising at least three recombinant Borrelia burgdorferi protein antigens. These constructs are also referred to herein as Borrelia chimeric protein antigens or Borrelia chimeras. Fusion protein constructs are described herein in Tables 4, 5, 6 and 8.

  The invention also uses one or more or all of these recombinant Borrelia fusion proteins in an assay to determine the test sample to detect the presence of antibodies against Borrelia burgdorferi in the test sample. Also relates to a method for For example, the Borrelia fusion proteins described herein (eg, Tables 4, 5, 6, and 8) can be used in detection methods and ELISA, other immunological assays, or antibody-antigen binding or antibody-antigen binding complexes. It can be used to prepare protein arrays or microarrays for use in any assay method that can detect the body. In addition to the use of the Borrelia fusion proteins of Tables 4, 5, 6, and 8 in these detection assays, one or more additional recombinant Borrelia antigens, such as the recombinant Borrelia antigens listed in Table 1, etc. Can be included in such assays or microarrays. In one embodiment of the invention, the microarray comprises the 25 recombinant Borrelia antigens and chimeric proteins of Table 6. In another embodiment, the microarray comprises 11 recombinant Borrelia antigens and chimeric proteins of Table 8.

  For one or more recombinant Borrelia burgdorferi fusion proteins of Tables 4, 5, 6, or 8 or antibodies reactive with the recombinant Borrelia antigens listed in Table 1 or more A method for diagnosing Lyme disease in a subject (such as a mammal including a human) by determining an obtained test sample, also referred to herein as an antibody-antigen reactant (antibody-antigen reaction product) Further encompassed by the present invention is a method wherein detection of an antibody-antigen binding complex, etc.) indicates that the individual has Lyme disease. Such assays for detecting antibody-antigen complexes are well known to those skilled in the art. In certain embodiments of the invention, microarrays are used in detection / diagnostic assays, the microarrays are recombinant Borrelia chimeric proteins described herein in Tables 4, 5, 6, and 8, and further in Table 1. Including the recombinant Borrelia antigen described. In one embodiment of the invention, the microarray comprises the 25 recombinant Borrelia antigens and chimeric proteins of Table 6. In another embodiment, the microarray comprises 11 recombinant Borrelia antigens and chimeric proteins of Table 8.

  As a result of this discovery, very sensitive and specific methods and microarrays are currently available for the evaluation of test samples for the presence of antibodies against Borrelia proteins. The presence of such antibodies is useful for diagnosis of Lyme disease. Moreover, the methods can be used to identify potential diagnostic candidates and vaccine candidates for Lyme disease.

The foregoing will become apparent from the following more detailed description of example embodiments of the invention, as illustrated in the accompanying drawings, in which like reference numerals refer to the same parts throughout the various views. I will. The drawings are not necessarily to scale, emphasis instead being placed upon describing embodiments of the invention.
The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6. The figure shows the amino acid sequences of the chimeric antigens (SEQ ID NOs: 3-27) and OC2 / 9 variants (SEQ ID NOs: 28-30) of Table 6.

  The description of exemplary embodiments of the present invention continues.

  Accurate and reliable diagnostic assays for Lyme disease are essential to ensure successful treatment and recovery. However, serodiagnosis of the disease is described in B.C. The high level of genetic heterogeneity of Burgdorferi isolates makes it extremely difficult even among those collected from one place. In addition, current serodiagnostic tests for Lyme disease are found in the early stages of B. There is a lack of sensitivity and specificity for detecting Burgdorferi infections. In the present invention, 48 highly antigenic Borrelia proteins have been identified. These recombinant Borrelia protein antigens are recognized by the majority of all analyzed serum samples, including sera from patients with early Lyme disease. In addition, this library of highly antigenic Borrelia proteins includes the set of recombinant Borrelia chimeric antigen proteins shown in Tables 4, 5, and 6 and the 25 recombinant and chimerics of Table 6 described herein. It was used to develop a very sensitive and specific recombinant protein-based assay containing antigen or 11 recombinant antigens and recombinant chimeric antigen (Table 8).

