RU2514230C1 - Recombinant chimeric polypeptides, carrying epitopes of various immunodominant proteins of spirochaeta of borrelia burgdorferi sensu lato complex, and serum diagnostic technique for ixodic tick-borne borreliosis - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: there are presented recombinant chimeric polypeptides _rmBmpA-_frp83, _rmOspA-_frp83, _rmDbpB-_rmOspA, _rmFlaA-_frFlaB and _rmOspC_Bg-_rmOspC_Ba, prepared on the basis of gene expression amplified by PCR on the DNA of Borrelia garinii 20047^T Western-Siberian isolate or in case of the protein rmOspC_Ba, on the DNA of Borrelia afzelii isolate.

EFFECT: invention extends the range of recombinant polypeptides applicable for the serum diagnosis of ixodic tick-borne borreliosis, providing higher specificity and sensitivity of the ITBB, including the differential diagnosis of the early stage and the stage of a disseminated infection in the territories of Borrelia burgdorferi s1 Western-Siberian isolates.

8 cl, 2 dwg, 3 tbl, 5 ex

Description

The invention relates to medicine, the microbiological industry and can be used to obtain recombinant chimeric polypeptides carrying epitopes of various immunodominant spirochete proteins of the Borrelia burgdorferi sensu lato complex by genetic engineering methods. These polypeptides can be used to diagnose tick-borne tick-borne borreliosis (Lyme borreliosis, Lyme disease) by enzyme-linked immunosorbent assay (ELISA), immunochromatographic analysis and Western blot analysis, as well as to obtain animal sera containing polyclonal antibodies to the corresponding recombinant chimeric polypeptides, and creating molecular vaccines against the causative agent of tick-borne tick-borne borreliosis.

Tick-borne tick-borne borreliosis (IKB) is an infectious vector-borne natural focal disease caused by spirochetes of the Borrelia burgdorferi sensu lato (B.burgdorferi s.l.) complex, transmitted through ticks. Currently, 18 species of spirochetes have been characterized, which are part of the complex B.burgdorferi s.l., of which only four: B.burgdorferi sensu stricto, B.garinii, B.afzelii and B.spielmanii, are pathogenic for humans (1). In terms of breadth of spread and incidence rate, IKB is one of the leading places among natural focal diseases. The geographical distribution of IKB is extensive, it is found on all continents (except Antarctica). In our country, the natural foci of this infection are widespread in the forest zone, from the borders with the Baltic states in the west to Southern Sakhalin - in the east (2). Four of the six species of borrelia found in the world have been discovered in Russia. Species B.afzelii and B.garinii are distributed throughout the country, from the European part to the Far Eastern region (3). B.burgdorferi sensu stricto was found only in the European part of Russia - in the Moscow and Leningrad regions (4, 5, 6). Over the past decade, studies have been carried out on the infection of ixodid ticks common in Western Siberia with spirochetes of the Borrelia burgdorferi sensu lato complex and determination of the species composition of borrelia (B.afzelii, B.garinii and, presumably B.japonica, the pathogenicity of the latter has not been identified) (7 , 8, 9).

Tick-borne tick-borne borreliosis is a serious danger to human health, as it can lead to long-term disability and disability. Clinically, the disease proceeds with a predominant lesion of the skin, nervous system, musculoskeletal system, heart and is characterized by a tendency to chronic as well as latent course (10).

Diagnosis of ICD is one of the urgent public health problems, and this is due to many factors: a variety of clinical manifestations, the presence of concomitant infections, the causative agents of which are transmitted by ixodid ticks (anaplasmosis, babesiosis, tick-borne encephalitis, etc.) (11), depending on the manifestation of infection as a species the causative agent, as well as on the individual characteristics of the body, etc. At an early stage, ICD responds well to antibiotic treatment. In the later stages, treatment is longer and not always successful. In the early period of development of ICD, an early stage of infection (stage of local infection) and the next stage of disseminated infection, corresponding to dissemination of borrelia into various organs, are distinguished. The disease can have an erased clinical picture of the course or a latent form or disguise itself as other diseases, which complicates its diagnosis.

The main methods that allow you to quickly diagnose ICD are methods based on the detection of antibodies to the pathogen, while borrelia lysate or the proteins that make up their composition are used as antigens.

Borrelia lysate B.burgdorferi s.1. Is known, containing borrelia proteins, which are used as antigens for the diagnosis of ICD (12). The disadvantages of using antigens in the composition of borrelia lysate are that the lysate also includes heat shock proteins p75 and p60, which have the homology of amino acid sequences with proteins that perform similar functions in a number of gram-negative, gram-positive microorganisms and mycobacteria (13). In addition, flagellin Borrelia has common epitopes with flagellins of other spirochetes (T. pallidum, T. phagedenis B.persica, B.hermsii, B. duttoni, etc.). Therefore, the use of borrelia lysate antigens in laboratory practice leads to false positive results when testing the sera of patients with syphilis, periodontosis, leptospirosis, tuberculosis and many other diseases (14). The specificity of the analysis when using borrelia lysate antigens is small and is 60-70%.

Antigens of external surface proteins and decorin-binding proteins of native borrelia strains (spirochetes B.burgdorferi s.1.) Are known, which are used for the diagnosis of ICD (15). However, with repeated passaging of the culture in vitro, Borrelia lose their extrachromosomal elements (plasmids) encoding immunodominant proteins, including external surface and decorin-binding proteins. This limits the number of obtained antigens due to the small number of cycles of reproduction of the pathogen in vitro and makes their use impractical.

In the last 15 years, for the diagnosis of ICD, immunodominant proteins of the causative agent of ICD synthesized by recombinant Escherichia coli strains have been used as antigens.

A known lysate of E. coli cells producing the surface immunodominant BmpA borrelia protein used for the diagnosis of ICD (16). The disadvantage of the claimed diagnostic tool is that the use of crude from lysate BmpA protein significantly reduces the sensitivity of the diagnosis. In addition, it cannot be used to diagnose an early stage of ICD.

Known recombinant flagellar protein spirochete B.burgdorferi s.1. 38 kDa FlaA, used as an antigen for the diagnosis of ICD at an early stage of the disease (17). However, it cannot be used for serodiagnostics of the stage of disseminated infection of ICD.

Known recombinant flagellar protein spirochete B.burgdorferi s.1. 41 kDa FlaB, used as an antigen for the diagnosis of ICD, which elicits an immune response in the early stages of ICD development, and FlaB immunoglobulins remain in high titer throughout the infection (18). The disadvantage of this antigen is that it does not allow to differentiate between the early stage and the stage of disseminated infection of IKB.

A recombinant OspC protein from the family of external surface borrelia lipoproteins is known that is used as an antigen for the diagnosis of ICD (15), which is a strong immunodominant protein of B.burgdorferi s.1., Inducing a humoral immune response at an early stage of infection. The disadvantage of OspC is its unsuitability for diagnosing the stage of disseminated infection of ICD.

A recombinant OspA protein from the family of external surface borrelia proteins is known, which is used as an antigen for the diagnosis of ICD (19). This marker allows you to diagnose ICD with a predominant lesion of the joints at the stage of disseminated infection, it is not suitable for the diagnosis of an early stage of ICD

A known combination of recombinant proteins OspA and VIsE (variable major protein-like sequence, expressed), used together as antigens for the diagnosis of ICD at the stage of disseminated infection. This combination of antigens is insufficient to exclude a false positive reaction in healthy patients (20). In addition, it does not allow to diagnose the early stage of IKB.

A known recombinant decorin-binding protein (DbpA) is Borrelia, which is used as an antigen for the diagnosis of ICD at the stage of disseminated infection, which makes it possible to detect 100% of patients with such a form of ICD as neuroborreliosis and 62% with ICD with primary joint damage (21). The use of DbpA without a combination with other markers of ICD does not allow to diagnose the early stage of the disease.

Another decorin-binding protein of borrelia, DbpB, is also of diagnostic value for the detection of ICD at the stage of disseminated infection (22). However, it was found that the use of decorin-binding proteins as antigens for the diagnosis of ICD does not allow to diagnose the early stage of the disease (22).

Known recombinant protein Borrelia BTPA (p39) from the family of basic membrane proteins, used as an antigen for the diagnosis of ICD at the stage of disseminated infection. BmpA induces a strong immune response in the body. The mature BmpA protein has a molecular weight of about 39 kDa and, along with flagellar proteins, is a fairly conservative immunogenic spirochete protein of the B.burgdorferi s complex. 1 .: the homology of the BmpA amino acid sequences of various species of B.burgdorferi s.1. Spirochetes, pathogenic for humans and common in Europe, ranges from 86% to 91% (23). The sensitivity of diagnostic test systems based on the use of BmpA obtained on the basis of one type of borrelia depends on the prevalence of this species in the region in which the patient is infected. The use of BmpA for the diagnosis of ICD does not allow to detect the early stage of the disease.

A recombinant polypeptide comprising a fragment of the amino acid sequence (positions 139-273) of the OspC Borrelia strain Borrelia burgdorferi sensu stricto strain, a recombinant polypeptide comprising a fragment of 160-170 of the indicated OspC amino acid sequence, as well as a recombinant chimeric polypeptide comprising a combination of fragments of the OspC amino acid sequences (1) 164, 165-179, 180-216, 217-273) from four different strains of borrelia, which can be used to obtain molecular vaccines against IKB (24). The disadvantage of using the aforementioned recombinant polypeptides and a chimeric polypeptide for the diagnosis of ICD in Siberia is that the source of genes for obtaining these polypeptides are typical European Borrelia isolates, which significantly differ in antigenic properties from spirochetes common in Siberia. In addition, the use of OspC or its fragments, including as part of a recombinant chimeric polypeptide, for the diagnosis of ICD does not allow to diagnose the stage of disseminated infection.

