CN106310225B - Application of caspase recruitment domain protein 6 (Card 6) in liver ischemia-reperfusion injury - Google Patents

Abstract

The invention discloses an application of caspase recruitment domain protein 6 (Card 6) in liver ischemia reperfusion injury, belonging to the field of gene function and application. According to the invention, a liver cell specific Card6 gene knockout mouse and a Card6 transgenic mouse are taken as experimental objects, the function of a Card6 gene is researched through a liver ischemia reperfusion injury model, and the Card6 is found to have the effect of improving liver ischemia reperfusion injury, so that the Card6 has the following applications: the application of the Card6 as a drug target in screening drugs for preventing, relieving and/or treating hepatic ischemia-reperfusion injury, wherein the screening of the drugs for preventing, relieving and/or treating hepatic ischemia-reperfusion injury refers to the screening of drugs capable of promoting the expression of Card 6; application of Card6 in preparing a medicament for preventing, alleviating and/or treating hepatic ischemia-reperfusion injury.

Description

Application of caspase recruitment domain protein 6 (Card 6) in liver ischemia-reperfusion injury

Technical Field

The invention belongs to the field of functions and applications of genes, and relates to application of caspase recruitment domain protein 6 (Card 6) in liver ischemia-reperfusion injury, in particular to application of Card6 in screening or preparing a medicine for preventing, relieving and/or treating liver ischemia-reperfusion injury.

Background

In clinical procedures such as liver resection, treatment of severe liver injury and liver transplantation, it is usually necessary to block the blood flow of the hepatic portal, and the damage of the hepatocytes, which were damaged in the original ischemia, is not reduced but rather increased after the blood supply is restored, which is called Hepatic Ischemia Reperfusion Injury (HIRI) [1 ]. HIRI can reduce liver metabolism and detoxification function, and severe patients cause liver failure, which directly affects disease prognosis, operation success rate and patient survival rate. How to alleviate HIRI is a significant problem facing current liver surgery.

HIRI is a pathophysiological process involving multiple factors and functioning of multiple signal pathways, and the pathogenesis of HIRI is not completely elucidated so far. HIRI involves the interaction of hepatocytes with a variety of non-parenchymal cells such as sinusoidal endothelial cells, kupffer cells, stellate cells, and infiltrating inflammatory cells, in which the activated complement system is also involved [2 ]. The pathological characteristics are as follows: (1) the liver histiocyte is damaged due to the activation of kupffer cells, lymphocytes and neutrophils; (2) the release and activation of calcium overload, oxygen free radicals and cytokines cause inflammatory reactions, apoptosis, necrosis; (3) damage to hepatic sinus endothelial cells leads to microcirculatory disturbance, further aggravating irreversible damage such as tissue ischemia and apoptosis by cell necrosis [3 ].

Since the 80 s of the last century, the search for ways and methods to alleviate HIRI, surgical intervention, ischemic preconditioning, drug preconditioning and post-ischemic conditioning [4] have been gradually applied clinically. However, the above strategies have not been able to adequately address the problem of liver damage from clinical HIRI. With the intensive research in the fields of molecular biology, genetic engineering technology and the like, the targeted therapy aiming at important functional genes related to HIRI opens up a new way for the prevention and treatment of HIRI.

Caspase recruitment domain protein 6 (Card 6) is one of the important members of the Card family, and is a newly discovered protein that plays an important role in regulating inflammatory and immune processes [5], widely expressed in tissues and organs such as heart, liver, lung, kidney, skeletal muscle and the like of mammals [6, 7 ]. Card6 is involved in signal transduction of multiple receptors in innate or adaptive immunity, and can regulate expression of NOD-like receptors (NLRs) and Toll-like receptors (TLRs) dependent proinflammatory factors, playing an important role in immune and inflammatory responses in the body [8, 9 ]. It has been shown that Card6 can interact with the RIP kinase family members, RICK, RIP1, through its Core amino acid domain (Core). Another study has shown that increased expression of Card6 in β -IFN and γ -IFN-induced bone marrow derived macrophages may play an important role in the immune response to pathogens, innate immunity, and adaptive immune regulation in the body [9 ]. HIRI is also a lesion closely related to inflammation and immunity, and the functional role of Card6 in the pathogenesis of HIRI is researched, so that it is expected to become an important potential target for preventing and treating HIRI.