  It has been discovered that antibodies against certain cell coat proteins are present in the serum of individuals with Lyme disease. Microarrays containing recombinant Borrelia burgdorferi antigenic protein and chimeric antigen were prepared as described herein. The microarray was exposed to test samples such as serum from individuals previously diagnosed with disseminated Lyme disease. The results showed that the sera of individuals with Lyme disease reacted with the specific recombinant Borrelia proteins shown in Tables 1, 4, 5, 6, and 8. In particular, a number of sera from individuals reacted with a specific subset of proteins such as those shown in Tables 6 and 8. The results showed that the sera of individuals with Lyme disease reacted with the recombinant and chimeric Borrelia proteins shown in Tables 1 and 4 and 5, in particular with the highly immunogenic proteins shown in Tables 6 and 8. . The overall sensitivity and specificity of the Lyme disease assay described herein is shown in Tables 2, 3, 7, 9, and 10.

  In certain methods and microarrays of the invention, one or more recombinant cell envelope protein antigens, recombinant antigens, and / or chimeric antigens (fusion protein constructs) are used. In certain embodiments, a set of two or more antigens is used. Other embodiments encompassed herein include up to 11 antigens such as 3 antigens in Table 8, 4 antigens, 5 antigens, 16 antigens in Table 4, 25 antigens in Table 6, Table 5 96 antigens, or 48 antigens of Table 1 or all antigens of the preceding table. A representative set includes the set of proteins shown in Tables 1, 4, 5, 6, and 8. Such a set can further include homologues and paralogs of the cell coat protein. In one particular embodiment, the set consists essentially of the antigens shown in Table 6. In another specific embodiment, the set consists essentially of the antigens shown in Table 8.

  In further methods and microarrays of the invention, one or more other proteins identified herein are used, and other combinations of proteins are used (eg, Tables 1, 4, 5, 6). And a protein selected from any one of 8). Such combinations include two or more, three or more, four or more, five or more, six or more, seven or more, eight or more or of proteins Other sets of groups (eg, having one or more selected from Table 1, Table 5, and / or Table 6).

  In another embodiment of the invention, a test sample from an individual is A determination is made of the presence of antibodies against one or more proteins (eg, recombinant or chimeric antigens) of Burgdorferi. A “test sample” is a sample of blood, serum, cerebrospinal fluid, or other suitable biological fluid from an individual. In the method, a test sample is determined for the presence of antibodies to one or more proteins using routine methods established in the art. In one particular embodiment, the assessment is performed using a microarray of Borrelia proteins. In one method, for example, an array, eg, a microarray described below or a protein or set of proteins described herein, is exposed to a test sample from an individual, and any resulting binding of an antibody to the protein ( Is determined) if present in the test sample. The presence of an antibody (also referred to herein as “reactive with”) that binds to one or more antigens indicates that the antibody It is specific for the protein of burgdorferi. The presence of such antibodies is useful for diagnosis of Lyme disease in the individual from whom the test sample was obtained.

  The assay methods described herein are described in B.A. Includes an array of burgdorferi antigens. In one embodiment, the array is a B.I., such as a protein set as described in Tables 1, 4, 5, 6, or 8. Contains a subset of recombinant proteins from Burgdorferi. In other embodiments, the other array is two or more, four or more, six or more, six or more, or eight or more of the antigenic proteins listed in Tables 1, 5, or 6. B. Like other group sets, etc. Includes various subsets of Burgdorferi proteins. In one particular embodiment, the microarray consists essentially of all of the proteins listed in Table 6 or consists of all of the proteins listed in Table 6. In another specific embodiment, the microarray consists essentially of all of the proteins listed in Table 8 or consists of all of the proteins in Table 8. In further embodiments, other microarrays may be used for B. cerevisiae, such as a subset of the proteins described in Table 1 or Table 5. Including various subsets of Burgdorferi proteins (2 or more, 4 or more, 6 or more, 8 or more, or other groups of proteins listed in Table 6 or Table 8 Set).

  Another embodiment of the present invention is the use of B. cerevisiae as a potential candidate for the development of a diagnostic test for Lyme disease. B. as a potential candidate for the determination / evaluation of other or additional proteins of Burgdorferi and for the development of vaccines to further protect against Lyme disease. Includes methods for the assessment of Burgdorferi proteins. In these methods, B.D., such as those described herein in Table 6 or Table 8. One or more proteins of burgdorferi (eg, in the microarray described above) are exposed to serum from one or more individuals known to have Lyme disease and then derived from the serum The protein to which the antibody binds is determined. For example, a fluorescence Cy5 intensity / Cy3 intensity ratio can be used as described in the examples. The ratio of the average reactivity of lye serum to the negative control plus the ratio of any protein that exceeds 3 times the standard deviation is the antibody present in A significant interaction between the burgdorferi proteins is shown. It is reasonable to consider such proteins useful in vaccine compositions for eliciting an immune response in a subject, as described below. Such proteins are also proteins that can be used in diagnostic tests for Lyme disease (eg, in the methods described above) and in the microarrays described herein, as well as possible. Can be used as a vaccine candidate.

