AU2015328255A1 - Recombinant Borrelia proteins and methods of use thereof - Google Patents
Recombinant Borrelia proteins and methods of use thereof Download PDFInfo
- Publication number
- AU2015328255A1 AU2015328255A1 AU2015328255A AU2015328255A AU2015328255A1 AU 2015328255 A1 AU2015328255 A1 AU 2015328255A1 AU 2015328255 A AU2015328255 A AU 2015328255A AU 2015328255 A AU2015328255 A AU 2015328255A AU 2015328255 A1 AU2015328255 A1 AU 2015328255A1
- Authority
- AU
- Australia
- Prior art keywords
- borrelia
- antigens
- recombinant
- proteins
- antibodies
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/20—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6854—Immunoglobulins
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/20—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/26—Infectious diseases, e.g. generalised sepsis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Hematology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Food Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Peptides Or Proteins (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
Borrelia burgdorferi recombinant proteins and methods of assessing a sample for the presence of antibodies to certain proteins of Borrelia burgdorferi, are described, as are methods of diagnosing Lyme disease. Microarrays of proteins of Borrelia burgdorferi are also described.
Description
PCT/US2015/054303 WO 2016/057562 - 1 -
RECOMBINANT BORRELIA PROTEINS AND METHODS OF USE THEREOF RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 62/076,059, filed on November 6, 2014 and U.S. Provisional Application No. 5 62/060,867, filed on October 7, 2014. The entire teachings of the above applications are incorporated herein by reference.
INCORPORATION BY REFERENCE OF MATERIAL IN ASCII TEXT FILE
This application incorporates by reference the Sequence Listing contained in the following ASCII text file being submitted concurrently herewith: 10 a) Filename: 43381001002_SEQUENCELISTING.txt; created
October 6, 2015, 120 KB in size.
GOVERNMENT SUPPORT
This invention was made with government support under CK000150 from Centers for Disease Control (CDC). The government has certain rights in the 15 invention.
BACKGROUND OF THE INVENTION
Lyme disease is the most common vector-borne disease in North America and Europe, and its range and incidence are increasing. Human Lyme disease is caused by several members of a group of closely related spirochetes belonging to the 20 Borrelia burgdorferi sensu lato species complex. The spirochete is transmitted to humans via ticks of the genus Ixodes (Steere, A. C., N. Engl. J.Med. 1989; 321:586-96). It is a progressive multisystem disorder characterized by an initial cutaneous infection that can spread early in infection to secondary sites that include the nervous system, heart and joints (Masuzawa, T. et al., Microbiol. Immunol. 1996; 25 40:539-45; Stanek, G.,Infection 1991; 19:263-7). The accurate diagnosis and treatment of Lyme disease depends on correlating objective clinical abnormalities with serological evidence of exposure to B. burgdorferi. WO 2016/057562 PCT/US2015/054303 -2-
SUMMARY OF THE INVENTION
The present invention encompasses novel recombinant Borrelia burgdorferi proteins and their use in highly sensitive and specific methods of diagnosing Lyme disease in a subject. In particular, the present invention is drawn to recombinant 5 Borrelia fusion protein constructs comprising at least three recombinant Borrelia burgdorferi protein antigens. These constructs are also referred to herein as Borrelia chimeric protein antigens, or Borrelia chimeras. The fusion protein constructs are described in Tables 4, 5, 6 and 8 herein.
The present invention is also drawn to methods of using one, or more, or all, 10 of these recombinant Borrelia fusion proteins in assays for assessing test samples for detecting the presence of antibodies to Borrelia burgdorferi in the test sample. For example, the Borrelia fusion proteins described herein (e.g., Tables 4, 5, 6 and 8) can be used to prepare protein arrays, or microarrays, for use in the detection methods, as well as in ELISA, other immunological assays, or any assay method 15 capable of detecting antibody-antigen binding or antibody-antigen binding complexes. In addition to the use of the Borrelia fusion proteins of Tables 4, 5, 6 and 8 in these detection assays, one, or more, additional recombinant Borrelia antigens can be included in such assays or microarrays, such as the recombinant Borrelia antigens listed in Table 1. In one embodiment of the present invention, the 20 microarray comprises the 25 recombinant Borrelia antigens and chimeric proteins of Table 6. In another embodiment, the microarray comprises the 11 recombinant Borrelia antigens and chimeric proteins of Table 8.
Further encompassed by the present invention are methods of diagnosing Lyme disease in a subject (such as a mammal, including a human) by assessing a 25 test sample obtained from the subject for antibodies reactive with one, or more of the recombinant Borrelia burgdorferi fusion proteins of Tables 4, 5, 6 or 8, or, additionally one, or more, of the recombinant Borrelia antigens listed in Table 1, wherein the detection of antibody-antigen reactions (such as antibody-antigen bound complexes, also referred to herein as antibody-antigen reaction products) are 30 indicative of Lyme disease in the individual. Such assays to detect antibody-antigen complexes are well-known to those of skill in the art. In a particular embodiment of the present invention, microarrays are used in the detection/diagnostic assays, PCT/US2015/054303 WO 2016/057562 -3- wherein the microarrays comprise the recombinant Borrelia chimeric proteins described herein as in Tables 4, 5, 6 and 8, and also recombinant Borrelia antigens described in Table 1. In one embodiment of the present invention, the microarray comprises the 25 recombinant Borrelia antigens and chimeric proteins of Table 6. 5 In another embodiment, the microarray comprises the 11 recombinant Borrelia antigens and chimeric proteins of Table 8.
As a result of this discovery, highly sensitive and specific methods and microarrays are now available for the assessment of a test sample for the presence of antibodies to proteins of Borrelia. The presence of such antibodies is diagnostic for 10 Lyme disease. In addition, methods are available to identify potential diagnostic and vaccine candidates relating to Lyme disease.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing will be apparent from the following more particular description of example embodiments of the invention, as illustrated in the 15 accompanying drawings in which like reference characters refer to the same parts throughout the different views. The drawings are not necessarily to scale, emphasis instead being placed upon illustrating embodiments of the present invention.
The Figure depicts the amino acid sequences of the chimeric antigens of Table 6 (SEQ ID NOS: 3-27) and variants of OC2/9 (SEQ ID NOS: 28-30).
20 DETAILED DESCRIPTION OF THE INVENTION A description of example embodiments of the invention follows.
Accurate, reliable diagnostic assays for Lyme disease are critical to ensure successful treatment and recovery. However, serodiagnosis of the disease is particularly difficult due to the high level of genetic heterogeneity of B. burgdorferi 25 isolates, even among those collected from a single location. Furthermore, current serodiagnostic tests for Lyme disease lack sensitivity and specificity for detecting B. burgdorferi infection in the early stages of the disease. In the present invention, 48 highly antigenic Borrelia proteins have been identified. These recombinant Borrelia protein antigens are recognized by the majority of all sera samples analyzed 30 including sera from patients with early Lyme disease. Moreover, this library of PCT/US2015/054303 WO 2016/057562 -4- highly antigenic Borrelia proteins has been used to develop a set of recombinant Borrelia chimeric antigen proteins as shown in Tables 4, 5 and 6 and a highly sensitive and specific recombinant protein-based assay containing the 25 recombinant and chimeric antigens of Table 6, or the 11 recombinant antigens and 5 recombinant chimeric antigens (Table 8) as described herein.
