CN101619313B - Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof - Google Patents
Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof Download PDFInfo
- Publication number
- CN101619313B CN101619313B CN200910090227A CN200910090227A CN101619313B CN 101619313 B CN101619313 B CN 101619313B CN 200910090227 A CN200910090227 A CN 200910090227A CN 200910090227 A CN200910090227 A CN 200910090227A CN 101619313 B CN101619313 B CN 101619313B
- Authority
- CN
- China
- Prior art keywords
- mycobacterium tuberculosis
- tuberculosis
- ag85b
- dna
- aptamer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, a preparation method and application thereof. The oligonucleotides aptamer has nucleotide sequences shown as AP-1 to AP-13. The preparation method of the oligonucleotides aptamer comprises steps as follows: (1) constructing a random single-stranded DNA (ssDNA) library and preparing a primer; (2) preparing the random single-stranded DNA (ssDNA) library by PCR amplification; (3) carrying out SELEX screening; (4) detecting the appetency; (5) cloning and sequencing DNA. The oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B is applied to detect the antigen level of the mycobacterium tuberculosis Ag85B in human serum, can replace antibodies, improves the sensitivity and the specificity of the tuberculosis antigen detection in specimens of body fluid (such as serum, hydrothorax, cerebrospinal fluid ascites and the like), thereby improving the accuracy rate of tuberculosis diagnosis.
Description
Technical field
The present invention relates to the targeted mycobacterium tuberculosis Ag 85 B oligonucleotide aptamer, belong to white plaque Medical Immunology and detection technique field.
Background technology
White plaque epidemic situation of China and resistance situation are all quite serious, and the tuberculosis patient numerical digit occupies the second in the world, is only second to India.Existing pulmonary tuberculosis patient 4,510,000, wherein the infectivity pulmonary tuberculosis patient 1,960,000, annual newly-increased tuberculosis case 1,400,000, annual death toll is about 130,000, in transmissible disease, occupies first.In the conventional clinically at present diagnostic method of using, the sensitivity that the clinical samples smear detects is low, and positive rate has only 20-30%; Traditional Luo Shi cultured positive rate is low, has only about 30%, and needs the 4-8 time-of-week.Tuberculosis serological diagnosis mainly is tuberculosis antibody and detection of antigens, and the tuberculosis antibody test is a kind of auxiliary diagnosis means; Although the history in existing more than 20 year of applied immunology technology for detection tuberculosis antigen; In detection technique and research thinking bigger progress is arranged all, but the detection sensitivity of tuberculosis antigen is still lower in the humoral specimen, mainly has following problem: 1. lack high specific antibody of tiring; Though have application specific tuberculosis antigen immune animal at present abroad in recent years; And be purified into the research report of efficient antibody, but all belong to the small sample quantity research basically, lack the clinical assessment of big specimen amount; 2. lack comprehensive, deep understanding for the antigen of mycobacterium tuberculosis characteristic and with the relation of the progress of disease, tuberculosis antigen is detected hit specific antigens to select to exist certain limitation; 3. the antigen of mycobacterium tuberculosis amount is lower in the serum; Be lower on the one hand by the intravital specificity tuberculosis of mycobacterium tuberculosis entering tuberculosis patient CAg amount; Be that tuberculosis antigen combines to form CIC ELISA (CIC) in vivo with corresponding antibody on the other hand, make that the susceptibility of Detection of antigen is restricted in the serum.Among the 4510000 active tuberculosis patients of the whole nation, bacterium sun pulmonary tuberculosis patient recall rate is low at present, and the cloudy pulmonary tuberculosis patient of bacterium accounts for 55.6%, and rate of missed diagnosis is high, delay diagnosis.In addition, the outer tuberculosis of lung, the diagnosis of children's's tuberculosis are also very difficult.Therefore, from different humoral specimens, detect the special antigen of white plaque, foundation is quick, responsive, diagnosis of tuberculosis, differential diagnosis method are extremely important for the control of white plaque epidemic situation efficiently.
SELEX (systematic evolution of ligands by exponential enrichment) technology is the phyletic evolution technology of exponential enrichment part; Being a kind of novel combination chemical technology that nineteen ninety Tuerk and Gold set up, is research small molecules the nucleic acid position, sequence and the space conformation that combine with the target material and the effective ways of function.Its ultimate principle is single stranded oligonucleotide library of external chemosynthesis (RNA or ssDNA library); Its two ends are fixed sequence program, and the centre contains the stochastic sequence of 20～40 oligonucleotide, utilize jumbo random oligonucleotide storehouse and target molecule to interact; Therefrom be separated to oligonucleotide with the target molecule specific combination; And combine the amplification in vitro technology, and make it obtain exponential enrichment, so pass through multi-turns screen; Finally obtain oligonucleotide high with target material avidity, high specificity, be referred to as " adaptive son (aptamer) ".In the adaptive sub-molecule except that G-C, A-U base pairing; Also has the existence of the even base pairs of change such as G-U; Can form hair clip (hairpin), false knot (pseudoknot), bulge loop (bulge), G-tetrad multiple space structures such as (G-quartet), can form the rigid structure with quite stable, they interact with target molecule through hydrogen bond, Van der Waals force etc.; Or chimeric or encapsulate, form stabilized complex.The SELEX technology has advantages such as storage capacity is big, target molecule is extensive, avidity is high, high specificity; Almost any one target molecule can utilize the SELEX technology screening to go out the oligonucleotide aptamer that is complementary with it in theory; Like metals ion, organic dye, amino acid, cytokine, cofactor, aminoglycoside, microbiotic, base analogue, Nucleotide and polypeptide etc.; Wherein the protein target molecule is maximum; Complete virion and bacterial pathogens, even complete cell also can go out the oligonucleotide aptamer of high-affinity through the SELEX technology screening.Oligonucleotide aptamer and target molecule have high avidity and specificity; Bonded dissociation constant (Kd) can reach nM; Even pM level; Compare with antibody, have molecular weight little, can infiltrate cell quickly, in blood, remove more rapidly, can stablize synthetic, be convenient to characteristics such as modification, can be applicable to aspects such as clinical diagnosis, disease treatment and fundamental research.