  The proteins identified herein as reactive with the serum of individuals with Lyme disease are useful as vaccine immunogens against Borrelia infections. Accordingly, the present invention also relates to pharmaceutical compositions that can be used to vaccinate and / or treat Borrelia infections in animals or humans. In certain embodiments, the pharmaceutical composition is one or more Borrelia burgdorferi antigens such as those shown in Tables 5, 6 or 8, or another such as those shown in Table 1. Or other proteins derived from the Borrelia burgdorferi antigen or cell coat protein (eg, US Pat. No. 6,248,562, the entire teachings of which are incorporated herein by reference) , 008,625; U.S. Pat. No. 7,060,281; and U.S. Pat. No. 7,179,448, etc. Proteins that have modifications such as alterations or proteins that form part of a chimeric protein). Combinations of the proteins described herein (eg, the proteins of Tables 1, 5, 6, and 8) can also be used.

  The pharmaceutical composition can also be administered with physiologically acceptable carriers, excipients, and / or adjuvants. Suitable adjuvants are well known in the art (see, eg, WO 96/40290, the entire teachings of which are incorporated herein by reference), eg, of proteins in animals to be treated It can be used to enhance immunogenicity, efficacy, or half-life.

  Pharmaceutical compositions used to vaccinate and / or treat Borrelia infections can be prepared using methods for preparing vaccines well known in the art. For example, the proteins described herein can be obtained by known techniques, such as by size exclusion chromatography, affinity chromatography, ion exchange chromatography, preparative electrophoresis, selective precipitation, or combinations thereof. It can be isolated and / or purified. The prepared protein can be mixed with other suitable reagents described herein such that the protein is at a suitable concentration. The dosage of protein will vary and will depend on the age, weight, and / or physical condition of the animal, eg, mammal, human, to be treated. Optimal dosages can be determined by routine optimization techniques using suitable animal models.

  Administration of a pharmaceutical composition used as a vaccine can be by any suitable technique. Suitable techniques for administration of the pharmaceutical composition include injection, eg subcutaneous injection, intramuscular injection, intravenous injection, intraperitoneal injection; mucosal administration, eg exposure of nasal mucosa to nasal drops containing the protein of the invention Oral administration; and DNA immunization, including but not limited to:

  Moreover, the proteins identified herein as reacting with the sera of individuals with Lyme disease (eg, the proteins shown in Tables 1 and / or Tables 4 and / or Tables 5, especially Tables 6 and 8) and the present specification The methods described in the book can be used as prognostic markers that allow one of ordinary skill in the art to tailor treatment for a disease by targeting their specific proteins. For example, if an individual's serum is reactive with a particular subset of proteins, those in an individual can be demonstrated, as indicated by reducing and / or eliminating the reactivity of the individual's serum with those proteins. Therapy can be initiated to reduce and / or eliminate the presence of other proteins.

  The present invention also relates to diagnostic and / or prognostic kits comprising the proteins described herein (eg, in the microarray described above). The kit also includes a reagent for detecting antibody-antigen complexes formed between the protein and the antibody, eg, an antibody present in a host sample provided by the user.

  Particular embodiments of the present invention are described in the following examples, which are not to be construed as limiting in any way.

Example 1: Discovery of 48 Borrelia antigens Protein array. A total of 416 genes are Identified by comparison of the Burgdorferi genome. Of these, 350 (84%) produced products that were accurate in size when PCR was performed, and all 350 were successfully cloned into the T7 expression vector pET28b. The sequence verified plasmid was expressed using its overnight automated expression system, and the expressed protein was purified using IDA resin and printed on nitrocellulose coated FAST slides (eg, the teachings herein are U.S. Patent Application Publication No. 12 / 784,584 and U.S. Patent Application Publication No. 12 / 989,003, which are incorporated herein by reference). Moreover, several representative different OspC types were amplified from human isolates. The OspC types included in this study were A, B, C, D, E, F, G, H, I, J, K, and U types. This study also included the highly antigenic B31 cell coat protein identified in early protein array studies (Xu Yet al, 2008). In total, the array contained approximately 400 samples, including expressed Borrelia protein, negative controls, and blanks. Arrays were probed with sera from patients with Lyme disease and antibodies were visualized with Cy5-conjugated goat anti-human IgG or Cy5-conjugated goat anti-human IgM to determine antibody isotype (Xu Y et al, 2008).