Recombinant proteins OspA, OspB, fragments thereof, recombinant chimeric OspA-OspB polypeptide, FlaB polypeptide that can be used to diagnose ICD are known (25). The disadvantage of using these recombinant polypeptides for the diagnosis of ICD in Russia is that they are based on the genes of the North American isolates Borrelia burgdorferi sensu stricto (strains N40, B31 and ZS7), which are found in Russia only in the Moscow and Leningrad regions and are not available in other territories, including in Siberia. In addition, the selected structure of the flaB gene encodes cross epitopes with flagellar proteins of other types of pathogens, mainly the causative agent of syphilis, Treponema palladium (29), which leads to false positive results when using the recombinant FlaB polypeptide encoded by this gene for diagnosis. Recombinant proteins obtained according to this analogue are synthesized fused with glutathione transferase, which can lead to distortion of the results in the diagnosis of ICD.

Recombinant proteins OspA and FlaB are known, encoded by full-length ospA and flab genes obtained by PCR amplification on DNA of the North American isolate Borrelia burgdorferi, strain ZS7 (26). The disadvantage of using them for the diagnosis of ICD is that they have different antigenic properties, compared with similar polypeptides encoded by the genes of Borrelia isolates found in Russia, in particular in Siberia, which reduces the effectiveness of the use of ICD diagnostic test systems based on their use on Russian territory. In addition, as noted above, OspA is suitable for the diagnosis of ICD mainly at the stage of disseminated infection, and only FlaB has antibodies, both at an early stage of the disease and at the stage of disseminated infection. Thus, the joint use of these antigens for serodiagnosis of ICD does not provide a reliable diagnosis at an early stage of infection.

A recombinant OspC protein encoded by a gene belonging to the invasive groups A, B, I and K of Borrelia burgdorferi s.1 is known. or groups A, B Borrelia afzelii (27). The disadvantage of using this polypeptide for the diagnosis of ICD in Russia is that it is derived from the borrelia gene, which are not found in ixodid tick populations in Russia. In addition, OspC is not suitable for the diagnosis of ICD at the stage of disseminated infection.

A recombinant OspC protein is known, and a recombinant polypeptide corresponding to a FlaB protein fragment of the West Siberian isolate B.garinii subgroup NT29, shared as antigens for the diagnosis of ICD. The disadvantage of the FlaB protein fragment is that it contains eight additional amino acid residues of the mature α-toxin of Staphylococcus aureus, which gives false positive results in the diagnosis of ICD, i.e. cannot provide high specificity for the diagnosis of ICD (28). In addition, the combination of these two recombinant polypeptides does not provide reliable diagnosis of ICD at the stage of disseminated infection, because antibodies to OspC are produced in patients only at an early stage, and only antibodies to FlaB can be present both at an early stage and at the stage of disseminated infection.

Known recombinant protein FlaA species B.burgdorferi s.s. (strain B31), common on the North American continent and in Western Europe (29). The disadvantage of using this protein for the diagnosis of ICD in Russia is that it differs in antigenic properties from the FlaA proteins characteristic of borrelia circulating in ixodid tick populations in Siberia and the Far East. In addition, FlaA is not suitable for the diagnosis of ICD at the stage of disseminated infection.

Closest to the claimed are chimeric recombinant polypeptides carrying epitopes of various sizes from OspA proteins characteristic of North American and European Borrelia isolates and one or two other recombinant polypeptides of these Borrelia in the following combinations: OspA and OspA, OspA-OspB, OspA-OspB-OspB-Ospb-Ospb-Ospb-Ospb-Ospb-Ospb-Ospb-Ospb-OspB-OspB-OspB-OspB-OspB-OspB , OspA-p83, as well as chimeric recombinant OspB-FlaB and OspB-FlaB-OspC polypeptides (30). The use of these chimeric antigens for the diagnosis of IKB in Siberia is not acceptable due to the following reasons:

- they mainly consist of epitopes of highly variable antigens of North American and European Borrelia isolates, such as: OspA, OspB and OspC, which differ significantly from the similar amino acid sequences of Siberian borrelia isolates, which determines their different affinity for patient serum antibodies and reduces the sensitivity of the analysis;

- the number of conserved antigens for which differences between borrelia species of different regions are less pronounced is limited by the p83 and FlaB proteins that are part of the chimeric antigens OspA-p83, OspB-FlaB-OspC and OspB-FlaB, however, the combination of one recombinant chimeric marker polypeptide the early stage and the stage of disseminated infection complicates the differential diagnosis of these stages of the disease.

The objective of the present invention is to expand the arsenal of recombinant polypeptides suitable for the diagnosis of ICD, increasing the specificity and sensitivity of the diagnosis of ICD in the regions of distribution of West Siberian isolates Borrelia burgdorferi s.1., Including differential diagnosis of the early stage and the stage of disseminated infection.

The solution to this problem is achieved by the fact that the following new recombinant chimeric polypeptides are proposed, obtained on the basis of expression of genes synthesized by PCR on DNA, isolated from West Siberian isolates B.garinii and B.afzelii:

1. Recombinant chimeric polypeptide - _rm BmpA- _fr p83 (SEQ ID NO 4) size 591 a.o. with a molecular weight of 65.89 kDa, containing from the N-terminus of the molecule the amino acid sequence of the mature BmpA protein of the West Siberian isolate Borrelia garinii ( _rm BmpA) of 324 a.o. with a molecular weight of 35.3 kDa, and from the C-terminus, the amino acid sequence of the C-terminal fragment of the p83 protein ( _fr p83) of the West Siberian isolate Borrelia garinii of 248 a.o. with a molecular weight of 28.17 kDa.

2. Recombinant chimeric polypeptide - _m OspA- _fr p83 (SEQ ID NO 6) of size 521 a.o. with a molecular weight of 57.99 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspA protein ( _rm OspA) of the West Siberian isolate Borrelia garinii with a size of 257 a.o. with a molecular weight of 27.79 kDa, and from the C-terminus, the amino acid sequence of the C-terminal fragment of the p83 protein ( _fr p83) of the West Siberian isolate Borrelia garinii of 248 a.o. with a molecular weight of 28.17 kDa.

3. Recombinant chimeric polypeptide - _rm DbpB- _rm OspA (SEQ ID NO 8) size 432 a.o. with a molecular weight of 47.13 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature protein DbpB ( _rm DbpB) of the West Siberian isolate Borrelia garinii, size 156 a.o. with a molecular weight of 17.02 kDa, and from the C-terminus of the recombinant mature protein OspA ( _rm OspA) of the West Siberian isolate Borrelia garinii measuring 257 a.o. with a molecular weight of 27.79 kDa.

4. Recombinant chimeric polypeptide - _rm FlaA- _fr FlaB (SEQ ID NO 10) size 587 a.o. with a molecular weight of 64.76 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature FlaA protein (rmFlaA) of the West Siberian isolate Borrelia garinii of 318 a.o. with a molecular weight of 35.82 kDa, and from the C-terminus, the amino acid sequence of the FlaB flagellar protein fragment ( _fr FlaB) specific for B.burgdorferi s.1 spirochetes. 250 a.s. with a molecular weight of 26.62 kDa.

5. Recombinant chimeric polypeptide - _rm OspC _Bg - _rm OspC _Ba (SEQ ID NO 12) of size 390 a.o. with a molecular weight of 40.83 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia garinii ( _rm OspC _Bg ) of 188 a.o. with a molecular weight of 19.70 kDa, and from the C-terminus, the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia afzelii ( _rm OspC _Ba ) of 186 a.a. with a molecular weight of 19.19 kDa.

In the short notation of proteins, the subscripts mean: “m” - mature, “fr” - fragment “r” - recombinant, Bg and Ba - protein belonging to Borrelia species Borrelia garinii and Borrelia afzelii, respectively.

Known methods for serodiagnosis of ixodic tick-borne borreliosis by enzyme-linked immunosorbent assay using commercial test systems.

A known method for serodiagnosis of ICD by enzyme-linked immunosorbent assay, including the use of a native antigen in the form of a spirochete lysate obtained from strain P1 of B. afzelii isolated in the Moscow region (manufacturer:

State Scientific Center for Applied Microbiology, Obolensk, Russia) (31). The disadvantage of this method is that it does not provide satisfactory specificity with respect to ICB in the regions of distribution of West Siberian isolates of borrelia, because they differ significantly in the structure of antigens from borrelia isolates common in the Moscow region. In addition, the method does not allow to differentiate the early stage and the stage of disseminated infection. The use of spirochete lysates provides high sensitivity of the method, but it has very low specificity due to the presence of antigens in the lysates that have cross antigenic reactivity with antigens of other microorganisms, including human symbionts. In addition, the production of lysates is associated with expensive cultivation of spirochetes, and in the course of several passages, spirochetes can lose the antigens encoded by the plasmid DNA of these microorganisms.