Reference documents:

1. Serracino-Inglott, F., N.A. Habib, and R.T. Mathie, Hepatic ischemia-reperfusion injury. Am J Surg, 2001. 181(2): p. 160-6.

2. Li, A.M., et al., Effects of therapeutic hypercapnia on inflammation and apoptosis after hepatic ischemia-reperfusion injury in rats.Chin Med J (Engl), 2010. 123(16): p. 2254-8.

3. de Rougemont, O., P. Dutkowski, and P.A. Clavien, Biological modulation of liver ischemia-reperfusion injury. Curr Opin Organ Transplant, 2010. 15(2): p. 183-9.

4. Li, J., et al., The mechanisms and strategies to protect from hepatic ischemia-reperfusion injury. Eur Rev Med Pharmacol Sci, 2015. 19(11): p. 2036-47.

5. Li, L., et al., Caspase recruitment domain 6 protects against cardiac hypertrophy in response to pressure overload. Hypertension, 2014. 64(1): p. 94-102.

6. Stehlik, C., et al., Card6 is a modulator of NF-kappa B activation by Nod1-and Cardiak-mediated pathways. J Biol Chem, 2003. 278(34): p. 31941-9.

7. Dufner, A., S. Pownall, and T.W. Mak, Caspase recruitment domain protein 6 is a microtubule-interacting protein that positively modulates NF- kappaB activation. Proc Natl Acad Sci U S A, 2006. 103(4): p. 988-93.

8. Dufner, A. and T.W. Mak, CARD tricks: controlling the interactions of Card6 with RICK and microtubules. Cell Cycle, 2006. 5(8): p. 797-800.

9. Dufner, A., et al., Card6 is interferon inducible but not involved in nucleotide-binding oligomerization domain protein signaling leading to NF- kappaB activation. Mol Cell Biol, 2008. 28(5): p. 1541-52。

disclosure of Invention

In order to solve the defects and shortcomings of the prior art for clinically preventing and treating the hepatic ischemia-reperfusion injury, the invention aims to determine the correlation between the expression of the Card6 gene and the hepatic ischemia-reperfusion injury and provide a new application of a target gene Card6 for treating the hepatic ischemia-reperfusion injury, namely the application of Card6 as a drug target in screening drugs for preventing, relieving and/or treating the hepatic ischemia-reperfusion injury, the application of Card6 in preparing drugs for preventing, relieving and/or treating the hepatic ischemia-reperfusion injury, and further the application of Card6 gene in treating the hepatic ischemia-reperfusion injury.

The purpose of the invention is realized by the following technical scheme:

the invention takes a liver cell specificity Card6 gene knockout mouse and a Card6 transgenic mouse as experimental objects, and researches the function of the Card6 gene through a liver ischemia reperfusion injury model. The results show that: compared with a wild type C57BL/6 mouse, the area of liver necrosis of the mouse with the liver cell specificity Card6 gene knockout is obviously increased; the necrotic area of the liver was significantly reduced in the Card6 transgenic mice compared to the non-transgenic mice. This suggests that the gene Card6 has the function of protecting liver, and provides theoretical basis and clinical basis for the function of Card6 in the research of new targets and strategies for preventing and treating hepatic ischemia.

The study of the present invention demonstrates that: in the liver ischemia-reperfusion injury model, Card6 has the functions of inhibiting liver necrosis, reducing liver cell apoptosis and protecting liver function.

A function of Card6 gene in liver ischemia reperfusion injury is mainly reflected in that Card6 has the function of protecting liver, especially Card6 has the function of improving liver ischemia reperfusion injury.