It has been discovered that antibodies to certain cell envelope proteins are present in sera of individuals with Lyme disease. As described herein, microarrays containing recombinant Borrelia burgdorferi antigenic proteins and chimeric antigens were prepared. The microarrays were exposed to test samples such as sera 10 from individuals previously diagnosed with disseminated Lyme disease. Results indicated that the sera of individuals with Lyme disease reacted with specific recombinant Borrelia proteins as shown in Tables 1, 4, 5, 6 and 8. In particular, high numbers of the sera from the individuals reacted with a specific subset of those proteins as those shown in Tables 6 and 8. Results indicated that the sera of 15 individuals with Lyme disease reacted with the recombinant and chimeric Borrelia proteins, shown in Tables 1 and 4, and 5 and in particular with the highly immunogenic proteins, shown in Tables 6 and 8. The overall sensitivity and specificity of the Lyme disease assay as described herein is shown in Tables 2, 3, 7, 9 and 10. 20 In certain methods and the microarrays of the invention, one or more recombinant cell envelope protein antigens, recombinant antigens and/or chimeric antigens (fusion protein constructs) are used. In certain embodiments, a set of two or more antigens are used. Other embodiments encompassed herein include three antigens, four antigens, five antigens and so forth, up to the 11 antigens of Table 8, 25 the 16 antigens of Table 4, the 25 antigens of Table 6, the 96 antigens of Table 5 or the 48 antigens of Table 1, or all of the antigens from the afore-mentioned Tables. Representative sets include the set of proteins shown in Tables 1, 4, 5, 6, and 8. Such sets can further include homologs and paralogs of the cell envelope proteins. In one particular embodiment, the set consists essentially of the antigens set forth in 30 Table 6. In another particular embodiment, the set consists essentially of the antigens set forth in Table 8. PCT/US2015/054303 WO 2016/057562 -5 -
In further methods and the microarrays of the invention, one or more other proteins as identified herein are used, other combinations of proteins are used (e.g., proteins selected from any of Tables 1, 4, 5, 6 and 8, in combination). Such combinations include sets of two or more, three or more, four or more, five or more, 5 six or more, seven or more, eight or more, or other groups of proteins (e.g., with one or more selected from Table 1, Table 5 and/or Table 6).
In another embodiment of the invention, a test sample from an individual is assessed for the presence of antibodies to one or more proteins (e.g., recombinant or chimeric antigens) of B. burgdorferi). The “test sample” is a sample of blood, 10 serum, cerebrospinal fluid, or other appropriate biological fluid from the individual. In the methods, the test sample is assessed for the presence of antibodies to one or more proteins using routine methods established in the art. In one particular embodiment, the assessment is performed using a microarray of Borrelia proteins.
In certain methods, for example, an array, eg. a microarray as described below, or a 15 protein or set of proteins as described herein, is exposed to the test sample from the individual, and any resultant binding of antibodies (if present in the test sample) to the proteins is determined. The presence of antibodies bound to (also referred to herein as “reactive with”) one, or more, antigens is indicative of antibodies specific to those proteins of B. burgdorferi. The presence of such antibodies is diagnostic for 20 Lyme disease in the individual from whom the test sample was obtained.
The assay methods described herein encompass arrays of B. burgdorferi antigens. In one embodiment, the array comprises a subset of recombinant proteins of B. burgdorferi, such as the set the proteins set forth in Tables 1, 4, 5, 6 or 8. In other embodiments, other arrays include various subsets of proteins of B. 25 burgdorferi, such as sets of two or more, four or more, six or more, eight or more, or other groups of antigenic proteins as set forth in Tables 1, 5 or 6. In one particular embodiment, the microarray consists essentially of all of the proteins set forth in Table 6, or consists of all of the proteins set forth in Table 6. In another particular embodiment, the microarray consists essentially of all of the proteins set forth in 30 Table 8, or consists of all of the proteins of Table 8. In further embodiments, other microarrays include various subsets of proteins of B. burgdorferi, such as subsets of the proteins set forth in Table 1 or in Table 5 (e.g., sets of two or more, four or more, PCT/US2015/054303 WO 2016/057562 -6- six or more, eight or more, or other groups of proteins as set forth in Table 6 or Table 8).
Other embodiments of the present invention encompass methods for the evaluation/assessment of other or additional proteins of B. burgdorferi as potential 5 candidates for development of a diagnostic test for Lyme disease, and also for assessment of proteins of B. burgdorferi as potential candidates for development of vaccines to protect against Lyme disease. In these methods, one or more proteins of B. burgdorferi, such as described herein in Table 6 or Table 8 (e.g., in a microarray as described above), are exposed to sera from one or more individuals known to 10 have Lyme disease, and the proteins to which antibodies from the sera bind are then determined. For example, Cy5 intensity/Cy3 intensity ratio of fluorescence, as described in the Examples, can be used. The ratio of any proteins greater than the mean ratio of the reactivity of the Lyme sera to a negative control plus three times the standard deviation indicates significant interactions between antibodies present 15 in the Lyme sera and the B. burgdorferi protein. It is reasonable to believe that such proteins are useful for vaccine compositions to elicit an immune response in a subject, as described below. Such proteins are also proteins which can be used in diagnostic tests for Lyme disease (e.g., in the methods described above), as well as in microarrays as described herein, and additionally can be used as potential vaccine 20 candidates.
The proteins identified herein as reacting with sera of individuals with Lyme disease are useful as vaccine immunogens against Borrelia infection. Thus, the present invention is also drawn to pharmaceutical compositions which can be used to vaccinate and/or treat Borrelia infection in an animal or human. In a particular 25 embodiment, the pharmaceutical composition comprises one, or more, Borrelia burgdorferi antigen, such as one shown in Tables 5, 6 or 8, or another Borrelia burgdorferi antigen, such as one shown in Table 1, or a protein derived from a cell envelope protein or other protein (e.g., a protein having modifications such as insertions, deletions, or other alterations, or a protein that forms part of a chimeric 30 protein, such as those described in U.S. patents 6,248,562; 7,008,625; 7,060,281; and 7,179,448, the entire teachings of which are incorporated herein by reference). PCT/U S2015/054303 WO 2016/057562 -7-
Combinations of the proteins described herein (e.g., those in Tables 1, 5, 6 and 8) can also be used.
The pharmaceutical composition can also be administered together with a physiologically-acceptable carrier, an excipient and/or an adjuvant. Suitable 5 adjuvants are well known in the art (see for example PCT Publication WO 96/40290, the entire teachings of which are incorporated herein by reference), and can be used, for example, to enhance immunogenicity, potency or half-life of the proteins in the treated animal.
The pharmaceutical compositions used to vaccinate and/or treat Borrelia 10 infection can be prepared using methods for preparing vaccines which are well known in the art. For example, the proteins described herein can be isolated and/or purified by known techniques, such as by size exclusion chromatography, affinity chromatography, ion exchange chromatography, preparative electrophoresis, selective precipitation or combinations thereof. The prepared proteins can be mixed 15 with suitable other reagents as described herein, such that the protein is at a suitable concentration. The dosage of the protein will vary and depends upon the age, weight and/or physical condition of the animal, e.g., mammal, human, to be treated. The optimal dosage can be determined by routine optimization techniques, using suitable animal models. 20 Administration of the pharmaceutical composition to be used as a vaccine can be by any suitable technique. Suitable techniques for administration of the pharmaceutical composition include, but are not limited to, injection, e.g., subcutaneous injection, intramuscular injection, intravenous injection, intra peritoneal injection; mucosal administration, e.g., exposing nasal mucosa to nose 25 drops containing the proteins of the present invention; oral administration; and DNA immunization.
In addition, the proteins identified herein as reacting with sera of individuals with Lyme disease (e.g., those shown in Table 1 and/or Table 4 and/or Table 5, and in particular Tables 6 and 8) as well as the methods described herein can be used as 30 prognostic markers enabling one skilled in the art to tailor treatment for disease by targeting those specific proteins. For example, should an individual’s serum demonstrate reactivity with a particular subset of proteins, therapy can be initiated to PCT/U S2015/054303 WO 2016/057562 -8- reduce and/or eliminate the presence of those proteins in the individual, as shown by reducing and/or eliminating reactivity of the individual’s serum with those proteins.
The present invention is also drawn to diagnostic and/or prognostic kits which comprise the proteins described herein (e.g., in a microarray as described 5 above). The kit also includes reagents for detecting antibody-antigen complexes that are formed between the protein and antibodies that are present in a sample, e.g., a user-supplied host sample.
The specific embodiments of the present invention are described in the following examples, which are not to be interpreted as limiting in any way. 10 EXAMPLE 1: Discovery of 48 Borrelia Antigens.