Mycobacterium tuberculosis is invaded the mechanism of causing a disease behind the human body and the pathological change that causes all is the basis with the interaction between protein expression and protein, and the host mainly accomplishes its defence to pathogenic agent through immunoreation and inflammatory reaction.Therefore, tubercle bacillus affection or white plaque can and appear in the blood circulation through following approach generation related protein: (1) mycobacterium tuberculosis produces secretory protein in the focus environment; (2) disintegration of tubercule bacillus thalline produces tropina under the immunity of organisms effect; (3) bacterium stimulates body to produce relevant proteins C reactive (comprising antibody); (4) spill albumen at bacteriological action lower body cell disruption release tissue albumen, tissue.The detection of tuberculosis antigen can be used as the direct evidence that mycobacterium tuberculosis exists, and can avoid tuberculosis patient because " false negative " that the humoral immunization that the immunne response level lowly causes detects or cellular immunization detects.Therefore, can find that in tuberculosis patient serum the white plaque GAP-associated protein GAP is as the diagnosis and treatment mark.At present aspect the adaptive sub-research of tuberculosis, it is thus clear that utilize SELEX scientific discovery cAMP receptor protein (CRP
Mt) with the report of genomic dna binding site and the effect in gene expression regulation thereof; Also use the SELEX technology screening and gone out the adaptive son of mycobacterium tuberculosis H37Rv DNA (number of patent application 200610019671.8) that can suppress m tuberculosis infection, and the adaptive son of secreted antigens c FP10, ESAT-6 and MPT64.And use oligonucleotide aptamer detection antigen is a kind of novel detection technique; Demonstrated its unique advantages in multiple diagnostic mode separately or with the antibody Combination application; Particularly can remedy the deficiency that antibody is used in diagnostic field, oligonucleotide aptamer possibly be more suitable for being used for the analog that monoclonal antibody is difficult to distinguish or the differential diagnosis of cross-reacting antigen.But do not see domestic and international report up to now as yet about adaptive son of mycobacterium tuberculosis secretory property antigen A g85B and application oligonucleotide aptamer detection tuberculosis antigen.
Ag85B albumen is mycobacterium tuberculosis secretory protein matter; Has good antigenicity; No matter be Ag85B antigen or its antibody; Their levels in tubercular's circulation of blood all will be apparently higher than normal healthy controls group (comprising BCG vaccination person), and the Ag85B protein level among the active tuberculosis patients serum is higher 50～150 times than other mycobacterium disease patient and normal healthy controls group.Detect the Ag85B antigen levels and can distinguish the white plaque of active period and the immunization or the previous infection of BCG-CWS, also can white plaque and non-tuberculous mycobacteria lesion not come.Therefore; Through screening and the proteic oligonucleotide aptamer of acquisition targeted mycobacterium tuberculosis Ag 85 B; Be applied to detect mycobacterium tuberculosis Ag 85 B antigen levels in the human serum, can improve sensitivity and specificity that tuberculosis antigen detects, thereby improve the accuracy rate of diagnosis of tuberculosis.
Summary of the invention
One of the object of the invention is in order to overcome the deficiency of prior art, the oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B to be provided.
Above-mentioned purpose of the present invention reaches through following technical scheme:
A kind of oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B is characterized in that: the nucleotide sequence of said oligonucleotide aptamer (seeing the sequence 1-13 in the sequence table) as shown in the table.
| The oligonucleotide aptamer title | The nucleotide sequence of adaptive son |
| AP-1 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCT CAAAAGTGCACGCTACTTTGCTAA |
| AP-2 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCG CAAAAGTGCACGCTACTTTGCTAA |
| AP-3 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCC CAAAAGTGCACGCTACTTTGCTAA |
| AP-4 | GCAATGGTACGGTACTTCCTTTTTTTTTGTGTTGTCGTGATATTGTAACCTGT CAAAAGTGCACGCTACTTTGCTAA |
| AP-5 | GCAATGGTACGGTACTTCCTTAACTTTTTTTGATGTTTATGTCGGTTTGCTATG CAAAAGTGCACGCTACTTTGCTAA |
| AP-6 | GCAATGGTACGGTACTTCCTTTTCTGTCTAGTTGTATTTACTCTTGGTATTATG CAAAAGTGCACGCTACTTTGCTAA |
| AP-7 | GCAATGGTACGGTACTTCCTTTTGGAAATTCTTTTTGTACTAGAATAATACCAC CAAAAGTGCACGCTACTTTGCTAA |
| AP-8 | GCAATGGTACGGTACTTCCTTTTTATATCAGTCTTAATATTGTGTTCTGTTGAC CAAAAGTGCACGCTACTTTGCTAA |
| AP-9 | GCAATGGTACGGTACTTCCTTTTTCCTGTAATATTCGTCTTTTGATGTTGTCTA CAAAAGTGCACGCTACTTTGCTAA |
| AP-10 | GCAATGGTACGGTACTTCCTATCTTCATCGGCAGGATGCCTATGCGCAGGTTTG CAAAAGTGCACGCTACTTTGCTAA |
| AP-11 | GCAATGGTACGGTACTTCCATTGGCGTTTGTTAGGACTGATGTTCGAGAAACCG CAAAAGTGCACGCTACTTTGCTAA |
| AP-12 | GCAATGGTACGGTACTTCCGGTTATTCTGTATTGTTGAATTGTTCTAGTGGTTT CAAAAGTGCACGCTACTTTGCTAA |
| AP-13 | GCAATGGTACGGTACTTCCGTTATTCAATTAAGTCGGGTTTATTGTGTGCGTTG CAAAAGTGCACGCTACTTTGCTAA |
Another object of the present invention provides a kind of preparation method of oligonucleotide aptamer of above-mentioned targeted mycobacterium tuberculosis Ag 85 B.