  Serum sample. Sera from patients with Lyme disease were obtained from the Centers for Disease Control (CDC) for early array studies. The CDC samples are for initial symptoms (sample C = 0 day) and on day 10 (sample D), 20 days (sample E), 30 days (sample F), 60 days (sample G), and Serum from 31 patients collected after 90 days (Sample H) was included. Fourteen end-stage lime samples (end-stage) from patients with end-stage clinical symptoms (Lyme arthritis or neuroborreliosis) obtained from the Lyme Disease Center at Stoney Brook University were also analyzed. A total of 115 samples were analyzed, including 21 samples C, 29 samples D, 15 samples E, 8 samples F, 1 samples G, and 12 samples H. Normal control serum (n = 14) was obtained from a healthy donor.

  Serum was obtained from Dr. Mark Soloski, Johns Hopkins School of Medicine, Baltimore MD to further determine the protein array. Samples were taken during initial symptoms (sample V1 = diagnosed early lime, before treatment) and 3 weeks when symptoms occurred (sample V2 = 3 weeks after diagnosis / and beginning of treatment), 7 weeks (sample V3 = diagnosis) Sera from 50 patients collected after / 7 weeks after treatment), as well as after 15-17 weeks (sample V4 = about 15-17 weeks after diagnosis / treatment). A total of 46 samples per group were analyzed. For specificity studies, sera were obtained from patients with diseases associated with serological responses known to produce cross-reactivity in Lyme disease testing. These included patients with syphilis, lupus, and rheumatoid arthritis. Normal control serum was obtained from a healthy donor.

  result. Approximately 140 of the array proteins were happy to elicit an antibody response in humans with natural infection using both secondary antibodies. Of these 140 antigens, 80 proteins were recognized by at least half of the serum samples from each time point. Importantly, most sera recognized at least one antigen from a subset of 48 highly antigenic Borrelia proteins using IgM and IgG secondary antibodies (Table 1). This high degree of positivity included all sera collected when migrating erythema was first seen in the patient. The Cy5 / Cy3 ratio of these 48 proteins was observed at the highest level in the array, and on average exceeded the average ratio of lyse serum reactivity to negative controls by 5 times the standard deviation. Moreover, BLASTx searches with highly immunogenic Borrelia proteins against the NCBI non-redundant protein database, excluding all recorded Borrelia sequences, showed no significant matches to other organisms. Interestingly, 40 of the 48 antigens are encoded in plasmids and most of the encoded proteins are cell surface proteins, lipoproteins, or putative outer membrane proteins. Over 90% of the plasmid gene sequence is non-B. It has no significant homologue to the Burgdorferi gene. The peculiarities of the plasmid sequences suggest that they play a special, adaptive aid for the survival and growth of Borrelia in nature and in a wide variety of hosts. In addition, many cell surface lipoproteins encoded by plasmids that are related to the variability of plasmid sequences are those sequences that are directly involved in parasite-host interactions, and thus are almost certainly the key immunogen and Support the view that (Casjens et al, 2000).

  The sensitivity of the assay described herein is far superior to the commercially available Lyme disease assay in early patients with disease. The sensitivity of the assay of the present invention was compared in a two-tier testing with 48 Borrelia antigens using 29 patients with early Lyme disease. Among 29 patients with EM, the sensitivity of our protein array using IgM or IgG secondary antibodies is 96% during initial symptoms (sample V1) and 97% during the recovery phase after 3 weeks (Sample V2). In comparison, the percentages were 48% and 69%, respectively, for the standard two-stage test. The overall sensitivity and specificity of the lime assay described herein for this set of serum samples is shown below in Tables 2 and 3.

Example 2: Protein array using recombinant chimeric Borrelia protein.
Overview. A library of chimeric proteins using 48 highly antigenic Borrelia proteins was designed for use in developing a recombinant chimera-based diagnostic assay for Lyme disease. Recombinant chimeric constructs containing genes from several genetic species make it possible to produce certain proteins that confer antigenicity to multiple strains, indicating the great potential and adaptability of this technology. Moreover, the use of pure protein preparations as antigens provides greater flexibility in adapting the test to various assay formats. B. Recombinant chimeric protein assay for early disease when compared to the best whole cell assay. It is reasonable to think that it will show excellent sensitivity in detecting antibodies against Burgdorferi and equivalent sensitivity for end-stage disease.