A known method for serodiagnosis of ICD by enzyme-linked immunosorbent assay, including the use of natural antigen isolated from a strain of RKo B.afzelii (manufacturer of the test system: "Dade Behring Marburg GmbH", Germany) (32). The known method has the same disadvantages.

A known method for serodiagnosis of ICD by enzyme-linked immunosorbent assay, including the use of a mixture of the following recombinant polypeptides of three types of Borrelia as antigens: p21 and OspC from B.burgdorferi sensu stricto and B. garinii, p41i is the inner part of flagellin, from B. garinii, p18 and p100 from B.afzelii (manufacturer: “Biomedica”, Austria) (33). The disadvantage of the claimed method is that the known antigens are obtained on the basis of borrelia, common in Western Europe, which limits its use in territories where West Siberian isolates of borrelia are common. In addition, the known method does not allow to differentiate the early stage and the stage of disseminated infection. Another disadvantage of the method is that the use of three to four antigens is not enough to achieve high sensitivity and specificity of the method.

A known method for serodiagnosis of ICD by enzyme-linked immunosorbent assay, which includes the use of recombinant VlsE polypeptide and cell lysate of B. afzelii, B. arinii as antigens to diagnose the stage of disseminated infection of ICD (detection of antibodies to IgG class Borrelia), recombinant FlaB polypeptide and natural purified OspC for diagnosis early stage of ICD (for the detection of antibodies to IgM class Borrelia) (manufacturer of test systems: NovaTec GmbH, Germany) (34). The disadvantage of the claimed method is that the known antigens are obtained on the basis of borrelia, common in Western Europe, which limits its use in territories where West Siberian isolates of borrelia are common. The use of cell lysates provides high sensitivity of the method, but it has very low specificity due to the presence of antigens in the lysates that have cross antigenic reactivity with antigens of other microorganisms.

A known method for serodiagnosis of ICD infection by enzyme-linked immunosorbent assay, which includes the use of a mixture of recombinant polypeptides of three types of borrelia as antigens: VlsE from B.burgdorferi sensu stricto, FlaB (p41) and BmpA from B.garinii, OspC from B.afzelii (manufacturer: ZAO Vector-Best ”, Novosibirsk, Russia). The known method is not sensitive and specific, including in Siberia. This is due to the small number of antigens used, as well as the use of recombinant Borrelia proteins as antigens that are not found in Siberia (B.burgdorferi sensu stricto) or differ significantly in amino acid sequence from proteins of West Siberian borrelia isolates. In addition, the method uses a recombinant OspC protein of only B.afzelii species, which is less common in Siberia than B.garinii.

Closest to the claimed is a method for serodiagnosis of ICD by the method of immunoenzymatic analysis, including the use as a mixture of antigen recombinant antigens DbpA from B.afzelii and B.garinii, FlaB (p41) from B.garinii, OspC from B.afzelii and B.garinii, p35 from B.afzelii (manufacturer of the test system: Omniks LLC, St. Petersburg, Russia) (31). Since it is based on the antigens inherent in European isolates of borrelia, it has a reduced sensitivity and specificity in the diagnosis of IKB caused by borrelia circulating in Siberia. In addition, it does not reliably detect ICD at an early stage, because For this, only one marker is used - OspC. The presence of anti-FlaB antibodies in the serum is found in patients both at an early stage and at the stage of disseminated infection.

The problem to which the invention is directed, is to increase the specificity and sensitivity of the method for diagnosing UTI, differential diagnosis of an early stage and the stage of disseminated infection of UTI in the distribution area of the West Siberian isolates Borrelia burgdorferi s.1.

The solution of this problem is achieved by the fact that as antigens for enzyme immunoassay use recombinant chimeric polypeptides _rm BmpA- _fr p83, _rm OspA- _fr p83, _rm DbpB- _rm OspA, _rm FlaA- _fr FlaB, _rm OspC _Bg - _rm OspC _Ba , in the present invention, obtained on the basis of DNA from West Siberian isolates Borrelia garinii, Borrelia afzelii; for the diagnosis of ICD at an early stage, recombinant chimeric polypeptides _rm FlaA- _fr FlaB and _rm OspC _Bg - _rm OspC _{Ba are used} ;

for the diagnosis of ICD at the stage of disseminated infection, recombinant chimeric polypeptides _rm BmpA- _fr p83, _rm OspA- _fr p83 and _rm DbpB- _rm OspA.

Description of the invention

According to the claimed invention proposed the following new recombinant chimeric polypeptides suitable for the diagnosis of ixodic tick-borne borreliosis in the area of distribution of West Siberian borrelia isolates:

1. A recombinant chimeric polypeptide _{- rm BmpA- fr p83 (SEQ ID} NO 4) of size 591 aa with a molecular weight of 65.89 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature protein BmpA ( _rm BmpA) of the West Siberian isolate Borrelia garinii 324 a.o. with a molecular weight of 35.3 kDa, and from the C-terminus, the amino acid sequence of the C-terminal fragment of the p83 protein ( _fr p83) of the West Siberian isolate Borrelia garinii of 248 a.o. with a molecular weight of 28.17 kDa.

2. Recombinant chimeric polypeptide - _rm OspA- _fr p83 (SEQ ID NO 6) size 521 a.o. with a molecular weight of 57.99 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspA protein ( _rm OspA) of the West Siberian isolate Borrelia garmii, size 257 a.o. with a molecular weight of 27.79 kDa, and from the C-terminus the amino acid sequence of the C-terminal fragment of the p83 protein ( _fr p83) of the West Siberian isolate Borrelia garinii of 248 a.o. with a molecular weight of 28.17 kDa.

3. Recombinant chimeric polypeptide - _rm DbpB- _rm OspA (SEQ ID NO 8) size 432 a.o. with a molecular weight of 47.13 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature protein DbpB ( _rm DbpB) of the West Siberian isolate Borrelia garmii, size 156 a.o. with a molecular weight of 17.02 kDa, and from the C-terminus, the amino acid sequence of the recombinant mature OspA protein ( _rm OspA) of the West Siberian isolate Borrelia garmii of 257 a.o. with a molecular weight of 27.79 kDa.

4. Recombinant chimeric polypeptide - _rm FlaA- _fr FlaB (SEQ ID NO 10) size 587 a.o. with a molecular weight of 64.76 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature FlaA protein ( _rm FlaA) of the West Siberian isolate Borrelia garmii, size 318 a.o. with a molecular weight of 35.82 kDa, and from the C-terminus, the amino acid sequence of the FlaB flagellar protein fragment ( _fr FlaB) specific for B.burgdorferi s.1 spirochetes. 250 a.s. with a molecular weight of 26.62 kDa.

5. Recombinant chimeric polypeptide - _rm OspC _Bg - _rm OspC _Ba (SEQ ID NO 12) of size 390 a.o. with a molecular weight of 40.83 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia garmii ( _rm OspC _Bg ) of 188 a.o. with a molecular weight of 19.70 kDa, and from the C-terminus, the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia afzelii ( _rm OspC _Ba ) of 186 a.a. with a molecular weight of 19.19 kDa.

The proposed recombinant chimeric polypeptides can significantly expand the arsenal of tools that can be used to diagnose ICD. They are suitable as antigens for the diagnosis of IKB in the areas of distribution of West Siberian borrelia isolates, because they are based on borrelia DNA from these regions. The simultaneous use in the diagnosis of ICD of the declared recombinant chimeric polypeptides, including various combinations of 8 proteins of West Siberian borrelia isolates in the composition of chimeras, allows for high specificity and sensitivity of diagnosis. An increase in the specificity and sensitivity of the differential diagnosis of an early stage and the stage of disseminated infection of ICD is ensured by the fact that the recombinant chimeric polypeptides according to claims 1-3 contain 4 markers of the stage of disseminated infection, and the recombinant chimeric polypeptides according to claims 4 and 5 include 4 early stage markers IKB.

The claimed recombinant chimeric polypeptides obtained as follows.

The expression vector pET36b ⁽⁺⁾ (Novagen, USA) was modified by inserting a polylinker, which is a DNA fragment containing recognition sites of restriction endonucleases EcoRI, KpnI, BssHII, BstEII, HindIII, and XhoI, under the regulatory region of the T7 bacteriophage promoter. Such a polylinker structure was obtained for the convenience of cloning selected Borrelia genes. The polylinker is followed by a nucleotide sequence encoding an 8-histidine amino acid fragment in the C-terminal region of recombinant proteins. This allows you to clean recombinant polypeptides using affinity chromatography on metal-chelated sorbents. The modified vector was named pETm, the structure of the integrated polylinker is listed in the sequence list under the number SEQ ID NO 1. The target recombinant polypeptides obtained using the modified expression vector pETm do not contain extended foreign amino acid sequences, as a result of which they do not give nonspecific signals in enzyme immunoassays. This, in turn, provides increased diagnostic specificity.