Protein arrays. A total of 416 genes were identified in the B. burgdorferi genome comparison. Of these, 350 (84%) produced a product that was the correct size when PCR was performed, and all 350 were successfully cloned into the T7 expression 15 vector pET28b. Sequence confirmed plasmids were expressed using the overnight autoexpression system; expressed proteins were purified using IDA resin and printed onto nitrocellulose coated FAST slides (see for example, US Serial No. 12/784,584 and US Serial No. 12/989,003, the teaching of which are incorporated herein). In addition, representatives of several different OspC types were amplified from human 20 isolates. The OspC types included in this study were types A, B, C, D, E, F, G, Η, I, J, K and U. This study also included the highly antigenic B31 cell envelope proteins that were identified in an earlier protein array study (Xu Yet al, 2008). In total, the arrays contained approximately 400 samples including expressed Borrelia proteins, negative controls and blanks. Arrays were probed with sera from Lyme disease 25 patients and antibodies were visualized with Cy5-conjugated goat antihuman lgG or Cy5-conjugated goat anti-human lgM to determine antibody isotype (Xu Y et al, 2008).
Serum samples. For earlier array studies, sera of patients with Lyme disease were obtained from the Centers for Disease Control (CDC). The CDC samples included 30 sera from 31 patient collected upon initial presentation (Samples C =0 days) and at 10 days (Samples D), 20 days (Samples E), 30 days (Samples F), 60 days (Samples G), and 90 days (Samples H) post presentation. Fourteen late Lyme samples (Late) PCT/US2015/054303 WO 2016/057562 -9- from patients who exhibited late clinical manifestations (Lyme arthritis or neuroborreliosis) obtained from the Lyme Disease Center at Stony Brook University were also analyzed. A total of 115 samples were analyzed that included 21 Sample C, 29 Sample D, 15 Sample E, 8 Sample F, 1 Sample G and 12 Sample H. Normal 5 control sera (n=14) were obtained from healthy donors.
To further assess protein arrays, sera were obtained from Dr. Mark Soloski, Johns Hopkins School of Medicine, Baltimore MD. The samples included sera from 50 patients collected upon initial presentation (sample VI =diagnosed early Lyme, prior to treatment) and at three weeks (Samples V2=three weeks following diagnosis 10 /and begin of treatment), seven weeks (Samples V3=seven weeks following diagnosis/treatment), and fifteen to seventeen weeks (Samples V4=~15 - 17 weeks following diagnosis/treatment) post presentation. A total of 46 samples per group were analyzed. For specificity studies, sera were obtained from patients with diseases associated with serological responses that are known to produce cross-15 reactivity in Lyme disease tests. These included patients with syphilis, lupus, and rheumatoid arthritis. Normal control sera were obtained from healthy donors. Results. Approximately 140 of the arrayed proteins delectably elicited an antibody response in humans with natural infections using both secondary antibodies. Of these 140 antigens, 80 proteins were recognized by at least half of the sera samples 20 from each time point. Importantly, the majority of sera recognized at least one antigen from a subset of 48 highly antigenic Borrelia proteins using lgM and lgG secondary antibody (Table 1). This high positivity included all sera that were collected when the patient was first seen for their erythema migrans. These 48 protein's Cy5/Cy3 ratios were among the highest observed in the arrays, averaging 25 greater than five times the standard deviation above the mean ratio of the reactivity of the Lyme sera to the negative control. In addition, a BLASTx search with highly immunogenic Borrelia proteins against the NCBI non-redundant protein database excluding all recorded Borrelia sequence revealed no significant matches to other organisms. Interestingly, 40 of the 48 antigens are plasmid encoded and the 30 majority of encoded proteins are outer surface proteins, lipoproteins or putative outer membrane proteins. Over 90% of plasmid gene sequences have no significant homologs to non-i?. burgdorferi genes. The uniqueness of plasmid sequences PCT/US2015/054303 WO 2016/057562 -10- suggests that they serve specialized adaptive roles for Borrelia's survival and propagation in nature and in a wide variety of hosts. Furthermore, the high numbers of outer surface lipoproteins encoded by the plasmids in conjunction with the variability of plasmid sequences supports the view that these sequences are directly 5 involved in parasite-host interactions, and therefore, are more than likely to be key immunogens (Casjens et al, 2000).
Table 1. 48 Highly Antigenic Borrelia proteins. Locus Protein name Locus Protein name BB 0024 hypothetical protein BB 138 hypothetical protein BB 0067a hypothetical protein BB J01 hypothetical protein BB 0312 chemotaxis protein CheW BB J23 hypothetical protein BB 0337 enolase BB K07 hypothetical protein BB 0364 methylglyoxal synthase BB N26 hypothetical protein BB 0546 hypothetical protein BB R22 hypothetical protein BB 0744 antigen, p83/100 BB S42 BapA protein BB 0858 hypothetical protein BbuJDl F28 VLS-like protein BB A14 hypothetical protein BbuJDl F31 VLS-like protein BBA16 outer surface protein B (OspB) BbuJDl_S13 hypothetical protein BB A60 surface lipoprotein P27 BbuN40 042 Erp26 protein BB A65 lipoprotein BbuN40 V37 Erp25 protein BB A66 outer surface protein BbuN40 X36 Erp27 protein BB A73 putative antigen P35 Bbu297_B19 outer surface protein C (OspC) BB A74 outer membrane porin OMS28 Bbu297_F32 VLS-like protein BB A70 hypothetical protein Bbu297 F33 VLS-like protein BB B07 alpha3-betal integrin-binding protein Bbu297_J03 hypothetical protein BB C08 hypothetical protein Bbu297 J03a hypothetical protein BB E09 protein p23 Bbu297 J05 hypothetical protein BB E19 hypothetical protein Bbu297_M38 bbK2.10 protein precursor BB G01 hypothetical protein Bbu297 P39 Erp42 protein WO 2016/057562 PCT/US2015/054303 - 11 - BBH18 hypothetical protein Bbu297_R41 MlpL (multicopy lipoproteins) BB H37 hypothetical protein Bbu297 W44 hypothetical protein BB 116 repetitive antigen A Bbu297 Y03 hypothetical protein
The sensitivity of the assay described herein far exceeds that of commercially available Lyme disease assays in patients in the early stages of the disease. The sensitivity of the present assay was compared with the 48 Borrelia 5 antigens with two-tier testing using 29 of the early Lyme disease patients. Among the 29 patients with EM, the sensitivity of our protein array with lgM or lgG secondary antibody was 96% at initial presentation (Samples VI) and 97% during convalescence, 3 weeks later (Samples V2). In comparison, the percentages were 48% and 69%, respectively, for standard 2-tiered testing. The overall sensitivity and 10 specificity of the Lyme assay as described herein for this set of sera specimens are shown below in Table 2 and Table 3.
Table 2. Serologic Responses in Well-Characterized Lyme disease Patients: Sensitivity.
Immunoglobulin Sample Vl= Early Diagnosisa Samples V2= 3 weeks Samples V3= 7 weeks Samples v4= 15-17 weeks IgM 39/46 (85) 42/46 (91) 41/46 (89) 38/44 (86) IgG 38/46 (83) 4/46 (96) 43/46 (93) 39/44 (89) IgM + IgG 33/46/(72) 41/46 (89) 38/46 (83) 34/44 (77) IgM or IgG 44/46 (96) 45/46 (98) 46/46 (100) 43/44 (98) a = number positive/total (%). WO 2016/057562 PCT/US2015/054303 - 12-
Table 3. Serologic Responses in Normal Controls and Potentially Cross Reactive Patients:
Specificity.
Immunoglobulin Normal (%)a Sick-non-Lyme (%) IgM 40/40/(100) 26/28 (89) IgG 40/40(100) 24/28/(86) IgM+IgG 40/40(100) 27/28 (96) IgM or IgG 40/40/(100) 26/28 (93) 5 a = number negative/total (%). EXAMPLE 2: Protein Arrays using Recombinant Chimeric Borrelia Proteins. Overview. A library of chimeric proteins using 48 highly antigenic Borrelia proteins was designed for use in developing a recombinant chimera based diagnostic 10 assay for Lyme disease. Construction of recombinant chimeras containing genes from several genospecies allows one to generate one protein that confers antigenicity to multiple strains, revealing the great potential and adaptability of this technique.