Aiming at the function of improving the hepatic ischemia reperfusion injury of the Card6, the Card6 has the following applications:

application of Card6 as a drug target in screening drugs for preventing, alleviating and/or treating hepatic ischemia-reperfusion injury. This application is for non-diagnostic and therapeutic purposes; the screening of the medicine for preventing, relieving and/or treating the liver ischemia-reperfusion injury refers to screening of the medicine capable of promoting the expression of Card 6.

Application of Card6 in preparing a medicament for preventing, alleviating and/or treating hepatic ischemia-reperfusion injury.

Compared with the prior art, the invention has the following advantages and effects:

(1) the invention discovers a new function of the Card6 gene, namely that the Card6 gene can inhibit the ischemia reperfusion injury of liver tissues and is closely related to the apoptosis of liver cells.

(2) Based on the role of Card6 in protecting liver ischemic diseases, it can be used for screening or preparing drugs for preventing, alleviating and/or treating liver ischemia reperfusion injury.

Drawings

FIG. 1 is a schematic diagram of a construction strategy of a hepatocyte-specific Card6 knock-out mouse and a diagram of a result of detecting the expression level of Card6 protein in a tissue of the constructed mouse. A is a construction strategy diagram of a liver cell specificity Card6 gene knockout mouse; b is a Western Blot detection result graph of the expression level of the Card6 protein in the tissue.

FIG. 2 is a schematic diagram of the construction strategy of a hepatocyte-specific transgenic mouse Card6 and the result of detecting the expression level of Card6 protein in the liver tissue of the constructed mouse. A is a construction strategy diagram of a hepatocyte-specific Card6 transgenic mouse; b is a Western Blot detection result graph of the expression level of the Card6 protein in liver tissues (wherein TG1, TG2, TG3 and TG4 are different transgenic mouse individuals).

FIG. 3 is a graph comparing the necrosis of the liver at different time points in mice. A is a liver HE staining graph and a necrosis area statistical histogram of WT and Card6-LKO mice at different time points; b is liver HE staining and necrosis area statistics histogram of NTG and Card6-TG mice at different time points (.: P < 0.05 vs WT I/R group; # P < 0.05 vs NTG I/R group).

FIG. 4 is a statistical comparison of ALT and AST levels in serum of mice at different time points. A is a histogram of the content statistics of ALT and AST in liver serum of WT and Card6-LKO mice at different time points; b is the histogram of ALT and AST content in the liver serum of NTG and Card6-TG mice at different time points (.: P < 0.05 vs WT Sham group; # P < 0.05 vs WT/NTG corresponding to time point I/R group).

FIG. 5 is a bar graph of TUNEL cell number at 24h reperfusion in mouse ischemia. A is TUNEL immunofluorescence and histogram of WT and Card6-LKO mice when they were reperfused for 24 h; b is TUNEL immunofluorescence and histogram of NTG and Card6-TG mice at 24h reperfusion (P < 0.05 vs WT/NTG I/R group).

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

Experimental animals and breeding:

experimental animals: wild type mice (WT, purchased from Beijing Huafukang Biotechnology GmbH) with the weight of 24g-27g and the background of male C57BL/6 strain, hepatocyte-specific Card6 gene knockout mice (Card 6-LKO), Card6 transgenic mice (Card 6-TG) (constructed by Lihongliang old teacher laboratory at animal experiment center of Wuhan university) and non-transgenic mice (NTG, littermate control non-transgenic mice) with the age of 8-10 weeks are selected as experimental objects.

A breeding environment: all experimental mice were housed in the SPF-class laboratory animal center, university of Wuhan. The SRF-grade mouse feed was purchased from Beijing Huafukang Biotech GmbH. Feeding conditions are as follows: the room temperature is 22-24 ℃, the humidity is 40-70%, the illumination time is 12h with alternating light and shade, and the drinking water can be freely taken.