Recombinant plasmid DNA pETm size 5305 BP contains:

- a 48 bp DNA fragment - polylinker containing restriction sites EcoRI, KpnI, BssHII, BstEII, HindIII;

- Unique restriction sites XbaI, FauNDI, EcoRI, BssHII, BstEII, KpnI, HindIII, XhoI, DraIII, XmaI, SapI;

- XhoI-FauNDI fragment of plasmid DNA pET36b ⁽⁺⁾ of 5257 bp in size, including:

1) a 47 bp DNA fragment containing the sequence of the transcription terminator of gene 10 of the bacteriophage T7;

2) a 468 bp DNA fragment containing the origin of replication of the single-stranded bacteriophage f1;

3) a DNA fragment measuring 813 bp containing the neomycytransferase gene, which determines the resistance of E. coli cells to capamycin;

4) a 468 bp DNA fragment containing the origin of replication of plasmid pMB1;

5) a 1080 bp DNA fragment encoding the region of the lacI regulatory gene of the E. coli lac operon;

6) a 468 bp DNA fragment containing the promoter of gene 10 of the bacteriophage T7.

The structure of the vector pETm is shown in the sequence listing under the number SEQ ID NO 2.

The pETm vector was used for cloning and expression of individual genes (or gene fragments) of the proteins _rm OspC _Bg , _rm DbpB, _rm OspA, _rm FlaA, _fr FlaB, _rm BmpA and _fr p83, characteristic of the West Siberian isolates Borrelia garinii, protein _rm OspC _{Ba of the} West Siberian isolate Borrelia afzelii, as well as chimeric genes of these proteins in the claimed combinations.

In the present invention, recombinant chimeric DNAs encoding recombinant chimeric polypeptides of the following composition were prepared and cloned as part of the pETm vector: _rm BmpA- _fr p83, _rm OspA- _fr p83, _rm DbpB- _rm OspA, _rm FlaA- _fr FlaB and _rm OspC _Bg - _rm OspC _Ba . In the short notation of proteins, the subscripts mean: “m” - mature, “fr” —fragment, Bg and Ba — protein belonging to Borrelia species Borrelia garinii and Borrelia afzelii, respectively.

Recombinant chimeric DNAs encoding the above polypeptides were likewise named. Constructed plasmids containing recombinant chimeric DNAs were named respectively: pETm- _rm bmpA- _fr p83, pETm- _rm ospA- _fr p83, pETm- _rm dbpB- _rm ospA, pETm- _rm flAA- _fr flaB and pETm- _rm ospC _Bg - _rm ospC _Ba .

The recombinant chimeric DNA _rm bmpA- _fr p83 as part of the vector pETm provides the synthesis of a recombinant chimeric polypeptide containing the epitopes of the immunodominant proteins _rm BmpA and _fr p83 specific for the Siberian isolate B. garinii subgroup 20047 ^T. The recombinant chimeric DNA _rm bmpA- _fr p83 has a size of 1773 bp and includes the following elements (all positions of nucleotide residues are indicated relative to plasmid pETm- _rm bmpA- _fr p83):

- a 972 bp B.garinii bmpA gene fragment encoding the recombinant mature BmpA protein ( _rm BmpA) of the West Siberian isolate Borrelia garimi, fragment position 5097-6068 bp;

- XhoI restriction endonuclease sites measuring 6 bp, site positions 6069-6074 bp and 6819-6824;

- a fragment of the p83 gene of B.garinii with a size of 744 bp encoding the C-terminal fragment of the p83 protein of the West Siberian isolate Borrelia garimi ( _fr p83), position of the fragment 6075-6818 bp;

- Unique restriction sites: KpnI (GGTACC), site position 5091-5096; BglII (AGATCT) site position 5454-5459 bp; HindIII (AAGCTT) position 6522-6527 bp

The structure of the recombinant chimeric DNA _m bmpA- _fr p83 is presented in the sequence listing of SEQ ID NO 3, the amino acid sequence of the recombinant chimeric polypeptide _m BmpA- _fr p83 encoded by it is presented separately under the number SEQ ID NO 4.

The recombinant chimeric DNA _rm ospA- _fr pSS in the vector pETm provides the synthesis of a recombinant chimeric polypeptide containing the epitopes of the immunodominant proteins _rm OspA and _fr p83 specific for the Siberian isolate B. garinii subgroup 20047 ^T. The recombinant chimeric DNA _rm ospA- _fr p83 has a size of 1563 bp and includes the following elements (all positions of nucleotide residues are indicated relative to plasmid pETm- _rm ospA- _fr p83):

- a fragment of 771 bp B.garinii ospA gene, encoding the recombinant mature OspA protein of the West Siberian isolate Borrelia garimi ( _rm OspA), position of the fragment 5088-5858 bp;

- XhoI restriction endonuclease sites of 6 bp in size, site positions 5859-5864 bp and 6609-6614;

- a fragment of the p83 gene of B.garinii, size 744 bp, encoding the C-terminal fragment of the p83 protein of the West Siberian isolate Borrelia garinii ( _fr p83), position of the fragment 5865-6608 bp;

- Unique restriction sites: EcoRI (GAATTC), site position 5081-5086; BamHI (GGATTC), site position 5496-5501 bp; BglII (AGATCT), site position 5828-5833 bp; HindIII (AAGCTT), position of the site 6312-6317 bp

The structure of the recombinant chimeric DNA _rm ospA- _fr p83 is presented in the sequence listing of SEQ ID NO 5, the amino acid sequence of the recombinant chimeric _rm OspA- _fr p83 polypeptide encoded by it is separately shown under the number SEQ ID NO 6.

The recombinant chimeric DNA _rm dbpB- _rm ospA as part of the pETm vector provides the synthesis of a recombinant chimeric polypeptide containing the epitopes of the immunodominant proteins _rm DbpB and _rm OspA specific for the Siberian isolate B.garinii subgroup 20047 ^T. The recombinant chimeric DNA _rm bpB- _rm OspA has a size of 1296 bp and includes the following elements (all positions of nucleotide residues are indicated relative to plasmid pETm- _rm dbpB- _rm ospA):

- a fragment of the _rm dbpB gene of B.garinii 468 bp in size, encoding the mature _rm DbpB protein, position of the fragment 5097-5564 bp;

- XhoI restriction endonuclease sites of 6 bp in size, site positions 5565-5570 bp and 6342-6347;

- a fragment of the 771 bp _rm ospA B.garinii gene coding for the mature _rm OspA protein, position of the 5571-6341 bp fragment;

- Unique restriction sites: EcoRI (GAATTC), site position 5081-5086; KpnI (GGTACC), site position 5091-5096; BamHI (GGATTC), site position 5979-5984 bp; BglII (AGATCT) position of the site 6311-6316 bp

The structure of the recombinant chimeric DNA _rm dbpB- _rm ospA is presented in the sequence listing of SEQ ID NO 7, the amino acid sequence of the recombinant chimeric polypeptide _rm DbpB- _rm OspA encoded by it is separately presented under the number SEQ ID NO 8.

Recombinant chimeric DNA _rm flaA- _fr flaB in the vector pETm provides the synthesis of a recombinant polypeptide containing epitopes of immunodominant proteins _fr FlaB and _rm FlaA specific for the Siberian isolate B.garinii subgroup 20047 ^T. The recombinant chimeric DNA _rm flaA- _fr flaB has a size of 1761 bp and includes the following elements (all positions of nucleotide residues are indicated relative to plasmid pET- _rm flaA- _fr flaB):

- a fragment of the B. garinii flaA gene of 954 bp in size, encoding the mature protein _rm FlaA position of the fragment 5097-6050 bp;

- XhoI restriction endonuclease sites measuring 6 bp, site positions 6051-6056 bp and 6807-6812 bp;

- a fragment of the coding region of the B. garinii flaB gene, size 756 bp, position of the fragment 6057-6812 bp;

- Unique restriction sites - EcoRI (GAATTC) Website position 5081-5086 bp and KpnI (GGTACC), site position 5091-5096 bp

The structure of the recombinant chimeric DNA _rm flaA- _fr flaB is presented in the sequence listing of SEQ ID NO 9, the amino acid sequence of the recombinant chimeric _rm FlsA- _fr FlaB polypeptide encoded by it is presented separately under the number SEQ ID NO 10.

A recombinant chimeric DNA _rm ospC _Bg - _rm ospC _Ba pETm in the vector provides the synthesis of a chimeric recombinant polypeptide comprising the immunodominant epitopes of proteins _rm OspC _Bg and _rm OspC _Ba, Siberian specific subgroups B.garinii isolates 20047 and ^T B.afzelii respectively. The recombinant chimeric DNA _rm ospC _Bg - _rm ospC _Ba has a size of 1170 bp and includes the following elements (all positions of nucleotide residues are indicated relative to plasmid pETm- _rm ospC _Bg - _rm ospC _Ba ):

- 564 bp _rm ospC _Bg B.garinii gene fragment encoding the mature _rm OspC _Bg protein, position of the 5088-5651 bp fragment;

- a fragment of the _rm ospC _Ba gene of B.afzelii 558 bp in size, encoding the mature _rm OspC _Ba protein, position of the fragment 5658-6215 bp;

- Unique restriction sites - EcoRI (GAATTC), site position 5081-5086; KpnI (GGTACC), site position 5652-5657 bp; XhoI (CTCGAG), position of the site 6216-6221 bp

The structure of a recombinant chimeric DNA _rm ospC _Bg - _rm ospC _Ba is represented in the sequence listing SEQ ID NO 11, encoded by its amino acid sequence is a recombinant chimeric polypeptide _rm OspC _Bg - _rm OspC _Ba separately presented under SEQ ID NO 12 number.