In addition, the use of pure protein preparations as antigens offers greater flexibility in adapting the test to different assay formats. It is reasonable to believe that an 15 assay of recombinant chimeric proteins will present superior sensitivity in detecting antibodies against B. burgdorferi for the early stages of the disease, and equivalent sensitivity for the late stages of the disease, when compared to the best whole-cell assays.
Chimeric Proteins. From our library of 48 highly antigenic Borrelia proteins, we 20 constructed 16 sets of chimeric proteins each containing three of the Borrelia antigens (Table 4). Each Borrelia protein was randomly assigned to one fusion construct and all 6 possible protein order combinations were synthesized to determine whether secondary structural characteristics may be affecting the presentation of protein epitopes. The 96 fusion constructs are shown in Table 5. 25 Chimeras of three Borrelia antigens were chosen to keep the molecular mass of the fusion protein at, or less than (below) about 100 kDa to optimize protein yield, which can be significantly affected by protein size. WO 2016/057562 PCT/US2015/054303 - 13 -
Table 4. Structural Characterization of Borrelia Fusion proteins Fusion Protein ID Borrelia Proteins 1TR 1-6 BB_A74/BB_0744/Bbu297_W44 1TRI 7-12 BBH37/BBE-0/BBC08 1TRI 13-18 BBH 18/BbuN40_X3 6/BbuJD 1 _S 13 1TRI 19-24 Bbu297_F33/OspC/BB_116 A 1TRI 25-30 Bbu297_P3 9/BBE19/BBK07 1TRI 31-36 BB_A60/BB_0546/Bbu297_M38 1TRI 37-42 BB_A65/Bbu297_Y 03/BbuJD 1F28 1TRI 43-48 BBA73/BBN26/BB-312 2TRI 1-6 BB_0024/BB_0067a/BB_A 16 2TRI 7-12 BB_0337/Bbu297_F32/BbuJD 1_F31 2TRI 13-18 BB_0364/BB_A66/BB_S42 2TRI 19-24 BB_085 8/BBB -7/BBG01 2TRI 25-30 BB_A 14/BBI3 8/BBJ23 2TRI 31-36 BBA70/BBJ01/BB_$22 2TRI 37-42 Bbu297_J03/Bbu297_J03a/Bbu297_J05 2TRI 43-48 Bbu297_R41/BbuN40/Q42/BbuN40_V37 WO 2016/057562 PCT/US2015/054303 - 14-
Table 5. Composition of the 16 set of chimeric Borrelia protein Proteins for IT Trimer Gene Name Trimer List IT-1— IT-6 BB_0312 purine-binding chemotaxis protein (BB_0744,Bbu297_W44,BB_A74) BB_0546 conserved hypothetical protein BB_0744/Bbu297_ W 44/ B B_ A7 4 BB_0744 Borrelia P83/P100 antigen B B_0744/BB_A74/Bbu297_W44 BB_A60 surface lipoprotein P27 BB_A74/BB_0744/Bbu297_W44 BB_A65 lipoprotein, putative BB_A74/Bbu297_W44/BB_0744 BB_A73 putative antigen P35 B b u 297_W44/ B B_0744/ B B_A7 4 BB_A74 outer membrane porin OMS28 Bbu297_W44/BB_A74/BB_0744 BB_C08 TM2 domain family IT-7— 1T-12( BB_E09 protein p23 BB_H37,BB_E09,BB_C08) BB_E19 PF-32 protein BB_H37/BB_E09/BB_C08 BB_H18 lipoprotein, putative BB_H37/BB_C08/BB_E09 BB_H37 lipoprotein, putative virulent strain-associated BB_E09/BB_H37/BB_C08 BBJ16A repetitive antigen A (VraA protein) BB_E09/BB_C08/BB_H37 BB_K07 lipoprotein, putative BB_C08/BB_H37/BB_E09 BB_N26 Borrelia orf-D family VMP-like sequence protein VIsE BB_C08/BB_E09/BB_H37 Bbu297_F33 (Vis) IT-13— 1T-18( Bbu297_M38 bbK2.10 protein precursor BbuN40_X36,BB_H18,BbuJDl_S13) Bbu297_P39 Erp42 protein BbuN40_X36/BB_H18/BbuJDl_S13 Bbu297_W44 conserved hypothetical protein BbuN40_X36/BbuJDl_S13/BB_H18 Bbu297_Y03 hypothetical protein BB_H18/BbuN40_X36/BbuJDl_S13 BbuJDl_F28 vis recombination cassette VIslO BB_H18/BbuJDl_S13/BbuN40_X36 BbuJDl_S13 conserved hypothetical protein BbuJDl_S13/BB_H18/BbuN40_X36 BbuN40_X36 Erp27 protein BbuJDl_S13/BbuN40_X36/BB_H18 ospC K IT-19— lT-24( Bbu297_F33, ospC, BBJ16A) Bbu297_F33/ospC /BB_I16A Bbu297_F33/BB_ll6A/ospC ospC /Bbu297_F33/BB_ll6A ospC /BB_ll6A/Bbu297_F33 BB_ll6A/ospC /Bbu297_F33 BB_ll6A/Bbu297_F33/ospC IT-25— lT-30( Bbu297_P39, WO 2016/057562 PCT/US2015/054303 - 15 -
Proteins for IT Trimer Gene Name Trimer List BB_E19, BB_J47) Bbu297_P39/BB_E19/BB_J47 Bbu297_P39/BB_J47/BB_E19 BB_E19/BB_J47/Bbu297_P39 BB_E19/Bbu297_P39/BB_J47 BB_J47/BB_E19/Bbu297_P39 BB_J47/Bbu297_P39/BB_E19 IT-31— lT-36( BB_A60, BB_0546, Bbu297_M38) BB_A60/BB_0546/Bbu297_M38 BB_A60/Bbu297_M38/BB_0546 BB_0546/BB_A60/Bbu297_M38 BB_0546/Bbu297_M38/BB_A60 Bbu297_M38/BB_0546/BB_A60 Bbu297_M38/BB_A60/BB_0546 IT-36— IT-42 (BB_A65, Bbu297_Y03, BbuJDl_F28) BB_A65/Bbu297_Y03/BbuJDl_F28 BB_A65/BbuJDl_F28/Bbu297_Y03 Bbu297_Y03/BB_A65/BbuJDl_F28 Bbu297_Y03/BbuJDl_F28/BB_A65 BbuJDl_F28/Bbu297_Y03/BB_A65 BbuJDl_F28/BB_A65/Bbu297_Y03 IT-43— lT-48( BB_A73, BB_N26, BB_0312) BB_A73/BB_N26/BB_0312 BB_A73/BB_0312/BB_N26 BB_N26/BB_A73/BB_0312 BB_N26/BB_0312/BB_A73 B B_0312/B B_N 26/B B_A73 B B_0312/B B_A73/B B_N 26 WO 2016/057562 PCT/US2015/054303 -16-
Proteins for 2T Trimer Gene Name Trimer List 2T-1— 2T-6(BB_0024, BB_0067a, BB_0024 conserved hypothetical protein BB_A16) BB_0067a peptidase, putative BB_0024/BB_0067a/BB_A16 BB_0337 phosphopyruvate hydratase BB_0024/BB_A16/BB_0067a BB_0364 methylglyoxal synthase BB_0067a/BB_0024/BB_A16 BB_0858 hypothetical protein BB_0067a/BB_A16/BB_0024 BB_A14 Borrelia orf-D family B B_A16/B B_0024/B B_0067a BB_A16 outer surface protein B (OspB) B B_A16/B B_0067a/B B_0024 BB_A66 outer surface protein 2T-7— 2T-12( BB_0337, Bbu297_F32, BB_A70 conserved hypothetical protein putative alpha3-betal integrin- BbuJDl_F31) BB_B07 binding protein BB_0337/Bbu297_F32/BbuJDl_F31 BB_G01 putative lipoprotein BB_0337/BbuJDl_F31/Bbu297_F32 BB_I38 putative surface antigen Bbu297_F32/BB_0337/BbuJDl_F31 BBJ01 conserved hypothetical protein tetratricopeptide repeat Bbu297_F32/BbuJDl_F31/BB_0337 BB_J23 domain protein BbuJDl_F31/BB_0337/Bbu297_F32 BB_R22 conserved hypothetical protein BbuJDl_F31/Bbu297_F32/BB_0337 BB_S42 BapA protein 2T-13— 2T-18( BB_0364, BB_A66, Bbu297_F32 VlsF2 (Vis) virulent strain associated BB_S42) Bbu297_J03 lipoprotein BB_0364/BB_A66/BB_S42 Bbu297_J03a BB_0364/BB_S42/BB_A66 Bbu297_J05 lipoprotein, putative BB_A66/BB_0364/BB_S42 Bbu297_R41 MIpL BB_A66/BB_S42/BB_0364 BbuJDl_F31 vmp-like sequence (Vis) protein BB_S42/BB_0364/BB_A66 BbuN40_Q42 Erp26 protein BB_S42/BB_A66/BB_0364 BbuN40_V37 Erp25 protein 2T-19— 2T-24( BB 0858, BB_B07, BBG01) BB_0858/BB_B07/BB_G01 BB_0858/BB_G01/BB_B07 BB_B07/BB_0858/BB_G01 BB_B07/BB_G01/BB_0858 BB_G01/BB_0858/BB_B07 BB_G01/BB_B07/BB_0858 2T-25— 2T-30( BB_A14, BB_I38, BB_J23) BB_A14/BB_I38/BB_J23 WO 2016/057562 PCT/US2015/054303 - 17-