Example 1 construction of hepatocyte-specific Card6 Gene knockout mice and Card6 transgenic mice

(1) Construction of hepatocyte-specific Card6 knockout mice (construction strategy is shown in A in FIG. 1)

According to the information of the Card6 gene, a CRISPR Design is utilized to Design a CRISPR targeting site in the non-coding region 4 of the intron 3 and the non-coding region 4 of the exon 4 respectively, and the target sequences are respectively:

Card6-sRNA1：GgAGAGTAGGCAACATGACT TGG；

Card6-sRNA2：gGTGAAAGCAGTTATCAGTA GGG。

in addition, a Donor Vector for homologous repair (Donor Vector) was designed, which included flanking homology arms, the middle exon 4, and two loxp sequences in the same orientation.

1) Construction of targeting vectors: two primers corresponding to sgRNA1 and sgRNA2 were fused into double-stranded DNA, respectively, and then ligated into a pUC57-sgRNA (addge 51132) vector treated with restriction enzyme BsaI using T4 DNA ligase. The upstream of the vector is provided with a T7 promoter which can be used for subsequent in vitro transcription experiments.

2) Construction of conditional knock-out backbone vector pBluescript SK (+) -2 loxp:

respectively synthesizing 4 oligomeric single-stranded nucleotide sequences:

loxp1-F：AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACCGGTGAT；

loxp1-R：ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGTCA；

loxp2-F：GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACGCGTA；

loxp2-R：CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTTAAGG；

the oligonucleotide sequences anneal to form two strands, loxp1 and loxp 2. The pBluescript II SK (+) vector is double-cut by HindIII (NEB, R0104L) and EcoRV (NEB, R0195L) and then connected into a loxp1 annealing double strand, and then the vector with correct sequence is double-cut by BamHI (NEB, R01 0136L) and SpeI (NEB, R0133L) and connected into a loxp2 annealing double strand, so that the conditional knockout framework vector is obtained and named as pBluescript SK (+) -2 loxp.

3) Construction of Donor Vector (Donor Vector): the following primers (Table 1) were designed according to the principle of primer design, and the left and right homology arms and the middle exon portion of the donor vector were amplified using mouse gDNA as a template. The product obtained by the amplification and the pBluescript SK (+) -2loxp vector are subjected to enzyme digestion by the restriction enzymes shown in Table 1 and then are connected one by one to obtain a donor vector.

TABLE 1 primer sequences and corresponding cleavage sites required for construction of donor vectors

Primer name	Primer sequences	Cleavage site
			Card6-F	GGGGTACCGTATAGATTTGTTAAAAATGAAAGTAGAGTAGGCAACATGATAACTTCGTATAGCATACATTATAGCAATTTATACTTGGAGTGAACCAACTCTTG	KpnI
Card6-R	ATAAGAATGCGGCCGCACCCTGTAGGTGTGTGCCACCTTGCCCAGCCAGACCCTACATAAATTGCTATAATGTATGCTATACGAAGTTATTGATAACTGCTTTCACAGTTCC	NotI

4) Transcription of the targeting vector: the two parts (Cas 9 protein responsible for cleavage and gRNA that directs Cas9 protein to target site) comprised by the CRIPR/Cas9 system were transcribed separately. For the Cas9 protein, the expression vector pST1374-Cas9 (Addgene 44758) is cut by enzyme with PmeI, a linearized plasmid is recovered after purification as a transcription template, and in vitro transcription is carried out by using a T7 mMESSAGE mMACHINE kit (AM 1345, Ambion), so as to obtain a capped mRNA product. Tailing the product by using a Poly (A) Tailing kit (Ambion) to obtain a mature mRNA product; for sgRNA, in vitro transcription was performed using the megashort Kit (AM 1354, Ambion). The transcribed mRNA of Cas9 and sgRNA was purified using miRNeasy Micro Kit (Qiagen, 217084).

5) Production of Card6-floxed conditional knockout mice

Injecting the mature mRNA product and donor vector into mouse fertilized egg, and transplanting to surrogate mother mouse for breeding. The resulting mice were identified. And (3) taking out toe or tail tissues of the mice one week after the mice are born, extracting genomes, and screening positive initial mice by a PCR method. Randomly selecting one of the mice confirmed to have homologous recombination as F0 generation for subsequent propagation, and finally obtaining Card6-floxed homozygous mice.