The inventive method Ixodes serodiagnosis of Lyme disease by enzyme immunoassay involves the use of a combination of antigens as claimed inventive recombinant chimeric polypeptides _{rm BmpA- fr p83, rm OspA- fr} p83, rm DbpB- rm OspA, rm FlaA- fr FlaB, rm OspC Bg - rm OspC _Ba obtained from the expression of genes synthesized by PCR on the DNA of the West Siberian isolate Borrelia garinii or in the case of the protein _rm OspC _Ba on the DNA of the isolate Borrelia afzelii. For serodiagnosis of early stage using SDS recombinant chimeric polypeptides _{rm FlsA- fr FlaB, rm OspC Bg} - rm OspC Ba; for serodiagnosis of the stage of disseminated infection of ICD, recombinant chimeric polypeptides _rm BmpA- _fr p83, _rm OspA- _fr p83, _rm DbpB- _rm OspA. Comparison of the amino acid sequences of the West Siberian borrelia isolates antigens used in the claimed method with the primary structures of similar antigens characteristic of the three pathogenic types of borrelia, common in Western Europe, North America and Asia, revealed different degrees of difference between them: for _rm OspA antigen, differences in amino acid sequence ranged from 26.9% to 64%, for _rm DbpB - from 17% to 46.5%, for _rm FlaA - from 1.5% to 4%, for _fr FlaB - from 2% to 5%, for _rm BmpA - from 5.8% to 13.8%, for _fr p83 - from 3.3% to 22.6%, for _rm OspC _Ba - from 56 % to 72.3%, for _rm OspC _Bg - from 70% to 84.3%.

The method is carried out on the basis of the standard method of enzyme-linked immunosorbent assay (Example 5 specific performance). The claimed method for serodiagnosis of ixodic tick-borne borreliosis demonstrates high diagnostic sensitivity and specificity for the detection of ICD in Western Siberia, which are due to the following factors:

a) primarily due to the use of chimeric proteins, including antigens characteristic of borrelia, distributed directly on the territory of Western Siberia, since it is known that differences in amino acid sequences of similar antigens characteristic of isolates of borrelia of different geographical areas necessitate the use of antigens characteristic of diagnostic tests Borrelia distributed in the respective geographical areas;

b) the claimed chimeric polypeptides used in the analysis consist of full-sized natural amino acid sequences of mature immunodominant antigens containing a complete set of their corresponding B-epitopes (the exception is the immunodominant C-terminal fragment of p83 protein);

c) the use of 8 antigens in the analysis simultaneously does not reduce the sensitivity of the analysis, since essentially five chimeric antigens are involved in the sensitization of the plate, and not the 8 individual antigens included in their composition;

d) the chimeric polypeptide _m OspC _Bg - _m OspC _Ba contains the amino acid sequences of two immunodominant highly variable antigens characteristic of the spirochetes B.garinii and B.afzelii circulating in Western Siberia.

The invention is illustrated by the following graphic materials.

List of figures and other materials

Figure 1. Physico-genetic map of recombinant plasmid DNA pETm. lacI is the coding region of the lacI regulatory gene of the E. coli lac operon; T7-promotor - promoter of gene 10 of the bacteriophage T7; TV-start is the transcription initiation point in the promoter-containing region of the T7 bacteriophage; lac-operator — sequence linking the lacZ gene transcription repressor; RBS - ribosomal binding site (Shine-Dalgarno sequence); His-Tag is a sequence encoding eight histidine aa .; T7-terminator - sequence of the transcription terminator of the 10 gene of the bacteriophage T7; Ori-pBR322 - origin of replication of the plasmid pBR322; Kan is a gene of neomycin phosphotransferase II, which determines the resistance of E. coli cells to kanamycin.

Figure 2. Electrophoregram of the fractions obtained by affinity chromatography on a Ni-chelate sorbent under denaturing lysate conditions of E. coli cells producing the chimeric polypeptide _rm BmpA- _fr p83. Lanes: (1) - producer cell lysate after induction; (2) a soluble fraction of the cell biomass lysate; (3) the fraction of proteins that are not bound to the resin; (4-5) - eluates containing imidazole with a final concentration of 20 mm and 50 mm, respectively; (6-8) - eluates containing imidazole with a final concentration of 250 mm; (9-13) - eluates containing imidazole with a final concentration of 500 mM, (14) - marker proteins (66 and 28 kDa).

Table 1. The nucleotide sequences of the primers used for amplification of B.burgdorferi s.1 genes. (restriction site underlined).

Table 2. Amplification conditions for B.burgdorferi s.1 gene fragments.

Table 3. ELISA detection in the sera of patients with ICD and healthy donors of antibodies of the IgM and IgG classes to recombinant chimeric borrelia antigens.

Case Studies

For a better understanding of the invention, the following are examples of its specific implementation.

Example 1. Construction of the plasmid vector pETm.

To construct the expression vector pETm, the vector pET36b ⁽⁺⁾ and synthetic DNA duplex - polylinker are used. Synthetic DNA duplex in its structure contains a set of unique restriction sites: EcoRI, KpnI, BssHII, BstEII, HindIII. Synthetic duplex is followed by a region encoding an eight-histidine amino acid sequence and a stop codon of mRNA translation termination. Moreover, the expression products of genes inserted into the constructed vector contain an additional 8 histidine amino acid sequence in the C-terminal region of the polypeptide chain, which allows affinity purification of polypeptides on metal chelate sorbents. Synthetic duplex DNA is obtained by hybridization of a pair of complementary oligonucleotides of sizes 53 and 55 pp, the structure of the oligonucleotides is shown in the sequence listing under the numbers SEQ ID NO 13 and 14, respectively. Oligonucleotides are synthesized in such a way that a double-stranded DNA fragment containing “sticky ends” for the restriction endonucleases FauNDI nXhoI, respectively, is formed at hybridization at the 5 ′ and 3 ′ ends (sites are underlined):

FauNDI XhoI TATGCAGAATTCTATGGGTACCGTTGCGCGCAGCGGTCACCCGAAGCTTCTGCACGTCTTAAGATACCCATGGCAACGCGCGTCGCCAGTGGGCTTCGAAGACGAGCT

Hybridization of oligonucleotides is carried out as follows. In an equimolar ratio, oligonucleotides are mixed in one tube, the tube is heated in a water bath and the solution is gradually cooled at room temperature. The resulting solution containing synthetic duplex is used for ligation with the XhoI-FauNDI plasmid DNA fragment pET36b (+). All procedures associated with the insertion and cloning of a duplex, and subsequently of gene amplicons, are carried out using standard genetic engineering techniques described in the manual (36).

To obtain the fragment, plasmid DNA pET36b (+) is hydrolyzed with restriction endonucleases FauNDI and XhoI. The linear form of plasmid DNA measuring 5252 bp - XhoI-FauNDI fragment, separated from the hydrolysis products in a 0.8% agarose gel. The required plasmid DNA fragment is excised from the agarose gel and the DNA is extracted using the Biosilika kit (Novosibirsk, Russia) according to the attached protocol. The purified DNA fragment of the XhoI-FanNDI plasmid pET36b (+) is ligated with a synthetic DNA duplex. Ligation is carried out in a molar ratio of 20: 1 (insert / XhoI-FauNDI fragment) using T4 DNA ligase from Sibenzim (Russia) according to the instructions of the enzyme manufacturer. E. coli strain BL21 (DE3) was transformed using the electroporation ligase mixture. The transformation of E. coli cells with a ligase mixture is carried out in accordance with the guidance of the manufacturer of the electroporator - "PeqLab, Biotechnologie GmbH" (Germany). Transformed cells are seeded onto Luria-Bertani (LB) agar medium containing kanamycin 30 μg / ml and grown overnight at 37 ° C. The obtained cell clones are analyzed for the presence of a synthetic duplex insert using polymerase chain reaction (PCR) using external primers PR268 and PR269, i.e. primers lying “to the left” and “to the right” of the integrated synthetic DNA fragment. Primer structures PR268 and PR269 are indicated in the sequence listing under numbers SEQ ID NO 15 and 16, respectively. Taq DNA polymerase Sibenzym (Russia) was used for PCR.

Amplification conditions:

1 cycle (96 ° С - 2 min, 64 ° С - 0.5 min, 72 ° С - 0.5 min);

25 cycles (96 ° C - 0.5 min, 64 ° C - 0.5 min, 72 ° C - 0.5 min);

1 cycle (96 ° С - 0.5 min, 64 ° С - 5 min, 72 ° С - 10 min).

The desired clones are identified by the size of the amplicon - the PCR product, which should be 296 bp PCR products are analyzed on a 2% agarose gel. Plasmids are isolated from several positive clones by the alkaline method and used for restriction analysis by enzymes, sites for which are present only in the integrated polylinker. The plasmid DNA of one of the clones, satisfying all conditions, is sequenced to confirm the nucleotide sequence of the cloned synthetic DNA fragment. The new plasmid DNA construct was named pETm; it is subsequently used for cloning the coding regions of the spirochete genes of the B.burgdorferi sensu lato complex. Physico-genetic map of the plasmid vector pETm is presented in Figure 1. The nucleotide sequence of the vector is in the sequence listing of SEQ ID NO 2.

Example 2. Construction of recombinant chimeric DNA containing the plasmid vector pETm nucleotide sequences encoding the recombinant chimeric immunodominant spirochete proteins of the complex Borrelia burgdorferi sensu lato.