Above-mentioned purpose of the present invention reaches through following technical scheme:
A kind of preparation method of oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B, its step is following:
(1) structure and the primer in random single chain DNA (ssDNA) library;
(2) pcr amplification prepares ssDNA library at random;
(3) SELEX screening;
(4) avidity is measured:
(5) dna clone and order-checking;
(6) the synthetic and evaluation of adaptive son.
A purpose more of the present invention provides the application of oligonucleotide aptamer aspect preparation mycobacterium tuberculosis detection reagent of above-mentioned targeted mycobacterium tuberculosis Ag 85 B.
A kind of optimal technical scheme is characterized in that: said application comprises the following steps:
(1) is that capture antibody encapsulates microwell plate with 1ng/ml rabbit Killing Mycobacterium Tuberculosis Ag85B polyclonal antibody IgG, puts 4 ℃ and spend the night; Inferior daily PBST washes plate 3 times, each 3 minutes;
(2) BSA sealing: every hole adds PBST-1%BSA 200 μ l, hatches 1 hour to 37 ℃, washes plate 3 times with PBST, each 3 minutes;
(3) add undiluted humoral specimen to be measured, hatch 40min-1h for 37 ℃; With SELEX washings washing 3-5 time;
(4) add the adaptive son of 1.25 μ g, 5 ' the biotinylated report of end, hatch 40min-1h for 37 ℃; With SELEX washings washing 3-5 time;
(5) the marked by streptavidin horseradish peroxidase of adding 200 μ l dilution in 1: 1000 is hatched 30min for 37 ℃; With SELEX washings washing 3-5 time;
(6) add O-Phenylene Diamine (O-Phenylenediamine, OPD), colour developing 15min;
(7), measure the absorbancy of wavelength 492nm through ELIASA with 2mol/L vitriol oil termination reaction.
Beneficial effect
The present invention is through screening and obtain the proteic oligonucleotide aptamer AP-1 of targeted mycobacterium tuberculosis Ag 85 B, AP-2, AP-3, AP-4, AP-5, AP-6, AP-7, AP-8, AP-9, AP-10, AP-11, AP-12, AP-13; Be applied to detect mycobacterium tuberculosis Ag 85 B antigen levels in the human serum; Can replace antibody; Improve tuberculosis antigen detects in the humoral specimen (comprising serum, hydrothorax, cerebrospinal fluid, ascites etc.) sensitivity and specificity, thereby improve the accuracy rate of diagnosis of tuberculosis.
A kind of method for preparing the adaptive son of high-affinity DNA of targeted mycobacterium tuberculosis specific antigens that the present invention sets up can prepare the adaptive son of multiple target molecule, is used for diagnosis lungy and treatment.
But the adaptive sub-ELONA method sxemiquantitative of the AP-1 that sets up ground detects the antigen levels in the tuberculosis patient humoral specimen (comprising serum, hydrothorax, cerebrospinal fluid, ascites etc.), only needs time half a day, can be used for quick diagnosis lungy.
The sensitivity that the inventor studies the adaptive sub-ELONA method detection tuberculosis patient serum of proof application AP-1 is 30.1%; Wherein the cloudy patient's of bacterium sensitivity is 12%; And the sensitivity that bacterium sun patient detects is 57.6%, and specificity is 98.1%, positive predictive value 89.3%; Negative predictive value 72.9%, total accuracy rate is 74.8%.False positive does not appear in PPD skin test male tuberculosis infected students and BCG vaccination person.Use the adaptive sub-ELONA method of AP-1 and also can from tuberculosis property hydrothorax, cerebrospinal fluid, ascites, detect antigen of mycobacterium tuberculosis, its positive rate is respectively 18.2%, 3.6%, 33.3%.
The oligonucleotide aptamer of key reagents of the present invention-----targeted mycobacterium tuberculosis Ag 85 B can synthesize or the pcr amplification preparation on a large scale, and cost is relatively low.
Through embodiment the present invention is further specified below, but and do not mean that restriction protection domain of the present invention.
Embodiment
Embodiment 1
A kind of preparation method of oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B, its step is following:
(1) structure and the primer in random single chain DNA (ssDNA) library: the structure and the primer in random single chain DNA (ssDNA) library: random single chain DNA (ssDNA) library: 5 '-GCAATGGTACGGTACTTCC (N35) CAAAAGTGCACGCTACTTTGCTAA-3 '; Upstream primer: 5 '-GCAATGGTACGGTACTTCC-3 '; Downstream primer: 5 '-GCTAAGCGGGTGGGACTTCCTAGTCCCACCCGCTTAGCAAAGTAGCGTGCACTT TTG-3 '; Biotin labeled upstream primer: 5 '-biotin-GCAATGGTACGGTACTTCC-3 '; Said random single chain DNA (ssDNA) library and primer are synthetic through primer company;
(2) pcr amplification in random single chain DNA (ssDNA) library preparation:
The ssDNA amplified library is become the dsDNA library, preserves, and be the ssDNA library that template amplification goes out the next round screening with the dsDNA library:
First round amplification condition: random single-stranded DNA banks 0.25 μ g, biotin labeled upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids of 10 μ l and 2 activity units of archaeal dna polymerase, it is 100 μ l that the adding distilled water makes TV; Put into the pcr amplification appearance then, response procedures is set at: 95 ℃, and 1min, 94 ℃, 30sec, 37 ℃, 1min, 58 ℃, 40sec, 27 circulations, last 58 ℃ are extended 2min, get pcr amplification product;
Second and third takes turns amplification condition: get the last round of screening product of 10 μ l as template; Upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃, and 1min; 94 ℃, 30sec; 37 ℃, 1min; 58 ℃, 40sec; 3 circulations of increasing; Getting 3 round-robin amplified productions is template; Biotin labeled upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃ of 1min, and 94 ℃ of 30sec, 37 ℃ of 1min, 58 ℃ of 40sec, second takes turns amplification carries out 24 circulations, and 27 circulations are carried out in the third round amplification, and last 58 ℃ are extended 2min;