  Chimeric protein. From our library of 48 highly antigenic Borrelia proteins, we constructed 16 sets of chimeric proteins each containing 3 of the Borrelia antigens (Table 4). Randomly assign each Borrelia protein to a fusion construct and synthesize all six possible protein order combinations to determine whether secondary structure characteristics can affect the presentation of protein epitopes did. The 96 fusion constructs are shown in Table 5. Three Borrelia antigen chimeras were chosen to keep the fusion protein at a molecular weight of about 100 kDa or less (below) in order to optimize protein yields where protein size could be significantly affected.

  Cloning of recombinant fusion proteins. 48B. The Borrelia gene encoding the Burgdorferi antigen was amplified using a unique gene-specific primer pair specially designed by the inventors for the construction of chimeric proteins. The primer is B.I. Designed from the genomic sequence of a Burgdorferi strain, each contains a novel DNA cassette that encodes recognition sequences for three restriction endonucleases that are in frame with the gene coding sequence. The 5 'primer (5'-AATTGGTACCCAGGATCCCCATATG + 15MER ORF specific sequence) (SEQ ID NO: 1) contains Kpnl (underlined), BamHI (bold), and Ndel (italic) recognition sequences. The 3'primer (5'GCGGGATCCGGTACCGTCGAC + 15mer ORF specific sequence) (SEQ ID NO: 2) contains BamHI, Kpnl, and Sall (dashed underline) recognition sequences. For amplification, 10 ng genomic DNA was used as a template in a 50 μl PCR reaction containing two ORF specific primer pairs. In order to increase the solubility properties of the expressed cell coat protein, the primer set was designed to amplify the coding region without the membrane anchor signal sequence (Dunn et al., 1990). PCR amplification was performed under stringent conditions using Platinum Taq DNA polymerase High Fidelity (Invitrogen) using conditions previously described by the inventors (Xu et al., 2003). PCR products were visualized by agarose gel electrophoresis. For quantification, the product was purified (PCR purification kit, Qiagen) and quantified by UV absorbance. To create a library of recombinant fusion proteins composed of three gene fragments, the amplification products are NdeI / BamHI (for the fragment at the 1′1 position) or BamHI / KpnI (for the fragment at the second position) or Cleaved with KpnI / Sall (for the fragment at the third position). The fragment at the first position was cloned with orientation into the unique NdeI and BamHI sites of the T7-based expression vector pET-28 (Novagen). This vector provides an N-terminal poly (His) affinity tag fused to the expressed protein to aid in purification on a nickel-Sepharose column. The lagging reaction was transformed into E. coli GC5 competent cells and the plasmid was verified using an Eppendorf Perfectprep Plasmid 96 VAC Direct Bind Kit and sequenced across the insert. Here the plasmid containing fragment 1 served as the vector for all subsequent cloning. For cloning with the orientation of fragments 2 and 3, the vector was digested with BamHI / XhoIl and the restriction digest amplicons of fragments 2 and 3 were simultaneously ligated into the digested vector. After transformation, the plasmid was purified and sequenced.

  Protein expression and purification. The purified plasmid was transformed into E. coli BL21 / DE3 competent cells for expression. Chimeric Borrelia proteins containing an N-terminal poly (His) affinity tag are expressed using the Overnight Express Autoinduction protocol. Induced cells are harvested by centrifugation and resuspended in 8M urea. An aliquot was run on SDS-PAGE. N-terminal poly-His tag protein was purified on a nickel-Sepharose column under denaturing conditions using Ni-NTA Spin Kit (Qiagen). The kit is designed for rapid screening and purification of His tag fusion proteins. The protein concentration was determined by measuring the absorbance shift when Coomassie Brilliant Blue G-250 reacted with the protein (Bio-Rad). Protein purity was checked by SDS-PAGE.

  Serum sample. The antigenicity of the chimeric protein was tested using CDC serum samples C (12 samples) and E (11 samples) and Baltimore serum samples V1 (28 samples) and V2 (23 samples) described above. did. In addition, an additional 32 serum samples were obtained from CDC (CDC-R1). These included sera from 12 lime patients. 12 patients with disease associated with cross-reactivity in Lyme disease test and 8 normal controls. In addition, 35 sera were obtained from Bioreclamation LLC, Westbury, NY from patients with diseases related to serological responses known to produce cross-reactivity in Lyme disease testing. These included patients with syphilis, lupus, and rheumatoid arthritis. Seven normal control sera were also obtained from healthy donors.