Coding regions of the genes of the claimed recombinant chimeric polypeptides are obtained in preparative amounts by amplification of the corresponding fragments of the genomic DNA of the spirochetes B.garinii and B.afzelii by PCR. Genomic DNA obtained previously from B.garinii and B.afzelii cultures (37) is used as a matrix.

Primers for amplification of the coding regions of genes are selected based on a comparison of known nucleotide sequences published in Internet databases (GenBank). Based on the comparison, the most conservative sites are selected so that the probability that the primer is complementary to the gene portion of the West Siberian Borrelia isolates is high. The structures of the selected primers are presented in table 1. Each primer at the 5'end contains a sequence encoding a recognition site by any restriction endonuclease.

Amplification of the genes is carried out with Pfu DNA polymerase, Sibenzym company (Russia) according to the attached instructions. The amplification conditions of the genes are presented in table 2. The initial temperature of denaturation is 96 ° C for 3 min, subsequent cycles of 20 s; the total number of reaction cycles is 30. The concentration of each primer in the reaction mixture is 0.2 nM (nanomole).

Amplification products are analyzed on a 1% agarose gel, gene fragments are identified by size. Each gene fragment is produced in an amount of 1-2 μg. Amplicons are purified by a standard phenol-chloroform extraction procedure, reprecipitated with ethanol, dissolved in 100 μl bidistilled water and used for restriction enzyme hydrolysis. The hydrolysis of amplicons is carried out at the rate of 2-3 times the excess of the enzyme for 16-20 hours, at a temperature of 37 ° C, in the case of using the restriction endonuclease XhoI - at 50 ° C. At the end of the reaction, the amplicons are again purified by phenol-chloroform extraction, reprecipitated and dissolved in 10-20 μl bidistilled water, 1/5 part is used for electrophoretic analysis. The bulk of DNA preparations are stored at -20 ° C until ligation, but not more than a month.

Amplicons of the corresponding borrelia genes are cloned as part of the pETm vector. At the first stage, the first of the pair of genes in the pETm vector is cloned, namely the genes _rm ospC _Bg , _rm flaA, _rm dbpB, _rm ospA and _rm bmpA. For this, the vector is hydrolyzed with restriction endonucleases, the sites of which are located at the 3'- and 5'-ends of the cloned gene, are separated from the hydrolysis products in an agarose gel, and the vector is isolated from the gel using a special kit (the procedures are similar to those described in example 1). The purified genes and the purified vector are ligated in an equimolar ratio of 5: 1 using T4 DNA ligase from Sibenzym (Russia) according to the instructions of the enzyme manufacturer. Using the electroporation ligase mixture, cells of E. coli strain BL21 (DE3) are transformed. The transformation of E. coli cells with a ligase mixture is carried out in accordance with the guidance of the manufacturer of the electroporator - PeqLab, Biotechnologie GmbH (Germany). Transformed cells are seeded on LB agar medium containing kanamycin 30 μg / ml and grown overnight at 37 ° C. The obtained cell clones are analyzed for the presence of an inserted borrelia gene by PCR using external primers PR268 and PR269 similarly to the method described in Example 1. PCR products are analyzed on a 2% agarose gel, the desired clones are identified by the size of amplicons. Plasmids are isolated from several positive clones by the standard alkaline method and sequenced to confirm the nucleotide sequence of the cloned borrelia gene. In the case of a satisfactory result, they proceed to the second stage of the assembly of recombinant DNA encoding the polypeptides. As a result of the first step, plasmids pETm- _rm ospC _Bg , pETm- _rm flaA, pETm- _rm dbpB, pETm- _rm ospA and pETm- _rm bmpA containing the corresponding borrelia genes are obtained.

At the second stage, the second of a pair of genes is inserted into the obtained recombinant plasmids, namely, the _rm ospC _Ba , _fr flaB, _rm ospA genes, the DNA fragment encoding the C-terminal fragment of the p83 protein of the West Siberian isolate Borrelia garinii ( _fr p83). For this, plasmids pETm- _rm ospC _Bg , pETm- _rm flaA, pETm- _rm dbpB, pETm- _rm ospA, pETm- _rm BmpA are hydrolyzed with restriction endonucleases, the sites of which are located at the 3'- and 5'-ends of the corresponding cloned gene, hydrolysis products on an agarose gel and isolated from the gel using a kit (the procedures are described in Example 1). The purified gene (second) and the purified corresponding plasmid are ligated in an equimolar ratio of 5: 1, E. coli cells are transformed with the ligase mixture and plated on an agar medium similar to the procedure described above (first step). The obtained cell clones are analyzed for the presence of an inserted borrelia gene by PCR using external primers PR268 and PR269 similarly to the method described in Example 1. PCR products are analyzed on a 2% agarose gel, the desired clones are identified by the size of amplicons. Plasmids are isolated from several positive clones by the standard alkaline method and sequenced to confirm the nucleotide sequence of the cloned borrelia gene.

Plasmids with confirmed content of gene pairs inserted into them are named pET- _rm bmpA- _fr p83, pETm- _rm ospA- _fr p83, pET- _rm dbpB- _rm ospA, pET- _rm flaA- _fr flaB and pET- _rm ospC _Bg - _rm oSpC _Ba .

Example 3. Expression in E. coli cells of recombinant chimeric DNA encoding recombinant chimeric polypeptides carrying epitopes of various immunodominant spirochete proteins of the Borrelia burgdorferi sensu lato complex.

The expression of the above chimeric genes cloned as part of the pET vector is carried out in E. coli cells of strains BL21 (DE3) and Rosetta 2. In the present invention, strain BL21 (DE3) was used as the main producer.

A recombinant clone museum culture or a colony of cells from a plate is grown overnight in 5 ml of LB medium at 37 ° C. Then the overnight culture was transferred into 500 ml of fresh LB medium containing kanamycin 30 μg / ml and grown at 37 ° C to a cell density of 0.8-1.0 about. e. a wavelength of 600 nm, then isopropyl-β-D-1-thiogalactopyronazide (IPTG) is added to a final concentration of 0.5 mM. The cell culture is incubated at 30 ° C and intensive aeration for 4 hours. At the end, cells are pelleted by centrifugation for 10 min at 3500 rpm and stored at -20 ° C until the recombinant polypeptides are isolated.

Example 4. Isolation and purification of recombinant chimeric polypeptides.

Isolation and purification of recombinant chimeric polypeptides from the obtained biomass (Example 3) is carried out using single-stage affinity chromatography of a cell lysate on a column of Ni-NTA-sepharose CL-6B in both native and denaturing conditions according to the protocol of the manufacturer Quiagen ( USA).

Denaturing conditions using guanidine and urea are used to isolate recombinant chimeric polypeptides. Cells are lysed in a 6M guanidine chloride solution. The debris is then precipitated by centrifugation at 16,000 g for 30 minutes. The lysate is incubated with the resin for one hour at room temperature, after which the suspension is loaded into the column. The column is washed with a buffer containing 8 M urea. The elution of recombinant chimeric polypeptides is carried out with a buffer containing a stepwise imidazole gradient: 20, 40, 60, 80, 250 and 500 mm. Recombinant chimeric polypeptides containing a C-terminal 8-histidine fragment remain bound to the sorbent, while bacterial proteins pass freely through the column. The main pool of the target recombinant chimeric polypeptide is washed from the column with a solution of 250 mm imidazole. Fractions are collected during chromatography, then analyzed by electrophoresis in Lemmley SDS-PAGE plates. The gels are stained with Kumasi R250 solution. An example of electrophoretic analysis of fractions obtained during chromatographic purification of the chimeric protein _rm BmpA- _fr p83 is shown in FIG. 2.

The purest fractions are combined, the protein concentration is measured according to Lowry and stored at -20 ° C until use in ELISA. The yield of proteins from one liter of cell culture of E. coli strain BL21 (DE3) averages 40-50 mg / L. The purity of recombinant chimeric proteins reaches at least 95%.

Example 5. The use of purified recombinant chimeric polypeptides for immunofermet analysis.

The study of the immunochemical properties of recombinant chimeric polypeptides is carried out using standard enzyme-linked immunosorbent assay (ELISA). The solid phase in all ELISA variants is 96-well flat-bottomed polystyrene plates. For the study using blood serum samples of various groups of donors:

- a group of patients with a reliable diagnosis of ICD (serum taken in the period 2-8 weeks from the onset of the disease);

- a group of healthy donors (sera were tested for the presence of antibodies of the IgG and IgM classes against spirochetes of the complex B.burgdorferi s.1. and Treponema pallidum using available commercial diagnostic kits).

Serum was obtained from the 1st city infectious diseases hospital in Novosibirsk and the regional AIDS center (Novosibirsk).

To prepare a working solution of antigen and its subsequent sorption on tablets, 0.02 M carbonate-bicarbonate buffer solution with a pH of 9.6 is used. For washing the plates, diluting the sera and preparing the working solution of the conjugate, phosphate-buffered saline containing 0.15 M sodium chloride and 0.1% tween-20 (FSB) is used. The substrate solution includes 0.05 M citrate buffer (pH-5.0), hydrogen peroxide (0.035%) and orthophenylenediamine (0.05%). To identify a specific antigen-antibody complex, peroxidase conjugates based on monoclonal antibodies (MA) to human IgG and IgM are used. MA-based conjugates were obtained from the hybridoma technology laboratory of the Central Research Institute of X-ray Radiology of the Ministry of Health of the Russian Federation.