6) Preparation of hepatocyte-specific Card6 Gene knockout mice

The above Card6-floxed mice were mated with liver-specific Alb-Cre (purchased from The Jackson Laboratory, cat # 003574) transgenic mice, and screened to obtain Card6^{floxed/floxed}And (2) injecting Tamoxifen intraperitoneally to the Alb-Cre mouse after the mouse grows to about 6 weeks old, inducing the expression of Cre enzyme, specifically identifying two homodromous loxps by the Cre enzyme, cutting off a sequence between the two loxps and one loxp in the loxp, and finally obtaining the hepatocyte specific Card6 gene knockout mouse.

The expression level of the Card6 protein in the liver of the liver cell-specific Card6 gene knockout mouse is detected by a Western Blot experiment (Western Blot). Proteins of liver, heart, brain and kidney tissues were extracted, and the expression of Card6 was confirmed by polyacrylamide gel electrophoresis (SDS-PAGE), and the results are shown in B in FIG. 1. In heart, brain and kidney tissues of a mouse, the expression content of the Card6 protein of a WT mouse and a knockout mouse is not greatly changed; in the liver tissue, compared with WT mice, the expression level of the Card6 protein in the knockout mice is obviously reduced.

(2) Construction of hepatocyte-specific Card6 transgenic mice (construction strategy is shown in A of FIG. 2)

Wild-type C57BL/6 Mouse Card6 Gene cDNA as a template, Mouse Card6 Gene (NCBI, Gene ID: 239319, NM-001163138.1) was amplified using an upstream primer (5'-AGCTTTGTTTAAACGCCACCATGGCTACAGAGGGTGC-3') and a downstream primer (5'-GGACTAGTTTAACGTCTCCCTGCTCTTG-3'), the amplified product was ligated to pCAG-CAT-LacZ vector (available from the laboratory of the Yankee Master, university of medical institute, Beijing Corp., and medical institute of Japan, see references: Kim T, Zalyabovska O, Liu J, et al, Gene of an Inducile, Cardiocyte-Specific Transgenic Mouse Model with PPAR b/d expression [ J ]. Peroxisome promoter-Activated Receptors (PPA), 57.) using restriction enzymes PmeRs (NEB, R0560L) and SpeI (NEB 0560B L), and plasmid DNA (CAT-33-DNA) to obtain Transgenic vector, expression of Card6 is driven by the CAG promoter. The constructed vectors were constructed into fertilized embryos (C57 BL/6J background) by microinjection to give Card6-floxed transgenic mice. Hepatocyte-specific Card6 transgenic mice were bred by cross breeding of Card6-floxed transgenic mice and Alb-Cre (purchased from The Jackson Laboratory, cat No. 003574) mice.

The expression level of the Card6 protein in the liver of different transgenic mice was determined by Western blotting (Western Blot) experiment. The different transgenic mouse liver tissue proteins were extracted and verified for overexpression of Card6 by polyacrylamide gel electrophoresis (SDS-PAGE), and the results are shown in B in fig. 2. The expression level of the Card6 protein in different transgenic mice is improved to different degrees compared with that in NTG mice.

Example 2 obtaining of mouse hepatic ischemia reperfusion injury (ischemia/reperfusion injury, I/R) model

(1) Grouping experimental animals: a liver ischemia-reperfusion injury model is established by liver ischemia-reperfusion (I/R) of a wild mouse of a male C57BL/6 strain, a liver cell-specific Card6 gene knockout mouse, a transgenic mouse of Card6 and a non-transgenic mouse. Randomized into 8 groups: the C57BL/6J strain wild type mouse pseudo-surgery group (WT Sham) and I/R surgery group (WT I/R), hepatocyte-specific Card6 gene knockout mouse pseudo-surgery group (LKO Sham) and I/R surgery group (LKO I/R), non-transgenic mouse pseudo-surgery group (NTG Sham) and I/R surgery group (NTG I/R), Card6 transgenic mouse pseudo-surgery group (TG Sham) and I/R surgery group (TG I/R).