Proteins for 2T Trimer Gene Name Trimer List BB_A14/BB_J23/BB_I38 BB_I38/BB_A14/ BB_J23 BBJ38/ BB_J23/BB_A14 BB_J23/BB_A14/BB_I38 BB_J23/BB_I38/BB_A14 2T-31— 2T-36( BB_A70, BB_J0, BB_R22) BB_A70/BB_J0/BB_R22 BB_A70/BB_R22/BB_J0 BB_J01/BB_A70/BB_R22 BBJ01/BBR22/BBA70 BB_R22/BB_A70/BB_J01 BB_R22/BB_J01/BB_A70 2T-37— 2T-42( Bbu297_J03, Bbu297_J03a, Bbu297_J05) Bbu297_J03/Bbu297_J03a/Bbu297_J05 Bbu297_J03/Bbu297_J05/Bbu297_J03a Bbu297_J03a/Bbu297_J03/Bbu297_J05 Bbu297_J03a/Bbu297_J05/Bbu297_J03 Bbu297_J05/Bbu297_J03/Bbu297_J03a Bbu297_J05/Bbu297_J03a/Bbu297_J03 2T-43— 2T-48( Bbu297_R41, BbuN40_Q42, BbuN40_V37) Bbu297_R41/BbuN40_Q42/BbuN40_V37 Bbu297_R41/BbuN40_V37/BbuN40_Q42 Bbu N40_Q42/Bbu 297_R41/Bbu N40_V37 BbuN40_Q42/BbuN40_V37/Bbu297_R41 BbuN40_V37/Bbu297_R41/ BbuN40_Q42 BbuN40_V37/ BbuN40_Q42/Bbu297_R41
Cloning of recombinant fusion proteins. Borrelia genes encoding the 48 B. burgdorferi antigens were amplified using a unique gene-specific primer pair that we specifically designed for chimeric protein construction. The primers were 5 designed from the genomic sequence of B. burgdorferi strains and each contains a novel DNA cassettes coding for the recognition sequence for three restriction endonucleases that are in-frame with gene coding sequence. The 5' primer PCT/US2015/054303 WO 2016/057562 -18- (5'-AATTGGTACCCCAGGATCCCATATG + 15MER ORF specific sequence) (SEQ ID NO:l) contains Kpnl (underlined), BamHI (bold) and Ndel (italics) recognition sequence. The 3’ primer (5'GCGGGATCCGGTACCGTCGAC +15mer ORF specific sequence) (SEQ ID NO:2) contains BamHI, Kpnl and Sail (dashed 5 underline) recognition sequences. For amplification, ten ng of genomic DNA were used as template in a 50-μΙ PCR reaction containing two ORF-specific primer pairs. To increase the solubility properties of expressed cell envelope proteins, primer sets were designed to amplify coding regions without a membrane anchoring signal sequence (Dunn et al., 1990). PCR amplification was performed under stringent 10 conditions with Platinum Taq DNA polymerase High Fidelity (Invitrogen) using conditions we have previously described (Xu et al., 2003). The PCR products were visualized by agarose gel electrophoresis. For quantification, the products were purified (PCR purification kit, Qiagen) and quantified by UV absorbance.
To create the library of recombinant fusion proteins comprised of three gene 15 fragments, amplified products were cleaved with Ndel/BamHI (for Γ1 position fragment), or BamHI/Kpnl (for 2nd position fragment) or KpnI/Sall (for 3rd position fragment). The 1st position fragments were directionally cloned into the unique Ndel and BamHI sites of the T7-based expression vector pET-28 (Novagen). This vector provides an N-terminal poly (His) affinity tag fused to the expressed proteins 20 to aid in purification on nickel-Sepharose columns. Ligation reactions were transformed into E.coli GC5 competent cells and plasmids were purified using Eppendorf Perfectprep Plasmid 96 VAC Direct Bind Kit and verified by sequencing across the inserts. Plasmids containing fragment 1 now served as vectors for all subsequent cloning. For directional cloning of fragments two and three, vectors 25 were digested with BamHI/XhoIl, and restriction digested amplicons of fragment two and three were ligated simultaneously into the digested vector. Following transformation, plasmids were purified and sequenced.
Protein expression and purification. Purified plasmids were transformed into E.coli BL21/DE3 competent cell for expression. Chimeric Borrelia proteins 30 containing an N-terminal poly (His) affinity tag are expressed using the Overnight Express Autoinduction protocol. Induced cells are harvested by centrifugation and resuspended in 8M urea. Aliquots were run on SDS-PAGE. N-terminal poly His- PCT/US2015/054303 WO 2016/057562 -19- tagged proteins were purified on nickel-Sepharose columns under denaturing conditions using Ni-NTA Spin Kit (Qiagen). The kit is designed for rapid screening and purification of His Tag fusion proteins. Protein concentration was determined by the measurement of the absorbance shift when Coomassie brilliant blue G-250 5 reacted with protein (Bio-Rad). Protein purity was checked by SDS-PAGE.
Serum samples. The antigenicity of the chimeric proteins was tested using CDC sera samples C (12 samples) and E (11 samples), and Baltimore sera samples VI (28 samples) and V2 (23 samples), described above. In addition, 32 more sera samples were obtained from the CDC (CDC-R1). These included sera from 12 Lyme 10 patients. 12 patients with diseases associated with cross-reactivity in Lyme disease tests and 8 normal controls. Moreover, 35 sera from patients with diseases associated with serological responses that are known to produce crossreactivity in Lyme disease tests were obtained from Bioreclamation LLC, Westbury, NY. These included patients with syphilis, lupus, and rheumatoid arthritis. Seven normal 15 control sera were also obtained from healthy donors.
Microarray. For protein microarray, recombinant proteins and each of the individual 48 Borrelia antigens were printed onto nitrocellulose-coated FAST glass slides. In addition, recombinant proteins OspB-OspC-Flagellin (B-C-Fia), OspA-p39-p93 (A-39-93) and an OspC dimer comprised of OspC Type Band Type H 20 (OC2/9) from an early study were also printed (Gomes Solecki et. al., 2000). Each slide in the arrays also contained 10 immobilized BSA spots for background determination. Proteome chips were probed with serum from patients with untreated early Lyme disease and sick non-Lyme patients using the Fast Pak protein array kit. Briefly, slides were first blocked overnight at 4°C in protein array-blocking buffer 25 before incubation in primary antibody (human sera and mouse anti His-Tag for quantitation) for 2 h. Antibodies were visualized with Cy5-conjugated goat antihuman lgG or Cy5-conjugated goat anti-human lgM (to detect bound human antibodies) and Cy3-conjugated goat anti mouse lgG (to quantify the amount of recombinant protein in each spot). After a 2 hr incubation, the slides are' stringently 30 washed and then scanned with an Axon GenePix 4200A microarray scanner. The raw data was captured and analyzed with Gene Pix Pro image analysis software. To minimize the variability among samples, the PMT gain was adjusted to equall.O in PCT/US2015/054303 WO 2016/057562 -20- all the arrays with power setting at 50%. A global background subtraction method was used to subtract the background from each spot using the average mean intensity value of BSA from each slide (Xu et al., 2008).