The antigen is diluted in carbonate-bicarbonate buffer (pH 9.6) to a working concentration, introduced into the wells of the tablet 100 μl and left for sorption at + 4 ° C for 15-18 hours. The working concentration is determined by testing the sera of healthy donors and the sera of patients with a reliable diagnosis of tick-borne borreliosis at different stages of the disease. After sorption is complete, the plates with immobilized antigen are washed twice with a carbonate-bicarbonate buffer solution with 0.05% Tween-20, and a solution volume of at least 250 μl is added to each well of the tablet. After washing, the residual liquid is removed, 100 μl of serum blocking solution are added to all wells of the plate, and then 10 μl of the tested sera are diluted 1:10, the plate is closed with a lid and incubated for 30 min at 37 ° C. As a solution for serum dilution, glycine buffer (GSB) with the addition of 2.0 μg / ml of E. coli BL21 cell lysate (DE3) was added to eliminate non-specific binding.

After incubation, the plates are washed with a washing solution (at least 6 times) and after removing moisture, 100 μl of the conjugate in working dilution are added to each well. The plate is incubated for 30 min at 37 ° C and then washed with a washing solution at least 6 times. Residual moisture is removed from the plate and 100 μl of peroxidase substrate is added to each well. The substrate is prepared immediately before use. The o-phenylenediamine tablet is dissolved in citrate-phosphate buffer to a final concentration of 0.5 μg / ml. After adding the substrate, the tablet is placed in a dark place and incubated for 20 minutes at room temperature. The reaction is stopped by adding 50 μl of a 2 M sulfuric acid solution to each well.

ELISA results are recorded on a Multiscan reader (Finland). Optical density (OD) is measured at a wavelength of 450 nm. The result is taken into account only if the average OD value in wells with conjugate control (OD _Kk ) does not exceed 0.2, in wells with K ^{(-) the} average OD value (OD _K ) is no more than 0.2, and in wells with K ^{(+ ) the} average value of OD (OD _{to +} ) is not less than 0.7. The results of ELISA are determined by the formula:

OD crit = srv. OD K ^(-) +0.2;

where 0.2 is the coefficient established by the statistical processing of the results.

Samples whose OD values are lower than the critical OD values are classified as seronegative. Samples whose OD values are equal to or greater than the critical OD value are evaluated as seropositive. The results of a study of the reactivity of recombinant chimeric polypeptides with serums are presented in table 3.

All sera from the group of healthy donors (n = 10) showed a negative result.

The ELISA data presented in Table 3 convincingly prove the specificity of the interaction of recombinant chimeric polypeptides with IgG and IgM antibodies in patients with tick-borne tick-borne borreliosis. Each claimed recombinant chimeric polypeptide may be suitable for the diagnosis of tick-borne tick-borne borreliosis, including for differentiated detection of an early stage and the stage of disseminated infection.

BIBLIOGRAPHY

1. Stanek G, Reiter M. The expanding Lyme Borrelia complex - clinical significance of genomic species? // Clin Microbiol Infect. 2011.17 (4). 487-493. doi: 10.1111 / j.1469-0691.2011.03492.x.

2. Postic D., Korenberg E., Gorelova N., Kovalevski Y. V., Bellenger E., Baranton G. Borrelia burgdorferi sensu lato in Russia and neighboring countries: high incedence of mixed isolates // Res. Microbiol. 1997.148. 691-702.

3. Korenberg EI, Nefedova VV, Fadeeva IA, Gorelova NB The main results of the genotyping of borrelia in Russia // Bull. Siberian medicine. 2006. Appendix 1. 87-92.

4. Masuzawa T., Naumov RL, Kudeken M., Kharitonenkov I.G. Detection of Borrelia burgdorferi sensu stricto in the Moscow region, Russia // Medical parasitology and parasitic diseases. 2001. (2). 52.

5. Gorelova N.B., Korenberg E.I., Postik D., lunicheva Iu.V., Riabova T.E. The first isolation of Borrelia burgdorferi sensu stricto in Russia // Zh. Mikrobiol. Epidemiol. Immunobiol. 2001.4. 10-12.

6. Rudakova S.A., Kolomeets A.N., Samoilenko I.E., Kuzminov A.M., Rudakov N.V. Express diagnostics of transmissible pathogens as the basis of a differentiated approach to the prevention of infections transmitted by ixodid ticks // Bull. SB RAMS. 2007. No4. S.116-119.

7. Beklemishev A.V., A.K. Dobrotvorsky, A.V. Peterina, I. D. Ivanov, N. Yu. Nomokonova, N. N. Livanova. Detection and typing of Borrelia burgdorferi sensu lato genospecies in Ixodes persulcatus ticks in West Siberia, Russia. // FEMS Microbiol Lett. 2003 V.227, N.2, - P.157-161.

8. Ryabchenko A.V., Beklemishev A.B. Monitoring infestation of ticks in the recreational zone of Novosibirsk by Lyme borreliosis pathogens. Bulletin of the NSU, 2007, V.5, issue 1, S.106-110.

9. Mamaev A.L., Ryabchenko A.V. and Beklemishev A.B. Genetic composition of spirochetes Borrelia burgdorferi sensu lato circulating in ixodid ticks caught in the spring of 2008 in the recreational zone of Novosibirsk. // Bulletin SB RAMS. 2010, T. 30, No. 2. S.13-16.

10. Wang, G., van Dam A.P., Schwartz // J. Clin. Microbiol. Rev. - Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. - 1999. - Vol. 12. - P.633-653.

11. Parola, P., and D. Raoult. Tick-borne bacterial diseases emerging in Europe // Clin. Microbiol. Infect. - 2001. - V.7. - P.80-83.

12. Bruckbauer H.R., Preac-Mursic V., Fuchs R., Wilske B. Cross-reactive proteins of Borrelia burgdorferi // Eur J Clin Microbiol Infect Dis. - 1992. - V.11. - N.3 - P.224-232.

13. Carreiro MM, Laux DC, Nelson DR. Characterization of the heat shock response and identification of heat shock protein antigens of Borrelia burgdorferi // Infect Immun. - 1990. - V.58. - N.7. - P.2186-2191.

14. Magnarelli LA, Miller JN, Anderson JF, Riviere GR. Cross-reactivity of nonspecific treponemal antibody in serologic tests for Lyme disease // J Clin Microbiol. - 1990. - V.28. - N.6. - P.1276-1279.

15. Wilske B, Fingerle V, Schulte-Spechtel U. Microbiological and serological diagnosis of Lyme borreliosis // FEMS Immunol Med Microbiol. - 2007. - V.49. - N.1. - P.13-21.

16. Ge Y., li C., Corum L., et al. Structure and expression of the FlaA periplasmic flagellar protein of Borrelia burgdorferi. // Journal of Bacteriology. - 1998. - V.180. - P.2418-2425.

17. Gilmore R. D. Jr., Murphree R.L., James A.M., Sullivan S.A., Johnson B.J. The Borrelia burgdorferi 37-kilodalton immunoblot band (P37) used in serodiagnosis of early lyme disease is the flaA gene product // J. Clin. Microbiol. - 1999. - V.37. - P.548-552).

18. Berland R., Fikrig E., Rahn D., Hardin J. and FlaVell R .. Molecular characterization of the humoral response to the 41-kilodalton flagellar antigen of Borrelia burgdorferi, the Lyme disease agent. // Infection and Immunity. - 1991 .-- V.59. -. P.3531-35).

19. Steere A.C., Klitz W., Drouin E.E., Falk B.A., Kwok W.W., Nepom G.T., Baxter-Lowe L.A. Antibiotic-refractory Lyme arthritis is associated with HLA-DR molecules that bind a Borrelia burgdorferi peptide // J. Exp. Med. - 2006. - V.203. - P.961-971.

20. Aberer E. Lyme borreliosis - an update // JDDG. - 2007. - No. 5. - P.406-413.

21. Heikkila T., Seppala I., Saxen H., Panelius J., Yrjanainen H., Lahdenne P. Species-specific serodiagnosis of Lyme arthritis and neuroborreliosis due to Borrelia burgdorferi sensu stricto, B.afzelii, and B.garinii by using decorin binding protein A // J. Clin. Microbiol. - 2002. - V.40. - P.453-460.

22. Heikkila T., Seppala I., Saxen H., Panelius J., Peltomaa M., Huppertz HI, Lahdenne P. Cloning of the gene encoding the decorin-binding protein B (DbpB) in Borrelia burgdorferi sensu lato and characterization of the antibody responses to DbpB in Lyme borreliosis // J. Med. Microbiol. - 2002. - V.51. - P.641-648.

23. Roessler D., Hauser U. and Wilske B. Heterogeneity of BmpA (P39) among European isolates of Borrelia burgdorferi sensu lato and influence of interspecies variability on serodiagnosis. // Journal of Clinical Microbiology. - 1997. - V.35. - P.2752-2758).

24. EP 1865062 "Altered OspA of Borrelia burgdorferi)), A16K 39/02, C07K 14/20, publ. 12.12.2007 r.

25. US 5747294 "Compositions and methods for the prevention and diagnosis of Lyme disease", C07K 14/20, A61K 39/00, publ. 05/05/1998

26. US 5686267 "Nucleic acid molecule encoding antigen associated with lyme disease", C07K 14/20, publ. 11/11/1997

27. WO 0078966 "Groups of Borrelia burgdorferi and Borrelia afzelii that cause Lyme disease in humans", A61K 39/02, publ. 12/28/2000

28. RU No. 2260047 "Recombinant plasmid DNA for the synthesis of the immunodominant protein Borrelia garinii NT29 used for the diagnosis of Lyme borreliosis (options)", C12N 15/09 publ. 09/10/2005 BI No. 25.