  Microarray. For protein microarrays, each of the recombinant proteins and individual 48 Borrelia antigens were printed on nitrocellulose coated FAST glass slides. In addition, the recombinant proteins OspB-OspC-flagellin (BC-Fia), OspA-p39-p93 (A-39-93), and OspC dimers composed of OspC B and H forms derived from early studies (OC2 / 9) was also printed (Gomes Solecki et al., 2000). Each slide in the array also contained 10 fixed BSA spots for background determination. The proteome chip was probed with serum from patients with untreated early Lyme disease and non-Lyme disease patients using the Fast Pak protein array kit. Briefly, slides are first incubated overnight at 4 ° C. in protein array blocking buffer for 2 hours prior to incubation in primary antibody (human serum and mouse anti-His tag for quantification). Shut off. The antibody quantifies the amount of recombinant protein in each spot, Cy5-conjugated goat anti-human IgG or Cy5-conjugated goat anti-human IgM (to detect bound human antibody) and Cy3-conjugated goat anti-mouse IgG. For visualization). After 2 hours of incubation, the slides were washed extensively and then scanned with an Axon GenePix 4200A microarray scanner. The raw data was captured and analyzed with Gene Pix Pro image analysis software. To minimize variability between samples, the PMT gain was adjusted to 1.0 equally in all arrays and the power setting was 50%. A global background subtraction method was used to subtract the background from each spot using the average intensity value of BSA from each slide (Xu et al., 2008).

  Data analysis. For analysis of data generated from arrays with human sera, a spot is considered positive if the spot's median fluorescence intensity is greater than 1000 and the spot's SNR (signal to noise ratio) is greater than 4, and further Included in the ratio analysis. The ratio of Cy5 intensity / Cy3 intensity (protein / His tag) for each protein was then calculated. All experiments are performed in duplicate and the Cy5 / Cy3 ratio of each protein is averaged. The average ratio of the reactivity of 17 non-Lyme disease patients to protein plus a C5 / C3 ratio of any chimeric protein that is greater than 3 times the standard deviation is significant between antibody and immobilized protein in lime serum Interaction was shown.

  result. A serum panel consisting of samples from patients with early Lyme disease is anti-B. To determine their sensitivity for detecting burgdorferi antibodies, they were used to screen an array of chimeric proteins. Although considerable heterogeneity was observed in the reactivity of individual serum samples to the array protein, there was significant consistency in the reactivity of individual samples for each of the six combinations of recombinant proteins. Indeed, among the 288 array proteins, most of them happily used both secondary antibodies to elicit an antibody response in humans with natural infection. Furthermore, the chimeric constructs were not significantly different in their immunoreactivity when compared to individual proteins. Although there was a sample-specific response, there was a subset of proteins that were commonly recognized by most of the sera. Importantly, most sera recognized at least one antigen from a subset of 25 highly antigenic Borrelia recombinant proteins and chimeric proteins using IgM and IgG secondary antibodies (Table 6). SEQ ID NO: 3-27). Such antigens represent the best candidates for the development of diagnostic tests, and an array of these 25 antigens was used in all subsequent sensitivity and specificity assessments. In addition, a mutant was made from the chimeric antigen OC2 / 9 (SEQ ID NO: 27) and is shown as SEQ ID NO: 28-30 in the figure. These variants and other chimeric antigen variants described herein can be made and tested for efficacy using the procedures described herein.

  The overall sensitivity and specificity of the lime assay for this set of serum samples is shown below in Table 7. As can be easily seen from the table, the protein array containing 25 recombinant Borrelia proteins was superior to the two-step system using the Lyme disease serum panel described above. For example, the sensitivity of the protein arrays described herein was compared in a two-stage trial using 29 patients with early Lyme disease. Among 29 patients with EM, the sensitivity of the protein arrays of the invention using IgM or IgG secondary antibodies is 100% during the initial symptoms (sample V1) and 87% during the recovery phase after 3 weeks ( Sample V2). In comparison, the percentages were 48% and 71%, respectively, for the standard two-stage test.