Four-wheel amplification condition: get the last round of screening product of 10 μ l as template; Upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃ of 1min, 94 ℃ of 30sec, 37 ℃ of 30sec, 60 ℃ of 40sec, 3 circulations of increasing; Getting 3 round-robin amplified productions is template; Biotin labeled upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃ of 1min, and 94 ℃ of 30sec, 37 ℃ of 30sec, 60 ℃ of 40sec, 30 circulations, last 60 ℃ are extended 2min;
The the 5th to eight takes turns amplification condition: get the last round of screening product of 10 μ l as template; Upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃ of 1min, 94 ℃ of 30sec, 55 ℃ of 30sec, 60 ℃ of 40sec, 3 circulations of increasing; Getting 3 round-robin amplified productions is template; Biotin labeled upstream primer 37.5pmol, downstream primer 37.5pmol, 0.2mmol/L dNTP, 10 times of dna polymerase reaction damping fluids and 2 activity units of archaeal dna polymerase, adding distilled water, to make TV be 100 μ l; Put into the pcr amplification appearance then, response procedures is: 95 ℃ of 1min, 94 ℃ of 30sec, 55 ℃ of 30sec; 60 ℃ of 40sec, the 5th takes turns 24 circulations of amplification, and the 6th takes turns 30 circulations of amplification; The 7th takes turns 27 circulations of amplification, and the 8th takes turns 24 circulations of amplification, and last 60 ℃ are extended 2min;
(3) SELEX screening:
A.PCR amplified production purifying and recovering: each pcr amplification product of taking turns in the step (2) is carried out electrophoresis with 7M urea 8% sex change PAGE; After putting in the 0.5 μ g/ml ethidium bromide solution dyeing, place it on the long-wave ultra violet lamp of completing preservative film, open uv lamp; Under the shield cap protection; Cut the pcr amplification product that is the orange band with sharp knife blade and downcut,, move in the 1.5ml centrifuge tube the adhesive tape chopping; The gel elution buffer of 3 times of volumes of adding (0.5M NH4Ac, 0.2%SDS, 1mM EDTA, pH 8.0), shake wash-outs more than 7 hours in 37 ℃; Elutriant is drawn onto in the new 1.5ml centrifuge tube, not with the gel sucking-off; Repeat wash-out once; The absolute ethyl alcohol that in elutriant, adds 2.5 times of volumes, the 3M NaAc of 1/10 volume, pH5.2 places 3hr for-70 ℃; 4 ℃ of held, 14, centrifugal 30min under the 000rpm; Abandon supernatant, deposition is washed once with 70% ethanol of 4 ℃ of precoolings, 4 ℃ of held, and 14, centrifugal 30min under the 000rpm; Abandon supernatant, be deposited in drying at room temperature; The DNA that drying is good be dissolved in an amount of SHMCK damping fluid (SELEX binding buffer liquid: 20mmol/L HepespH 7.35,120mmol/L NaCl, 5mmol/L KCl, 1mmol/L CaCl2,1mmol/L MgCl2,1%BSA) in; Each ssDNA that takes turns acquisition is stored in 4 ℃ of preservations;
B. microwell plate is the SELEX screening process of medium: (0.05mol/L NaHCO3 pH9.6) dilutes Ag85B albumen, encapsulates then in 96 hole enzyme linked plate holes, 4 ℃ of held, spends the night, and establishes blank hole (only adding coating buffer) simultaneously with encapsulating damping fluid; Discard coating buffer, wash plate 3 times with the PBS-T washings, 1min/ time; Ag85B albumen encapsulates the hole and the blank hole is all sealed with 3%BSA-PBS solution 100 μ l, hatches 2h for 37 ℃; Discard confining liquid, add each ssDNA that takes turns acquisition and SELEX binding buffer liquid (SHMCK damping fluid) totally 200 μ l encapsulate the hole to Ag85B albumen, combine 40min with Ag85B albumen in 37 ℃; Abandon binding buffer liquid, wash 6 times, wash 1min at every turn with SELEX washings (SELEX binding buffer liquid adds 0.05% polysorbas20); Abandon washings, add the SELEX elutriant in 80 ℃ of effect 10min (third round and later screening effect 15min), the following and protein bound ssDNA of Ag85B of wash-out; SsDNA under the wash-out is collected in the 1.5ml centrifuge tube; Repeat wash-out 1 time; Through isopyknic phenol: behind chloroform extracting, absolute ethyl alcohol and 70% ethanol sedimentation, ssDNA is dissolved in the 20 μ l TE damping fluids, as the ssDNA template of next round screening; So repeatedly, carry out the 9-14 wheel again;
(4) avidity is measured: the test of application enzyme couplet oligonucleotide (Enzyme-linked oligonucleotideassay, ELONA) method is measured the avidity of adaptive son:
A. with encapsulating damping fluid Ag85B albumen is diluted to the 112pmol/ hole, adds enzyme plate, seal rearmounted 4 ℃ and encapsulate and spend the night; Inferior daily PBST washes plate 3 times, each 3 minutes;
B.BSA sealing: every hole adds PBST-1%BSA 200 μ l, hatches 1 hour to 37 ℃, washes plate 3 times with PBST, each 3 minutes;
C. taken turns the pcr amplification product of screening the first round to the eight,, use the ethanol sedimentation purifying, measure dna content with phenol, chloroform extracting;
D. by every hole 250pmol ssDNA and 112pmol Ag85 albumen encapsulate the hole in 200 μ l SELEX binding buffer liquid 37 ℃ hatch 40min, with SELEX washings washing 6 times;
E. the marked by streptavidin horseradish peroxidase that adds 200 μ l dilution in 1: 1000 is hatched 30min for 37 ℃;
F.PBST washing 6 times, add then O-Phenylene Diamine (O-Phenylenediamine, OPD);
G.37 ℃ colour developing 15min; With 2mol/L vitriol oil termination reaction, measure the absorbancy of wavelength 492nm with ELIASA;
H. to take turns the absorbancy OD value of adaptive son of screening following successively the first round to the eight: 0,0,0.347,0.440,2.964,3.175,3.178,3.23, and showing the 8th, to take turns the avidity of adaptive word bank and mycobacterium tuberculosis Ag 85 B maximum;
(5) clone of adaptive son and order-checking:
Warp the 8th is taken turns the ssDNA that screening obtains, and becomes dsDNA with upstream primer with the downstream primer pcr amplification, and the PAGE glue purification reclaims product, carries out dna clone and order-checking; Clone's transformant is accredited as the male clone through PCR, and picking 100 clones cultivate, preserve, and therefrom 57 clones' of picking single growth bacterium colony carries out dna sequencing at random; The region sequence at random that obtains is following:
| Clone's sequence number No. | Region sequence 5 ' → 3 ' at random of PCR product cloning |
| 1 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 2 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 3 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 4 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 5 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 6 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 7 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 8 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 9 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 10 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 11 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 12 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 13 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 14 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 15 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 16 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 17 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 18 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 19 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 20 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 21 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 22 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 23 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 24 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 25 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 26 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 27 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 28 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 29 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 30 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 31 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 32 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 33 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 34 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 35 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 36 | AACCTCAGGTGATCTGCCTGCCTCGGCCT |
| 37 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 38 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 39 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 40 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 41 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 42 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 43 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 44 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 45 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 46 | AACCTCAGGTGATCTGCCTGCCTCGGCCG |
| 47 | AACCTCAGGTGATCTGCCTGCCTCGGCCC |
| 48 | TTTTTTTTTGTGTTGTCGTGATATTGTAACCTGT |
| 49 | TTAACTTTTTTTGATGTTTATGTCGGTTTGCTATG |
| 50 | TTTTCTGTCTAGTTGTATTTACTCTTGGTATTATG |
| 51 | TTTTGGAAATTCTTTTTGTACTAGAATAATACCAC |
| 52 | TTTTTATATCAGTCTTAATATTGTGTTCTGTTGAC |
| 53 | TTTTTCCTGTAATATTCGTCTTTTGATGTTGTCTA |
| 54 | TATCTTCATCGGCAGGATGCCTATGCGCAGGTTTG |
| 55 | ATTGGCGTTTGTTAGGACTGATGTTCGAGAAACCG |
| 56 | GGTTATTCTGTATTGTTGAATTGTTCTAGTGGTTT |
| 57 | GTTATTCAATTAAGTCGGGTTTATTGTGTGCGTTG |
(6) synthetic, the evaluation of adaptive son:
Synthesizing of the adaptive son of A.Ag85B: homology information and the secondary structure of taking all factors into consideration each bar sequence; No.1, No.37, No.47, No.48, No.49, No.50, No.51, No.52, No.53, No.54, No.55, No.56, the adaptive son clone's of No.57 dna sequence dna difference called after: AP-1, AP-2, AP-3, AP-4, AP-5, AP-6, AP-7, AP-8, AP-9, AP-10, AP-11, AP-12, AP-13 have been chosen, by synthetic these 13 the adaptive sons of ordinary method;
B. adaptive sub-avidity is measured: the primer amplification synthetic library Gp35, the 8th of applicating biotin mark takes turns the PCR product and the adaptive son of above-mentioned synthetic AP-1 to AP-11 of screening; Detect adaptive son and Ag85B protein affinity through the ELONA method, the result shows that the avidity of the adaptive son of AP-1 is the highest.
The avidity of 11 adaptive sons is measured
| Oligonucleotide aptamer title Aptamer | The nucleotide sequence DNA sequence of the aptamers (5 '-3 ') of adaptive son | Avidity (absorbancy OD 492) |
| AP-1 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCT CAAAAGTGCACGCTACTTTGCTAA | 1.347 |
| AP-2 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCG CAAAAGTGCACGCTACTTTGCTAA | 1.259 |
| AP-3 | GCAATGGTACGGTACTTCCAACCTCAGGTGATCTGCCTGCCTCGGCCC CAAAAGTGCACGCTACTTTGCTAA | 1.208 |
| AP-4 | GCAATGGTACGGTACTTCCTTTTTTTTTGTGTTGTCGTGATATTGTAACCTGT CAAAAGTGCACGCTACTTTGCTAA | 1.046 |
| AP-5 | GCAATGGTACGGTACTTCCTTAACTTTTTTTGATGTTTATGTCGGTTTGCTATG CAAAAGTGCACGCTACTTTGCTAA | 1.143 |
| AP-6 | GCAATGGTACGGTACTTCCTTTTCTGTCTAGTTGTATTTACTCTTGGTATTATG CAAAAGTGCACGCTACTTTGCTAA | 1.056 |
| AP-7 | GCAATGGTACGGTACTTCCTTTTGGAAATTCTTTTTGTACTAGAATAATACCAC CAAAAGTGCACGCTACTTTGCTAA | 1.078 |
| AP-8 | GCAATGGTACGGTACTTCCTTTTTATATCAGTCTTAATATTGTGTTCTGTTGAC CAAAAGTGCACGCTACTTTGCTAA | 1.141 |
| AP-9 | GCAATGGTACGGTACTTCCTTTTTCCTGTAATATTCGTCTTTTGATGTTGTCTA CAAAAGTGCACGCTACTTTGCTAA | 1.205 |
| AP-10 | GCAATGGTACGGTACTTCCTATCTTCATCGGCAGGATGCCTATGCGCAGGTTTG CAAAAGTGCACGCTACTTTGCTAA | 1.079 |
| AP-11 | GCAATGGTACGGTACTTCCATTGGCGTTTGTTAGGACTGATGTTCGAGAAACCG CAAAAGTGCACGCTACTTTGCTAA | 1.102 |
| Synthetic library Gp35 | GCAATGGTACGGTACTTCC-CAAAAGTGCACGCTACTTTGCTAA | 0.021 |
| The 8th takes turns the screening product | 1.354 |
The dissociation constant Kd value of the adaptive son of C.Ap-1: use the ELONA method and detect different concns AP-1 and the protein bound absorbancy OD492 of Ag85B, utilizing Origin Pro 7.5 computed in software AP-1 and the proteic dissociation constant Kd value of Ag85B then is 119.57 ± 52.95nM.