29. US No. 20040142399 "Recombinant FlaA as a diagnostic reagent", C07K 14/20, publ. 07/22/2004

30. US No. 6248562 "Chimeric proteins comprising borrelia polypeptides and uses therefor", C07K 14/20, publ. 06/19/2001

31. Manzenyuk I.N., Manzenyuk 0.10. Tick borreliosis (Lyme disease). Koltsovo. 2005 g. // http://entomologs.ru/laima_prodrobno_7.php

32. Marangoni A., Sparacino M., Cavrini F., Stomi E., Mondardini V., Sambri V. and Cevenini R. Comparative evaluation of three different ELISA methods for the diagnosis of early culture-confirmed Lyme disease in Italy./ / J Med Microbiol. - 2005. - V.54. - N.4. - P.361-367.

33. Lime borreliosis (Borrelios) // http://laboratory.rusmedserv.com/diaginfect/sintez/laimborrelioz/

34. NovaTec Company presents new kits for the diagnosis of borreliosis // Site “Medical Diagnostic Laboratory”, rubric “Innovations in Medicine”. http://www.meddialab.ru/text/v_poslednee_.htm?PHPSESSID=7ff9945d79e7e1bf13410b48a611ca04

35. National Center for Biotechnology Information, USA. http://www.ncbi.nlm.nih.gov

36. Maniatis T., Fritsch E., Sambrook J. Methods of genetic engineering. Molecular Cloning // M., 1984. P.157-185.

37. Ryabchenko A.V., I.V. Ivleva, A.B. Beklemishev. A comprehensive assessment of the infection of ticks Ixodes persulcatus, common in the recreation area of the Novosibirsk Scientific Center, with spirochetes Borrelia burgdorferi s.1. // J. infectious pathology, 2004, T. 11, No. 3-5, - S. 107-110.

Table 1 Nucleotide sequences of primers used for amplification of B.burgdorferi s.1 genes. (restriction site underlined) Gene No.ID / Seq NO Primer Structure (5'-3 ') Enzyme Site _rm ospC _Bg 278F / 17 CGGAATTCTGGGGATACTGCATCTACTAATC EcoRI 340R / 18 CTTGGTACCAGGTTTTTTTGGACTTTCTGC KpnI _rm ospC _Ba 341F / 19 CTTGGTACCGGGGATTCTGCATCTACTAATCC KpnI 197R / 20 GAGCTCGAGAGGTTTTTTTGGACTTTCTGC Xhoi _fr flaB 356F / 21 GTGCTCGAGGCTTCTAGAAACACTTCAAAAGC Xhoi 281R / 22 CCGCTCGAGACTATTAGTTGTAGATGCTACAAC Xhoi _rm flaA 164F / 23 GCTGGTACCCTCAAGAGACTGATGGAT KpnI 165R / 24 CTGCTCGAGTTCTTCAGGTTTTTCACTCTC Xhoi _rm dbpB 162F / 25 CTTGGTACOGGATTAACAGGAGAAGTAAAAG KpnI 163R / 26 CATCTCGAGTATTTTTTTCTCCTCATCGT Xhoi _rm ospA 277F / 27 CACCTCGAGAAGCAAAATGTTAGCAGCCT Xhoi 277R / 28 CTGCCTCGAGTTTTAAAGCGGTTTTAAGC Xhoi _rm ospA 276F / 29 CACGAATTCTAAGCAAAATGTTAGCAGCCT EcoRI _fr p83 345F / 30 TGCCCTCGAGCCGGAAGATCAAAAATTATC Xhoi 108R731 TATCCGCTCGACTTCAACTTTCTTTAAAGT Xhoi _rm bmpA 109F / 32 GATCGAGGTACCATTTTTTTATCTTGTAGTG KpnI 110R / 33 CTACCTCTCGAGTTCTTTAAGGAATTTTTCA Xhoi Note: F and R are the forward and reverse primers, respectively.

table 2 Amplification conditions for B. burgdorferi s.1 gene fragments Gene Tm1 Tm2 Elongation time _rm ospC _Bg 59 ° C 70 ° C 1.5 min _rm ospC _Ba 59 ° C 72 ° C 1.5 min _fr flaB 52 ° C 69 ° C 2.0 min _rm flaA 55 ° C 70 ° C 2.0 min _rm dbpB 54 ° C 67 ° C 1.5 min _rm ospA 55 ° C 70 ° C 2.0 min _fr p83 44 ° C 67 ° C 2.0 min _rm bmpA 57 ° C 66 ° C 2.0 min Note: Tm1 is the primer annealing temperature, during the first 5 cycles (without taking into account the restriction site sequence at the 5'-end of the primer); Tm2 is the annealing temperature of the primers during the next 25 cycles (taking into account the sequence of the restriction site at the 5'-end of the primer).

Table 3 ELISA for the detection of antibodies of the IgM and IgG classes to the claimed recombinant chimeric polypeptides of borrelia by ELISA Recombinant Polypeptides Positive serum count Samples of sera from sick donors Samples of healthy donor sera To diagnose an early stage of ICD: IgM IgG IgM IgG (n = 25) (n = 25) (n = 10) (n = 10) _rm OspC _Bg - _rm OspC _Ba 21 24 0 0 _rm FlaA- _fr FlaB eighteen 21 0 0 To diagnose the stage of disseminated infection: _rm BmpA- _fr p83 twenty 23 0 0 _rm OspA- _fr p83 19 21 0 0 _rm DbpB- _rm OspA eighteen twenty 0 0 Note: n is the number of sera tested.

Claims (8)

1. A recombinant chimeric polypeptide for the serodiagnosis of Lyme disease Ixodes _{- rm BmpA- fr p83 (SEQ ID} NO 4) of size 591 aa with a molecular weight of 65.89 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature BmpA protein of the West Siberian isolate Borrelia garinii ( _rm BmpA) of 324 a.o. with a molecular weight of 35.3 kDa, and from the C-terminus, the amino acid sequence of the C-terminal fragment of the p83 protein of the West Siberian isolate Borrelia garinii ( _fr p83) of the West Siberian isolate Borrelia garinii of 248 a.o. with a molecular weight of 28.17 kDa. 2. Recombinant chimeric polypeptide for serodiagnosis of tick-borne ixodic borreliosis - _rm OspA- _fr p83 (SEQ ID NO 6) of 521 a.o. with a molecular weight of 57.99 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspA protein of the West Siberian isolate Borrelia garinii ( _rm OspA) of 257 a.o. with a molecular weight of 27.79 kDa, and from the C-terminus the amino acid sequence of the C-terminal fragment of the p83 protein of the West Siberian isolate Borrelia garinii ( _fr p83) of 248 a.o. with a molecular weight of 28.17 kDa. 3. Recombinant chimeric polypeptide for serodiagnosis of tick-borne ixodic borreliosis - _rm DbpB- _rm OspA (SEQ ID NO 8) of 432 aa in size. with a molecular weight of 47.13 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature protein DbpB of the West Siberian isolate Borrelia garinii ( _rm DbpB) of 156 aa in size. with a molecular weight of 17.02 kDa, and from the C-terminus, the amino acid sequence of the recombinant mature OspA protein of the West Siberian isolate Borrelia garinii ( _rm OspA) of 257 a.o. with a molecular weight of 27.79 kDa. 4. Recombinant chimeric polypeptide for serodiagnosis of tick-borne ixodic borreliosis - _rm FlaA- _fr FlaB (SEQ ID NO 10) of 587 a.o. with a molecular weight of 64.76 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature FlaA protein of the West Siberian isolate Borrelia garinii ( _rm FlaA) of 318 a.o. with a molecular weight of 35.82 kDa, and from the C-terminus, the amino acid sequence of the FlaB flagellar protein fragment specific for B.burgdorferi s.1 spirochetes. ( _fr FlaB) 250 a.o. with a molecular weight of 26.62 kDa. 5. Recombinant chimeric polypeptide for serodiagnosis of tick-borne ixodic borreliosis - _rm OspC _Bg - _rm OspC _Ba (SEQ ID NO 12) of 390 a.o. with a molecular weight of 40.83 kDa, containing from the N-terminus of the molecule the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia garinii ( _rm OspC _Bg ) of 188 a.o. with a molecular weight of 19.70 kDa, and from the C-terminus, the amino acid sequence of the recombinant mature OspC protein of the West Siberian isolate Borrelia afzelii ( _rm OspC _Ba ) of 186 a.a. with a molecular weight of 19.19 kDa. 6. A method for serodiagnosis of tick-borne tick-borne borreliosis by enzyme-linked immunosorbent assay, characterized in that combinations of recombinant chimeric polypeptides according to claims 1-5 are used as antigens. 7. The method according to claim 6, characterized in that for the diagnosis of an early stage, a combination of recombinant chimeric polypeptides according to claims 4, 5 is used as antigens. 8. The method according to claim 6, characterized in that for the diagnosis of the stage of disseminated infection, a combination of recombinant chimeric polypeptides according to claims 1 to 3 is used as antigens.

Images