(2) Operation procedure of I/R model operation of hepatic ischemia reperfusion injury (portal vein and hepatic artery of middle and left lobes are clamped by non-invasive vascular clamps to make about 70% of liver ischemia):

1) mice were fasted 12h before surgery and had free access to water.

2) After the mice were successfully anesthetized with 3% sodium pentobarbital before surgery, they were stood flat to immobilize the limbs, the abdominal region of the mice was shaved with a shaver, and the region was sterilized with 10% iodine tincture and 75% ethanol.

3) An incision is made in the middle of the abdomen to expose the hepatic pedicle of the left and middle lobes of the liver.

4) The portal vein and hepatic artery of the middle and left lobes were clamped with non-invasive vascular clamps to ischemia about 70% of the liver to prevent severe mesenteric venous congestion. After 0.5min, the blocked leaves were seen to turn white compared to the non-blocked right leaves, indicating successful blocking. At this point, care was taken to record the onset of ischemia, maintain ischemia for about 60 minutes, cover the incision with wet saline gauze during which time, and take care of the incubation of the mice (Sham group mice removed the vascular clamp immediately upon successful blockade, restoring ischemic liver blood flow).

5) Removing the vascular clamp after 60 minutes of ischemia, recovering the blood flow of the ischemic liver, closing the abdominal cavity in two layers, sewing the inner layer, then sewing the skin, and placing the mice after the operation into a clean cage for independent feeding and observation.

Example 3 determination of the area of necrosis of the liver and the liver function indices (AST, ALT)

The evaluation indexes of the severity of the liver ischemia-reperfusion injury mainly comprise liver necrosis area and liver function indexes (AST and ALT), and the indexes are positively correlated with the severity of the liver ischemia-reperfusion injury.

(1) Taking materials

Mice in a Sham operation group (Sham) and an ischemia reperfusion group are taken at 1h, 3h, 6h, 12h and 24h after operation respectively, cervical dislocation is killed, 1mL of blood is taken from inferior vena cava immediately, and serum is separated. Meanwhile, the left lobe tissue of the liver in the ischemic area with the size of about 1.5cm multiplied by 1cm multiplied by 0.2cm is uniformly fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, and then subjected to HE staining after paraffin section.

Separating serum: the EP tube from which the blood was collected was allowed to stand at room temperature for 1-2 hours to allow the blood to coagulate naturally. Centrifuging at 4000rpm/min at 4 deg.C for 30min, and separating serum. 20. mu.L, 30. mu.L and 30. mu.L of serum were pipetted into a 0.2mL sterile EP tube, and the EP tube was labeled and stored in a freezer at-80 ℃ for further use.

(2) Preparation of Paraffin specimen section

1) The main operation procedures comprise: embedding frame treatment → flowing water washing → dehydration → transparence → wax soaking → embedding → slicing → spreading piece → airing or baking for standby.

2) Cut 5 μm paraffin sections for use using the standard procedure of a paraffin slicer.

(3) HE staining

The method mainly comprises the following steps: baking at 55 ℃ for 30min → xylene for 5min, 3 times → 100% alcohol for 1min → 95% alcohol for 1min → 70% alcohol for 1min → double distilled water for 1min → hematoxylin solution for 5min → water washing for 1min → 1% alcohol hydrochloride for 1s → water washing for 1min → Scott solution (sodium bicarbonate for 0.35g, magnesium sulfate for 2g, distilled water for 100 mL) for 1min → water washing for 1min → eosin solution for 3-5min → distilled water for washing away floating color → 70% alcohol for 1s → 95% alcohol for 1s → 100% alcohol for 30s, 3 times → xylene for 2min, 3 times → xylene for 3 times → immediate sealing piece before xylene drying → ventilation for drying, and taking a picture by microscope.