The protein bound absorbancy of different concns AP-1 and Ag85B
| The adaptive sub-concentration of Ap-1 (nM) | Absorbancy OD 492 |
| 0 | 0 |
| 0.5 | 0.02 |
| 5 | 0.034 |
| 10 | 0.428 |
| 100 | 0.793 |
| 360 | 1.516 |
| 720 | 1.695 |
The screening conditions of said each wheel are following:
The application of a kind of oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B aspect preparation mycobacterium tuberculosis detection reagent, its step is following:
A. through genetic engineering technique clone, expression, purifying mycobacterium tuberculosis Ag 85 B: the Ag85B recombinant plasmid in intestinal bacteria after IPTG induces 4 hours; Through SDS-PAGE analyze visible special expression product band (shown in Figure 1, be the purity analysis of mycobacterium tuberculosis Ag 85 B protein SDS-PAGE.), molecular weight is about about 31.0kDa, and the densitometric scan analysis revealed accounts for bacterial protein about 30%; Purifying Ag85B albumen under the sex change condition, the sample behind the purifying are analyzed through SDS-PAGE and are shown the protein band of only seeing a recovery, do not see other assorted band, are more than 95% through its purity of densitometric scan analysis revealed; As shown in Figure 1, be the purity analysis figure of mycobacterium tuberculosis Ag 85 B protein SDS-PAGE.Wherein, M: molecular weight of albumen standard; 1,3:Ag85B genetic engineering bacterium IPTG induces the back sample; 2: purified recombinant Ag85B albumen; 4:Ag85B genetic engineering bacterium IPTG induces preceding sample.
B. the animal immune method through routine prepares rabbit Killing Mycobacterium Tuberculosis Ag85B polyclonal antibody; Identify the titre of antibody through enzyme linked immune assay (ELISA); As shown in Figure 2; Be the titre that detects rabbit Killing Mycobacterium Tuberculosis Ag85B polyclonal antibody through ELISA, wherein, A1, A2 (blank) OD492 are respectively 0,0.007; A3, A4 (normal rabbit serum, negative control) OD492 are respectively 0.018,0.021; B1, B2 (No. 1 immunize rabbit serum) OD492 are respectively 1.473,1.652; B3, B4 (No. 2 immunize rabbit serum) OD492 are respectively 1.785,1.778; B5, B6 (No. 3 immunize rabbit serum) OD492 are respectively 1.219,1.186; B7, B8 (No. 4 immunize rabbit serum) OD492 are respectively 1.433,1.433.The result shows that 4 immunize rabbit serum all contain the Killing Mycobacterium Tuberculosis Ag85B polyclonal antibody of higher level.
C. set up and use the method that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in the humoral specimen: select the maximum clones' of the frequency of occurrences the adaptive sub-AP-1 of the pairing DNA of single growth bacterium colony to set up the adaptive sub-ELONA detection method of AP-1;
A. be that capture antibody encapsulates microwell plate with 1ng/ml rabbit Killing Mycobacterium Tuberculosis Ag85B polyclonal antibody IgG, put 4 ℃ and spend the night; Inferior daily PBST washes plate 3 times, each 3 minutes;
B.BSA sealing: every hole adds PBST-1%BSA 200 μ l, hatches 1 hour to 37 ℃, washes plate 3 times with PBST, each 3 minutes;
C. add undiluted humoral specimen to be measured, hatch 40min-1h for 37 ℃; With SELEX washings washing 3-5 time;
D. add the adaptive son of 1.25 μ g, 5 ' the biotinylated report of end, hatch 40min-1h for 37 ℃; With SELEX washings washing 3-5 time;
E. the marked by streptavidin horseradish peroxidase that adds 200 μ l dilution in 1: 1000 is hatched 30min for 37 ℃; With SELEX washings washing 3-5 time;
F. add O-Phenylene Diamine (O-Phenylenediamine, OPD), the colour developing 15min;
G. use 2mol/L vitriol oil termination reaction, measure the absorbancy of wavelength 492nm through ELIASA;
D. use susceptibility and specificity that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B:
A. use that the adaptive sub-ELONA method of AP-1 detects 100,80,50,40,20,10, the mycobacterium tuberculosis Ag 85 B albumen of 1ng/ml; Its OD492nm is respectively 0.89,0.678,0.494,0,0,0,0, shows that the susceptibility of using the adaptive sub-ELONA method detection mycobacterium tuberculosis Ag 85 B of AP-1 is 50ng/ml;
B. use the mycobacterium tuberculosis MPT 64 albumen that the adaptive sub-ELONA method of AP-1 detects 50ng/ml, its OD492nm is 0, shows that using the adaptive sub-ELONA method detection mycobacterium tuberculosis Ag 85 B of AP-1 has higher specificity;
E. use the adaptive sub-ELONA method of AP-1 and detect mycobacterium tuberculosis Ag 85 B in the humoral specimen:
A. use the adaptive sub-ELONA method of AP-1 and detect mycobacterium tuberculosis Ag 85 B in 100 routine healthy subjects (comprising the negative and 59 routine PPD skin test positive persons of 41 routine PPD skin tests), 59 routine non-tuberculosis respiratory disease patients and the 83 routine tuberculosis patient serum, its OD492nm is respectively 0.034 ± 0.14,0.056 ± 0.17,0.250 ± 0.41.(Mean ± 2SD) is the normal limits value with the optical density(OD) MV+2 times standard deviation of normal healthy controls group and non-tuberculosis respiratory disease control group; The sensitivity of using mycobacterium tuberculosis Ag 85 B in the adaptive sub-ELONA method detection tuberculosis patient serum of AP-1 is 30.1%, and wherein the cloudy patient's of bacterium sensitivity is 12%, and the sensitivity that bacterium sun patient detects is 57.6%; Specificity is 98.1%; Positive predictive value 89.3%, negative predictive value 72.9%, total accuracy rate is 74.8%.