Example 3: Diagnostic test for Lyme disease.
Overview. Using genomic and proteomic approaches, protein microarrays can identify antigens that may be useful in the development of highly sensitive and specific one-step assays that will have a wide range of specificities in detecting Lyme disease. To identify, it was produced based on multiple genotypes of Borrelia burgdorferi sense strict. Although the assay containing the 25 recombinant Borrelia proteins described above is very accurate and sensitive, studies have shown that the number of recombinant antigenic proteins is minimized to a minimum while maintaining high sensitivity and specificity. Designed to lower

  Serum sample. Sera from 70 Lyme disease patients were used for the protein array sensitivity of 25 recombinant proteins. This includes 28 early lime patients from CDC, Baltimore samples V1 and V2 as described above and 8 lime arthritis, 6 neurogenic lime, and 2 cardiac lime patients, also from CDC. Inclusive. Moreover, for specificity studies, 83 people with diseases related to serological responses known to produce cross-reactivity in Lyme disease trials, including syphilis, fibromyalgia, and rheumatoid arthritis. Serum was obtained from the patient (non-Lyme disease). Normal control serum was obtained from 16 healthy donors in endemic areas and 36 healthy donors in non-endemic areas.

  Microarray. For protein microarrays, 25 recombinant proteins in Table 6 were printed on nitrocellulose coated FAST glass slides. Proteome chips were probed with serum and analyzed as described above.

  result. A serum panel consisting of 70 samples from patients with various stages of Lyme disease was used to screen an array of chimeric proteins and anti-B. Their sensitivity for detecting burgdorferi was determined. Although there was a sample-specific response, there was a subset of proteins that were commonly recognized by most of the sera. Importantly, the majority of sera used 7 highly antigenic Borrelia chimeras and IgG secondary antibodies using IgM secondary antibodies for a total of 11 individual proteins. Chimeras were recognized (Table 8).

  The Cy5 / Cy3 ratio of these 11 recombinant and chimeric antigens was observed at the highest levels in the array, using normal sera and sera from patients with other chronic infections or autoimmune diseases, respectively. ,> 99% specificity. Eleven antigens were printed on array slides and used for sensitivity and specificity analysis.

  The overall sensitivity of our array of 11 proteins is shown in Table 9. For early Lyme patients, the sensitivity of the protein array using IgM or IgG secondary antibodies is 71% for CDC-derived sera, 88% at the initial symptoms for Baltimore samples (sample V1), and recovery after 3 weeks 88% between samples (sample V2). By comparison, the sensitivity was 44% in the standard two-stage trial for these same early lime patients. The sensitivity of the array was 100% for Lyme arthritis, neurogenic lime, and cardiac lime serum (Table 9).

  The specificity of the eleven antigen array assays (Table 10) is related to serologic responses related to serological responses that are known to produce cross-reactivity in normal controls and in currently used tests (non-lyme). Serum from patients with (disease) was evaluated by testing. Of the 52 healthy controls in the endemic area, no one had a positive result in the assay. For potential cross-reactive patients, 11 of 83 samples had a positive IgM or IgG antibody response in our assay. Thus, the overall specificity for the array assay was 100% for normal controls and 87% in non-Lyme disease patients.

  These data indicate that the microarray assay described herein can be used as an early Gives excellent sensitivity, specificity, and accuracy in detecting antibodies against Burgdorferi, but also demonstrates that it exhibits equivalent sensitivity for the end stage of the disease as well. As a result, standardized sensitive and specific one-step lyme disease assays of recombinant chimeric Borrelia proteins that would potentially have a broad coverage and specificity for Lyme disease are currently available. In addition, these assays will have significant commercial potential for the development of next generation rapid one-step point-of-care assays.

The teachings of all patents, published applications, and references cited herein are incorporated by reference in their entirety.
Casjens, S.M. Palmer, N .; , Van Vugt, R .; , Huang, W .; G. Stevenson, B .; Rosa, P .; , Et al. , A bacterial genome in flux: the twelve linear and nine circular extramosomal DNA in an infectious isolate of the lysedispiret. Mol. Microbiol. 2000; 35, 490-516.
Dunn, J .; J. et al. Lade, B .; N. , Barbour, A .; G. , Outer surface protein A (OspA) from the Lyme disease spirochete, Borrelia burgdorfferi: high level expression and purification of Amplification. Purif. 1990; 1: 159-68.
Gomes-Solecki, M .; J. et al. C. Dunn, J .; J. et al. Luft, B .; J. et al. , Et al. 2000. Recombinant chimeric Borrelia proteins for diagnosis of Lyme disease. J. et al. Clin. Microbial. 2000; 38: 2530-2535.
Xu, Y. Bruno, J .; F. Luft, B .; J. et al. , Profiling the human immune response to Borrelia burgdorferi infection with protein microarrays. Microb. Path. 2008; 45: 403-407.
Xu, Y. Bruno, J .; F. Luft, B .; J. et al. , Detection of Genetic Diversity in Linear Plasmids 28-3 and 36 in Borrelia burgdorfen stricto isolations by Subtractive Hybridization. Microb. Path. 2003; 35: 269-78.