Data analysis. For analysis of the data generated from the arrays with human 5 serum, the spot was considered positive and included for further ratio analysis if the median fluorescence intensity of a spot is more than 1000 and the SNR (signal-noise-ratio) of a spot is more than 4. A ratio Cy5 intensity/Cy3 intensity (protein/His-tag) for each protein was then calculated. All experiments were conducted two times, and each protein's Cy5/Cy3 ratios will be averaged. The 10 C5/C3 ratio of any chimeric protein greater than the mean ratio of the reactivity of the 17 sick non-Lyme patients to the protein plus three times the standard deviation indicated a significant interaction between antibodies in the Lyme sera and the immobilized protein.
Results. A serum panel composed of samples from patients with early Lyme 15 disease was used to screen arrays of chimeric proteins to determine their sensitivity to detect anti-5, burgdorferi antibodies. Although a considerable amount of heterogeneity in reactivity of individual serum samples to the arrayed proteins was observed, there was remarkable consistency in the reactivity of individual samples to the 6 combinations of each recombinant protein. In fact, among the 288 arrayed 20 proteins, the majority of them delectably elicited an antibody response in humans with natural infections using both secondary antibodies. Moreover, the chimeric constructs did not vary significantly in their immunoreactivities when compared to individual proteins. Although there were sample-specific responses, there was a subset of proteins recognized in common by a majority of the sera. Importantly, the 25 majority of sera recognized at least one antigen from a subset of 25 highly antigenic Borrelia recombinant proteins and chimeric proteins using lgM and lgG secondary antibody (Table 6 SEQ ID NOS: 3-27 of The Figure). Such antigens represent the best candidates for the development of diagnostic tests, and arrays of these 25 antigens were used in all subsequent sensitivity and specificity assessments. 30 Additionally, variants were made of chimeric antigen OC2/9 (SEQ ID NO: 27) and are shown as SEQ ID NOS: 28-30 of the Figure. These variants, as well as variants WO 2016/057562 PCT/US2015/054303 -21 -of the other chimeric antigens described herein, can be made and tested for efficacy using the procedures as described herein. WO 2016/057562 PCT/US2015/054303 -22-
Table 6. List of 25 Highly Antigenic Borrelia proteins
Protein ID gene locus gene name Chimeric Borrelia proteins SEQID NOS. 1S-1 BB_0312 purine-binding chemotaxis protein 3 1S-15 BB_N26 Borrelia orf-D family 4 1S-16 Bbu297_F33 VMP-like sequence protein VIsE (Vis) 5 1S-4 BB_A60 surface lipoprotein P27 6 IT-14 BbuN40_X36/BbuJDl_S13/BB_H18 7 IT-23 BB_ll6A/ospC /Bbu297_F33 8 IT-25 Bbu297_P39/BB_E19/BB_J47 9 IT-27 BB_E19/BB_J47/Bbu297_P39 10 IT-28 BB_E19/Bbu297_P39/BB_J47 11 IT-47* BB_0312/BB_N26/BB_A73 12 IT-48* BB_0312/BB_A73/BB_N26 13 IT-9* B B_E09/BB_H37/BB_C08 14 2S-15* BB_R22 conserved hypothetical protein 15 2S-16* BB_S42 BapA protein 16 2S-22* BbuJDl_F31 vmp-like sequence (Vis) protein 17 2S-7* BB_A16 outer surface protein B (OspB) 18 2T-16* BB_A66/BB_S42/BB_0364 19 2T-33* BB_J01/BB_A70/BB_R22 20 2T-4* BB_0067a/BB_A16/BB_0024 21 2T-5* BB_A16/BB_0024/BB_0067a 22 2T-8* BB_0337/BbuJDl_F31/Bbu297_F32 23 2T-9* Bbu297_F32/BB_0337/BbuJDl_F31 24 BCF* BB_A19/BB_B19/BB0147 25 BCVF* BB_A19/BB_B19/ Bbu297_F33/BB0147 26 OC2/9 BB_B19 B1/BB_B19K 27
The overall sensitivity and specificity of the Lyme assay for this set of sera specimens are shown below in Table 7. As can be readily seen from the table, 5 protein arrays containing 25 recombinant Borrelia proteins out performed 2 tier testing using the Lyme disease serum panel described above. For example, the sensitivity of the protein array described herein was compared with two-tier testing using 29 of the early Lyme disease patients. Among the 29 patients with EM, the sensitivity of the instant protein array with lgM or lgG secondary antibody was 10 100% at initial presentation (Samples VI) and 87% during convalescence, 3 weeks later (Samples V2). In comparison, the percentages were 48% and 71%, respectively, for standard 2-tiered testing. PCT/US2015/054303 WO 2016/057562 -23 - 5
Table 7. Sensitivity and specificity of protein arrays using lgM and lgG secondary antibodies.
No. Positive/Total (%) Protein Array Clinical 2 Tier IgM IgG IgM or IgG Diagnosis status VI = Diagnosed 14/29 28/28 24/27 28/28 early Lyme (48) (100) (89) (100) V2 = three week 20/28 19/23 18/23 20/23 follow-up (71) (83) (78) (87) C = Diagnosed 2/12 11/12 8/12 12/12 Sensitivity early Lyme (17) (92) (67) (100) E = 20 days post 7/12 12/12 8/11 11/11 visit (58) (100) (73) (100) CDCR1 8/12 9/12 11/12 11/12 samples (mix) (67) (75) (92) (92) No. Negative/Total (%) Sick non-Lyme 40/47 40/47 37/47 Specificity (47) (85) (85) (79) Normal (15) 13/15 12/15 10/15 (87) (80) (67) WO 2016/057562 PCT/US2015/054303 -24- EXAMPLE 3: Diagnostic Test for Lyme Disease.
Overview. Using genomic and proteomic approaches, protein microarrays were fabricated based on multiple genotypes of Borrelia burgdorferi sensu stricto to identify antigens that may be useful in the development of a highly sensitive and 5 specific single-tier assay that will have a wide range of specificity in detecting Lyme disease. Although the assay containing 25 recombinant Borrelia proteins described above is very accurate and sensitive, studies were designed to reduce the number of recombinant antigenic proteins to the least number while maintaining high sensitivity and specificity. 10 Serum samples. Sera from 70 Lyme disease patients were used to the sensitivity of protein arrays of the 25 recombinant proteins. This included 28 early Lyme patients from the CDC, Baltimore samples VI and V2 described above, and 8 Lyme arthritis, 6 neurologic Lyme and 2 cardiac Lyme patients also from the CDC. In addition, for specificity studies, sera were obtained from 83 patients (sick non-Lyme) with 15 diseases associated with serological responses that are known to produce crossreactivity in Lyme disease test including syphilis, fibromyalgia, and rheumatoid arthritis. Normal control sera were obtained from 16 healthy donors from an area of endemicity and 36 healthy donors from non-endemic areas.
Microarray. For protein microarray, the 25 recombinant proteins of Table 6 were 20 printed onto nitrocellulose-coated FAST glass slides. Proteome chips were probed with serum and analyzed as described above.