Use the result that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in the 242 routine human serums
As shown in Figure 3, be to use the result that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in the human serum.Wherein: A1: blank; The mycobacterium tuberculosis Ag 85 B albumen of B1-H1:100,80,60,50,20,10,1ng/ml; A2-H2:No.1-8 consumptive serum; The non-tuberculosis respiratory disease of A3-H3:No.1-8 patients serum; The healthy subjects serum that the A4-H4:No.1-8PPD tuerculoderma is negative; A5-H5:No.1-8PPD tuerculoderma male healthy subjects serum.
B. use the adaptive sub-ELONA method of AP-1 and detect mycobacterium tuberculosis Ag 85 B in 2 routine non-tuberculous pleuritis patients and the 22 routine tuberculous pleuritis patient's hydrothorax; Its OD492nm is respectively 0.04 ± 0.03,0.120 ± 0.18, and 4 routine OD492nm obviously increase in the 22 routine tuberculosis property hydrothorax, and positive rate is 18.2%; Result institute is shown in Figure 4; Be to use the result that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in people's hydrothorax, wherein, A1, A2: blank; B1, B2: positive control; C1, C2: negative control; A3, A4, B3, B4, C3, C4: tuberculosis property hydrothorax; A5, A6, B5, B6, C5, C6: non-tuberculous hydrothorax.The result shows that this method also can detect antigen of mycobacterium tuberculosis from hydrothorax.
C. use the adaptive sub-ELONA method of AP-1 and detect mycobacterium tuberculosis Ag 85 B in 4 routine non-tuberculous meningitis patients and the 28 routine tuberculous meningitis patient's cerebrospinal fluid; The result is as shown in Figure 5, uses the result that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in the human cerebrospinal fluid.Wherein, A1, A2: blank; B1, B2: positive control; C1, C2: negative control; A3, A4, B3, B4, C3, C4, D3, D4: tuberculosis property cerebrospinal fluid; A5, A6, B5, B6, C5, C6, D5, D6: non-tuberculous cerebrospinal fluid.
The result shows: only 1 routine tuberculosis property cerebrospinal fluid OD492nm obviously increases, and positive rate is 3.6%, and the result shows that this method also can detect antigen of mycobacterium tuberculosis from cerebrospinal fluid.
D. use the adaptive sub-ELONA method of AP-1 and detect mycobacterium tuberculosis Ag 85 B in 6 routine non-tuberculous peritonitis patients and the 28 routine tuberculous peritonitis patient's ascites, Fig. 6 is for using the result that the adaptive sub-ELONA method of AP-1 detects mycobacterium tuberculosis Ag 85 B in people's ascites.A1, A2: blank; B1, B2: positive control; C1, C2: negative control; A3, A4, B3, B4, C3, C4: non-tuberculous ascites; A5, A6, B5, B6, C5, C6: tuberculous ascites.
The result shows: 2 routine tuberculous ascites OD492nm obviously increase, and positive rate is 33.3%, and the result shows that this method also can detect antigen of mycobacterium tuberculosis from ascites.
Sequence table
< 110>The No. 309 Hospital of PLA, Beijing Tuberculosis and Thoracic Tumor Research Institute
< 120>oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B
<130>
<160>13
<170>PatentIn?version?3.3
<210>1
<211>72
<212>DNA
<213>AP-1
<400>1
gcaatggtac?ggtacttcca?acctcaggtg?atctgcctgc?ctcggcctca?aaagtgcacg 60
ctactttgct?aa 72
<210>2
<211>72
<212>DNA
<213>AP-2
<400>2
gcaatggtac?ggtacttcca?acctcaggtg?atctgcctgc?ctcggccgca?aaagtgcacg 60
ctactttgct?aa 72
<210>3
<211>72
<212>DNA
<213>AP-3
<400>3
gcaatggtac?ggtacttcca?acctcaggtg?atctgcctgc?ctcggcccca?aaagtgcacg 60
ctactttgct?aa 72
<210>4
<211>77
<212>DNA
<213>AP-4
<400>4
gcaatggtac?ggtacttcct?ttttttttgt?gttgtcgtga?tattgtaacc?tgtcaaaagt 60
gcacgctact?ttgctaa 77
<210>5
<211>78
<212>DNA
<213>AP-5
<400>5
gcaatggtac?ggtacttcct?taactttttt?tgatgtttat?gtcggtttgc?tatgcaaaag 60
tgcacgctac?tttgctaa 78
<210>6
<211>78
<212>DNA
<213>AP-6
<400>6
gcaatggtac?ggtacttcct?tttctgtcta?gttgtattta?ctcttggtat?tatgcaaaag 60
tgcacgctac?tttgctaa 78
<210>7
<211>78
<212>DNA
<213>AP-7
<400>7
gcaatggtac?ggtacttcct?tttggaaatt?ctttttgtac?tagaataata?ccaccaaaag 60
tgcacgctac?tttgctaa 78
<210>8
<211>78
<212>DNA
<213>AP-8
<400>8
gcaatggtac?ggtacttcct?ttttatatca?gtcttaatat?tgtgttctgt?tgaccaaaag 60
tgcacgctac?tttgctaa 78
<210>9
<211>78
<212>DNA
<213>AP-9
<400>9
gcaatggtac?ggtacttcct?ttttcctgta?atattcgtct?tttgatgttg?tctacaaaag 60
tgcacgctac?tttgctaa 78
<210>10
<211>78
<212>DNA
<213>AP-10
<400>10
gcaatggtac?ggtacttcct?atcttcatcg?gcaggatgcc?tatgcgcagg?tttgcaaaag 60
tgcacgctac?tttgctaa 78
<210>11
<211>78
<212>DNA
<213>AP-11
<400>11
gcaatggtac?ggtacttcca?ttggcgtttg?ttaggactga?tgttcgagaa?accgcaaaag 60
tgcacgctac?tttgctaa 78
<210>12
<211>78
<212>DNA
<213>AP-12
<400>12
gcaatggtac?ggtacttccg?gttattctgt?attgttgaat?tgttctagtg?gtttcaaaag 60
tgcacgctac?tttgctaa 78
<210>13
<211>78
<212>DNA
<213>AP-13
<400>13
gcaatggtac?ggtacttccg?ttattcaatt?aagtcgggtt?tattgtgtgc?gttgcaaaag 60
tgcacgctac?tttgctaa
Claims (2)
1. the oligonucleotide aptamer of a targeted mycobacterium tuberculosis Ag 85 B, it is characterized in that: the nucleotide sequence of said oligonucleotide aptamer is shown in sequence in the sequence table 1.