  Although the invention has been particularly shown and described with reference to exemplary embodiments thereof, various changes in form and detail may be made without departing from the scope of the invention as encompassed by the appended claims. It will be appreciated by those skilled in the art that it may be done in.

Claims (20)

  A recombinant Borrelia fusion protein construct comprising at least three Borrelia recombinant protein antigens, wherein the recombinant antigen is selected from Table 1.   2. The protein fusion construct of claim 1, wherein the molecular weight of the fusion protein construct is about 100 kDa or less.   The Borrelia fusion construct according to claim 1, wherein the recombinant antigen is amplified by PCR with primers comprising SEQ ID NO: 1 and SEQ ID NO: 2.   A vector comprising the recombinant Borrelia fusion protein construct of claim 1.   A Borrelia recombinant fusion protein construct selected from the group of constructs in Table 5.   A microarray comprising one or more Borrelia chimeric protein antigens of Table 5.   7. The microarray of claim 6, further comprising one or more recombinant Borrelia protein antigens of Table 1.   OspB-OspC-flagellin (B-C-Fla), OspA-p39-p93 (A-39-93), and OspC dimers consisting of OspC B-type and H-type (OC2 / 9) 8. The microarray of claim 7, further comprising one or more Borrelia recombinant protein antigens.   A microarray comprising the recombinant Borrelia protein antigen and fusion protein antigen of Table 6.   A microarray comprising the recombinant Borrelia protein antigen and fusion protein antigen of Table 8.   A method for diagnosing Lyme disease comprising the step of determining said sample obtained from a subject suspected of having Lyme disease for the presence of antibodies against Borrelia burgdorferi protein in a test sample, comprising: Contacting the sample with a microarray comprising one or more Borrelia fusion protein antigens of 6, 6 or 8, and detecting the presence of antibodies in the sample reactive to the Borrelia fusion protein antigen A method wherein detection of the presence of an antibody against one or more Borrelia chimeric antigens indicates the presence of Lyme disease in said subject.   12. The method of claim 11, wherein the microarray consists of all of the recombinant antigens and fusion protein antigens of Table 6.   12. The method of claim 11, wherein the microarray consists of all of the recombinant antigens and fusion protein antigens of Table 8.   A method for diagnosing Lyme disease in a subject comprising the step of determining said sample obtained from a subject suspected of having Lyme disease for the presence of antibodies against Borrelia burgdorferi protein in a test sample, comprising: Contacting the sample with a microarray comprising a recombinant Borrelia protein antigen of Table 6 and detecting the presence of antibodies in the sample reactive to the recombinant Borrelia antigen, in one or more sets A method wherein the detection of the presence of an antibody against a modified Borrelia antigen indicates the presence of Lyme disease in said subject.   A method for diagnosing Lyme disease in a subject comprising the step of determining said sample obtained from a subject suspected of having Lyme disease for the presence of antibodies against Borrelia burgdorferi protein in a test sample, comprising: Contacting the sample with a microarray comprising a recombinant Borrelia protein antigen of Table 8 and detecting the presence of antibodies in the sample reactive to the recombinant Borrelia antigen, in one or more sets A method wherein the detection of the presence of an antibody against a modified Borrelia antigen indicates the presence of Lyme disease in said subject.   A method for detecting antibodies against Borrelia burgdorferi in a test sample, the microarray of one or more recombinant Borrelia fusion protein antigens in Table 5 and the sample, wherein the antibody in the sample is the fusion Contacting under conditions sufficient to react with a protein antigen and detecting an antibody-antibody reaction.   17. The method of claim 16, wherein the microarray comprises the recombinant antigen and fusion protein antigen of Table 6.   17. The method of claim 16, wherein the microarray comprises the recombinant antigen and fusion protein antigen of Table 8.   A method for detecting an antibody against Borrelia burgdorferi in a test sample, the microarray comprising the recombinant Borrelia antigen and fusion protein antigen of Table 6 and the sample, wherein the antibody in the sample reacts with the antigen A method comprising contacting under conditions sufficient to effect and detecting an antigen-antibody reaction.   A method for detecting an antibody against Borrelia burgdorferi in a test sample, the microarray comprising the recombinant Borrelia protein antigen and fusion protein antigen of Table 8 and the sample, wherein the antibody in the sample is the antigen and the antigen. Contacting under conditions sufficient to react as well as detecting an antigen-antibody reaction.

Images