Results. A serum panel composed of 70 samples from patients with various stages of Lyme disease was used to screen arrays of chimeric proteins to determine their sensitivity to detect anti-5, burgdorferi antibodies. Although there were sample-25 specific responses, there was a subset of proteins recognized in common by a majority of the sera. Importantly, the majority of sera recognized 9 highly antigenic Borrelia chimeras using lgM secondary antibody and 7 chimeras using lgG secondary antibody for a total of 11 individual proteins (Table 8). 30 WO 2016/057562 PCT/US2015/054303 -25 -
Table 8. 11 Highly Antigenic Borrelia proteins. protein ID Borrelia Proteins SEQ ID NOS. 1S-16 Bbu297_F33 5 2S-16 BBS42 16 IT-9 BBE09/BBH37/BBC08 14 IT-27 BB_E 19/BB_K07/Bbu297_P39 10 IT-48 BB0312/BBA73/BBN26 13 2T-9 BBu297_F32/BB_0337/BbuJDl_F31 24 2T-16 BBA66/BBS42/BB 0364 19 2T-33 BBJ01/BBA70/BBR22 20 BCF BB A16/BB B19/BB O147 25 BCVF BBA16/BBB19/Bbu297_F33/BB0147 26 OC2/9 BB B19 Type B/Type H 27
These 11 recombinant and chimeric antigens’ Cy5/Cy3 ratios were among 5 the highest observed in the arrays and each had a specificity of > 99% using normal sera and sera from patients with other chronic infections or autoimmune diseases. The 11 antigens were printed on array slides and used for sensitivity and specificity analysis.
The overall sensitivity of our array of 11 proteins is shown in Table 9. For 10 early Lyme patients, the sensitivity of the protein array with lgM or lgG secondary antibody was 71% for sera from the CDC and for the Baltimore samples 88% at initial presentation (Samples VI) and 88% during convalescence, 3 weeks later (Samples V2). In comparison, the sensitivity was 44% for standard 2-tiered testing for these same early Lyme patients. The sensitivity of the array was 100% for Lyme 15 arthritis, neurologic Lyme and cardiac Lyme sera (Table 9). PCT/US2015/054303 WO 2016/057562 -26-
Table 9. Serologic Responses in Well-Characterized Lyme disease Patients: Sensitivity.
Overall Sensitivity number positive/total (%)· Sample Category Sample Group IgM IgG IgM or IgG Lyme disease (Total = 70) Early Lyme-CDC 57 46 71 Lyme arthritis 63 100 100 Neurologic Lyme 100 67 100 Cardiac Lyme 100 100 100 Baltimore-V 1 81 73 88 Baltimore-V2 88 73 88 Overall 71 66 84 5 The specificity of the 11 antigen array assay (Table 10) was evaluated by testing sera from normal controls and from patient with diseases associated with serological responses that are known to produce cross-reactivity (Sick-non-Lyme) in currently used tests. Among the 52 healthy controls from areas in which Lyme disease is endemic, none had positive results with the assay. For the potential cross 10 reactive patients 11 of 83 samples had positive lgM or lgG antibody responses in our assay. Thus, the overall specificity for the array assay was 100% for normal controls and 87% in Sick-non-Lyme patients. PCT/US2015/054303 WO 2016/057562 -27-
Table 10. Serologic Responses in Normal Controls and Potentially Cross Reactive Patients: Specificity.
Overall Sample Category Sample Group IgM IgG IgM or IgG EVB positive 100 100 100 Fibromyalgia 100 100 100 Influenza 100 100 100 Mononucleosis 88 100 88 Control: Multiple sclerosis 88 100 88 Sick non- Psoriasis 100 80 100 Specificity Lyme Rheumatoid arthritis 92 100 85 number (total=83) RF positive 80 100 100 negative/total SLE 100 100 100 (%)· Severe periodontitis 88 100 88 Syphilis 92 92 92 overall 93 98 93 Control: Healthy endemic 94 100 94 Healthy Healthy non-endemic 97 97 94 (total=52) Overall 96 98 94 overall 94 98 93 5 These data demonstrate that the microarray assays described herein offer superior sensitivity, specificity and precision in detecting antibodies against B. burgdorferi for not only early stages of the disease, but shows equivalent sensitivity for the late stages of the disease as well. As a result, a standardized sensitive and specific single-tier Lyme disease assay of recombinant chimeric Borrelia proteins 10 that will potentially have a wide range of coverage and specificity against Lyme disease is now available. Furthermore, these assays will have significant PCT/U S2015/054303 WO 2016/057562 -28- commercial potential for the development of a next-generation rapid, single-tier point of care assay.
The teachings of all patents, published applications and references cited herein are incorporated by reference in their entirety: 5
Casjens, S., Palmer, N., van Vugt, R., Huang, W.G., Stevenson, B., Rosa, P., et al., A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol., 2000; 35, 490-516. 10 Dunn, J.J., Lade, B.N., Barbour, A.G., Outer surface protein A (OspA) from the Lyme disease spirochete, Borrelia burgdorferi·, high level expression and purification of a soluble recombinant form of OspA Protein Expr. Purif. 1990; 1:159-68.
Gomes-Solecki, M.J.C., Dunn, J.J., Luft, B.J., et al., 2000.Recombinant chimeric 15 Borrelia proteins for diagnosis of Lyme disease. J. Clin. Microbial. 2000; 38:2530-2535.
Xu, Y., Bruno, J.F., Luft, B.J., Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays. Microb. Path. 2008; 45: 403-407.
Xu, Y., Bruno, J.F., Luft, B.J., Detection of Genetic Diversity in Linear Plasm ids 20 28-3 and 36 in Borrelia burgdorfesensu stricto isolates by Subtractive
Hybridization. Microb. Path. 2003; 35:269-78.
While this invention has been particularly shown and described with references to example embodiments thereof, it will be understood by those skilled in 25 the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims.
Claims (20)
- CLAIMS What is claimed is:1. A recombinant Borrelia fusion protein construct comprising at least three Borrelia recombinant protein antigens wherein the recombinant antigens are selected from Table 1.
- 2. The protein fusion construct of claim 1 wherein the molecular mass of the fusion protein construct is about 100 kDa or less.
- 3. The Borrelia fusion construct of claim 1 where is the recombinant antigens were amplified by PCR with primers comprising SEQ ID NO: 1 and SEQ ID NO:2.
- 4. A vector comprising the recombinant Borrelia fusion protein construct of claim 1.
- 5. A Borrelia recombinant fusion protein construct selected from the group of constructs of Table 5.
- 6. A microarray comprising one, or more, Borrelia chimeric protein antigens of Table 5.
- 7. The microarray of claim 6 further comprising one, or more, recombinant Borrelia protein antigens of Table 1.
- 8. The microarray of claim 7 further comprising one, or more, Borrelia recombinant protein antigens selected from the group consisting of OspB-OspC-Flagellin (B-C-Fla); OspA-p39-p93 (A-39-93) and OspC dimer consisting of OspC Type B and Type H (OC2/9).
- 9. A microarray comprising the recombinant Borrelia protein antigens and fusion protein antigens of Table 6.
- 10. A microarray comprising the recombinant Borrelia protein antigens and fusion protein antigens of Table 8.
- 11. A method of diagnosing Lyme disease comprising assessing a test sample obtained from a subject suspected of having Lyme disease for the presence of antibodies to Borrelia burgdoferi proteins in the sample, the method comprising contacting the sample with a microarray comprising one, or more of the Borrelia fusion protein antigens of Tables 5, 6 or 8 and detecting the presence of antibodies in the sample reactive to the Borrelia fusion protein antigens, wherein detecting the presence of antibodies to one, or more, Borrelia chimeric antigens indicates the presence of Lyme disease in the subject.
- 12. The method of claim 11 wherein the microarray consists of all of the recombinant antigens and fusion protein antigens of Table 6.
- 13. The method of claim 11 wherein the microarray consists of all of the recombinant antigens and fusion protein antigens of Table 8.
- 14. A method of diagnosing Lyme disease in a subject comprising assessing a test sample obtained from a subject suspected of having Lyme disease for the presence of antibodies to Borrelia burgdoferi proteins in the sample, the method comprising contacting the sample with a microarray comprising the recombinant Borrelia protein antigens of Table 6 and detecting the presence of antibodies in the sample reactive to the recombinant Borrelia antigens, wherein detecting the presence of antibodies to one, or more, recombinant Borrelia antigens indicates the presence of Lyme disease in the subject.