2. the application of the oligonucleotide aptamer of targeted mycobacterium tuberculosis Ag 85 B aspect preparation mycobacterium tuberculosis detection reagent, the nucleotide sequence of said oligonucleotide aptamer is shown in sequence in the sequence table 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910090227A CN101619313B (en) | 2009-08-05 | 2009-08-05 | Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910090227A CN101619313B (en) | 2009-08-05 | 2009-08-05 | Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101619313A CN101619313A (en) | 2010-01-06 |
| CN101619313B true CN101619313B (en) | 2012-08-29 |
Family
ID=41512726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910090227A Expired - Fee Related CN101619313B (en) | 2009-08-05 | 2009-08-05 | Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101619313B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014166558A1 (en) | 2013-04-09 | 2014-10-16 | Tubitak (Turkiye Bilimsel Ve Teknolojik Arastirma Kurumu) | Dna aptamers to diagnose mycobacterium tuberculosis bacteria and treat tuberculosis disease, specific for m. tuberculosis bacteria |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103937781A (en) * | 2013-03-15 | 2014-07-23 | 河南省农业科学院 | Real-time monitoring systematic evolution technology of ligands by exponential enrichment |
| CN106290914A (en) * | 2015-11-29 | 2017-01-04 | 卢美珍 | A kind of test kit for human brain disease detection |
| CN115806993B (en) * | 2022-12-27 | 2023-11-14 | 中国人民解放军军事科学院军事医学研究院 | Aptamer HCG-2 for specifically recognizing human chorionic gonadotrophin |
-
2009
- 2009-08-05 CN CN200910090227A patent/CN101619313B/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014166558A1 (en) | 2013-04-09 | 2014-10-16 | Tubitak (Turkiye Bilimsel Ve Teknolojik Arastirma Kurumu) | Dna aptamers to diagnose mycobacterium tuberculosis bacteria and treat tuberculosis disease, specific for m. tuberculosis bacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101619313A (en) | 2010-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102836425B (en) | The Vaccinum Calmette-Guerini of antigen expressed during comprising the latent infection stage | |
| CN102719438B (en) | Nucleic acid aptamer capable of being specifically bound to tubercle bacillus antigen and application thereof | |
| CN101619313B (en) | Oligonucleotides aptamer of targeted mycobacterium tuberculosis Ag85B, preparation method and application thereof | |
| CN107344968A (en) | A kind of time-resolved fluorescence immunoassay method for being used to detect avian influenza virus H7N9 | |
| CN103059109B (en) | Mycoplasma pneumonia antigen, preparation method and immunodetection kit | |
| CN101382548A (en) | Tuberculosis antibody multi-antigen ELISA detecting kit and making method | |
| CN101493454A (en) | Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same | |
| CN106589082A (en) | Screening and application of active tuberculosis diagnosis molecules | |
| CN102830235B (en) | A kind of luminescence detection kit and preparation method thereof | |
| WO2011014989A1 (en) | Oligonucleotide aptamers targeting at mycobacterium tuberculosis ag85b, preparing method and uses thereof | |
| CN102798723B (en) | Chemiluminescence detection kit and preparation method | |
| CN105861520A (en) | Application of Rv3121 protein for detecting mycobacterium tuberculosis infection | |
| WO2017125007A1 (en) | Method and kit for diagnosis of active tuberculosis | |
| CN101709087A (en) | Puccinia triticina f.sp.tritic monoclonal antibody and preparation method and application thereof | |
| CN104450724B (en) | One group of nucleic acid aptamers capable of specifically identifying Beijing genotypes tuberculosis bacterial strain antigen and application of nucleic acid aptamers | |
| CN107151672B (en) | Recombinant plasmid and application thereof | |
| CN102081092A (en) | Kit and detection method for mycobacterium tuberculosis | |
| CN101477125B (en) | Composition based on tubercle bacillus antigenic polypeptide for diagnosing tuberculosis | |
| CN104805063A (en) | Mycobacterium tuberculosis latent infection related proteins, preparation and applications thereof | |
| Qin et al. | Dynamic evolution and immunoreactivity of aptamers binding to polyclonal antibodies against MPT64 antigen of Mycobacterium tuberculosis | |
| CN102071204A (en) | Deoxyribonucleic acid (DNA) aptamer for mycobacterium tuberculosis glycolipid antigen and application thereof | |
| CN101581723A (en) | Kit used for detecting bovine abortus Chlamydia psittaci antibody and preparation method thereof | |
| CN101979406B (en) | Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof | |
| CN113278073B (en) | NKG2A nano antibody and application thereof | |
| CN106405113A (en) | Specific marker for detecting potential tuberculosis and application of specific marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120829 Termination date: 20130805 |