- 15. A method of diagnosing Lyme disease in a subject comprising assessing a test sample obtained from a subject suspected of having Lyme disease for the presence of antibodies to Borrelia burgdoferi proteins in the sample, the method comprising contacting the sample with a microarray comprising the recombinant Borrelia protein antigens of Table 8 and detecting the presence of antibodies in the sample reactive to the recombinant Borrelia antigens, wherein detecting the presence of antibodies to one, or more, recombinant Borrelia antigens indicates the presence of Lyme disease in the subject.
- 16. A method for detecting antibodies to Borrelia burgdoferi in a test sample comprising contacting the sample with a microarray of one, or more, recombinant Borrelia fusion protein antigens of Table 5, under conditions sufficient for the antibodies in the sample to react with the fusion protein antigens and detecting the antibody-antibody reaction.
- 17. The method of claim 16 wherein the microarray comprises the recombinant antigens and fusion protein antigens of Table 6.
- 18. The method of claim 16 wherein the microarray comprises the recombinant antigens and fusion protein antigens of Table 8.
- 19. A method for detecting antibodies to Borrelia burgdoferi in a test sample comprising contacting the sample with a microarray consisting of the recombinant Borrelia antigens and fusion protein antigens of Table 6, under conditions sufficient for the antibodies in the sample to react with the antigens and detecting the antigen-antibody reaction.
- 20. A method for detecting antibodies to Borrelia burgdoferi in a test sample comprising contacting the sample with a microarray consisting of the recombinant Borrelia protein antigens and fusion protein antigens of Table 8, under conditions sufficient for the antibodies in the sample to react with the antigens and detecting the antigen-antibody reaction.
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201462060867P | 2014-10-07 | 2014-10-07 | |
US62/060,867 | 2014-10-07 | ||
US201462076059P | 2014-11-06 | 2014-11-06 | |
US62/076,059 | 2014-11-06 | ||
PCT/US2015/054303 WO2016057562A1 (en) | 2014-10-07 | 2015-10-06 | Recombinant borrelia proteins and methods of use thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
AU2015328255A1 true AU2015328255A1 (en) | 2017-04-27 |
Family
ID=54337437
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU2015328255A Abandoned AU2015328255A1 (en) | 2014-10-07 | 2015-10-06 | Recombinant Borrelia proteins and methods of use thereof |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP3213076A1 (en) |
JP (1) | JP2017531657A (en) |
AU (1) | AU2015328255A1 (en) |
CA (1) | CA2963643A1 (en) |
HK (1) | HK1244534A1 (en) |
WO (1) | WO2016057562A1 (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP3359558B1 (en) | 2015-10-06 | 2023-12-13 | Bio-Rad Laboratories, Inc. | Borrelia immunoassays and materials therefor |
WO2018017998A1 (en) | 2016-07-22 | 2018-01-25 | The Research Foundation For The State University Of New York | Recombinant borrelia proteins and methods of use thereof |
US10718767B2 (en) | 2018-03-09 | 2020-07-21 | Id-Fish Technology, Inc. | Species specific antigen sequences for tick-borne relapsing fever (TBRF) and methods of use |
CN113302493A (en) * | 2018-10-01 | 2021-08-24 | 小利兰·斯坦福大学托管委员会 | High specificity and sensitivity immunoadsorption diagnostic assay for simultaneous resolution of multiple antibody isotypes |
Family Cites Families (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PT726955E (en) * | 1993-11-01 | 2004-08-31 | Brookhaven Science Ass Llc | QUIMERIC PROTEINS UNDERSTANDING POLIPEPTIDOS BORRELIA: ITS UTILIZATIONS |
US7008625B2 (en) | 1993-11-01 | 2006-03-07 | Research Foundation Of The State University Of New York | Recombinant constructs of Borrelia burgdorferi |
US6248562B1 (en) | 1993-11-01 | 2001-06-19 | Research Foundation State University Of New York | Chimeric proteins comprising borrelia polypeptides and uses therefor |
US6251405B1 (en) | 1995-06-07 | 2001-06-26 | Connaught Laboratories, Inc. | Immunological combination compositions and methods |
PT1194559E (en) | 1999-06-18 | 2007-01-31 | Brook Biotechnologies Inc | Groups of borrelia burgdorferi that cause lyme disease in humans |
ATE380870T1 (en) * | 2000-08-18 | 2007-12-15 | Univ New York State Res Found | BORRELIA BURGDORFERI RECOMBINANT GENE CONSTRUCTS |
-
2015
- 2015-10-06 EP EP15782207.3A patent/EP3213076A1/en not_active Withdrawn
- 2015-10-06 JP JP2017518430A patent/JP2017531657A/en active Pending
- 2015-10-06 CA CA2963643A patent/CA2963643A1/en not_active Abandoned
- 2015-10-06 AU AU2015328255A patent/AU2015328255A1/en not_active Abandoned
- 2015-10-06 WO PCT/US2015/054303 patent/WO2016057562A1/en active Application Filing
-
2018
- 2018-03-06 HK HK18103163.5A patent/HK1244534A1/en unknown
Also Published As
Publication number | Publication date |
---|---|
EP3213076A1 (en) | 2017-09-06 |
HK1244534A1 (en) | 2018-08-10 |
WO2016057562A1 (en) | 2016-04-14 |
JP2017531657A (en) | 2017-10-26 |
CA2963643A1 (en) | 2016-04-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Metts et al. | Analysis of the OspE determinants involved in binding of factor H and OspE-targeting antibodies elicited during Borrelia burgdorferi infection in mice | |
Xiong et al. | Potential serodiagnostic markers for Q fever identified in Coxiella burnetii by immunoproteomic and protein microarray approaches | |
US10266571B2 (en) | Lyme disease vaccine | |
US20100292096A1 (en) | Strain and species-specific borrelia protein array | |
AU2015328255A1 (en) | Recombinant Borrelia proteins and methods of use thereof | |
Luo et al. | Protein typing of major outer membrane lipoproteins from Chinese pathogenic Leptospira spp. and characterization of their immunogenicity | |
Tian et al. | Characterization of the main immunogenic proteins in Brucella infection for their application in diagnosis of brucellosis | |
Xu et al. | Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays | |
Kanagavel et al. | B-cell-specific peptides of Leptospira interrogans LigA for diagnosis of patients with acute leptospirosis | |
KR20160097325A (en) | Diagnostic reagents for improved in vivo or in vitro cell-mediated immunological diagnosis of tuberculosis | |
RU2514230C1 (en) | Recombinant chimeric polypeptides, carrying epitopes of various immunodominant proteins of spirochaeta of borrelia burgdorferi sensu lato complex, and serum diagnostic technique for ixodic tick-borne borreliosis | |
US20170212114A1 (en) | Recombinant Borrelia Proteins And Methods Of Use Thereof | |
HEIKKILÄ et al. | Cloning of the gene encoding the decorin-binding protein B (DbpB) in Borrelia burgdorferi sensu lato and characterisation of the antibody responses to DbpB in Lyme borreliosis | |
WO2018017998A1 (en) | Recombinant borrelia proteins and methods of use thereof | |
FI112544B (en) | Procedure for the diagnosis of early and late Lyme Borreliosis | |
US8431135B2 (en) | Polypeptides and methods for the specific detection of antibodies in patients with a borrelia infection | |
EP2931306A1 (en) | Methods and compositions of protein antigens for the diagnosis and treatment of leptospirosis | |
US8283439B2 (en) | Recombinant fragments and synthetic peptides of 17-kDa polypeptide useful in detecting Bartonella henselae | |
CN114814211A (en) | ELISA kit for detecting PCV3 | |
Ranka et al. | Analysis of Seroreactivity to Recombinant B. burgdorferi Antigens BBA65 and BBA73 | |
Lesseva et al. | CLONINg AND ExpRESSION OF RECOMBINANT FLAgELLAR pROTEIN FlaB FROM BorrELIa BurgDorFErI |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
MK5 | Application lapsed section 142(2)(e) - patent request and compl. specification not accepted |