(4) Determination of ALT and AST content in mouse serum

1) Taking a serum sample out of a refrigerator at the temperature of-80 ℃, quickly placing the serum sample on ice, and waiting for the sample to melt at room temperature;

2) serum from the EP tube wall was allowed to accumulate to the bottom of the tube by centrifugation at 4000rpm for 1 minute at room temperature.

3) According to the operation procedure, the fully automatic biochemical analyzer (Sysmex, Chemix 180 i) was turned on and the sample injector was cleaned.

4) And (4) putting the EP tubes to be detected one by one according to the marking sequence of the sample plates of the full-automatic biochemical analyzer.

5) Accurately installing a reagent detection disc, and starting to detect the ALT and AST levels by using a full-automatic biochemical analyzer.

HE staining results of WT and Card6-LKO groups after hepatic ischemia reperfusion injury are shown in a of fig. 3: under the microscope, liver tissues of the Sham group are basically normal, the structures of the liver tissues are neat, and no obvious fibrous tissue hyperplasia exists. The I/R group blurs the structure of the liver tissue and disorganizes the arrangement with prolonged reperfusion time. The liver cell has irregular necrotic foci, fuzzy structure, disorganization and dissociation of liver cells in the necrotic foci, and compared with normal liver, a large number of necrotic foci are found in liver lobules of necrotic liver, inflammatory reaction zones are found at the edge of necrotic tissue, and typical necrotic changes of liver cell nucleus are found, and the nucleus is solidified and contracted. This phenomenon peaked 24h after ischemia reperfusion. The experimental results show that the I/R infarct size of the mice given with Card6-LKO is significantly larger than that of the WT group of mice (A in FIG. 3); in contrast, the infarct size after I/R was significantly smaller in the mice of Card6-TG group than in the mice of NTG group (B in FIG. 3), and therefore, Card6 plays an important role in the damage caused by ischemia-reperfusion of liver.

The statistics of ALT and AST content in serum are shown in FIG. 4. The results showed that ALT and AST levels were significantly higher in the I/R group at each time point than in the Sham group, peaking at 6h post-reperfusion, and then declining, with ALT and AST levels significantly higher in the Card6-LKO mice after I/R than in the WT group (A in FIG. 4); ALT and AST levels after I/R were significantly lower in Card6-TG mice than in NTG group mice (B in FIG. 4).

Example 4 determination of hepatocyte apoptosis following ischemia reperfusion

Apoptosis was detected by TUNEL kit staining, TUNEL kit: ApopTag ^ Plus In Situ Apoptosis fluorescent Detection Kit (S7111, Chemicon). The specific process is as follows:

1) placing the paraffin slices in an oven, and baking the slices for 30 minutes at 60 ℃;

2) xylene, 5min × 3 times;

3) 100% ethanol, 5min × 2 times; 95% ethanol, 5 minutes; 70% ethanol, 5 minutes;

4）ddH₂o rinsing, 5 minutes multiplied by 2 times;

5) incubation with proteinase K at 37 ℃ for 15 min;

6) rinsing with PBS for 5min × 2 times;

7) equilibration Buffer was added directly dropwise to the tissue (13. mu.L/cm)²) Incubating at room temperature for at least 10 s;

8) the elution Buffer was discarded and TdT Enzyme working solution (77. mu.L Reaction Buffer + 33. mu.L TdT Enzyme) was added dropwise to the tissue (11. mu.L/cm)²) Incubating in a wet box at 37 ℃ for 1 h;

9) the sections were placed in a stock/Wash Buffer working solution (1 mL stock/Wash Buffer +34mL ddH)₂O) for 10min at room temperature after shaking for 15s (while waiting, the appropriate amount of Anti-Digoxigenin Conjugate was aspirated and placed in an EP tube, protected from light, and allowed to equilibrate to room temperature);

10) rinsing with PBS for 1min × 3 times;

11) gently removing the excess residual liquid from the tissue, sucking 3 the liquid around the tissue, and adding Anti-Digoxigenin Fluorescein working Solution (53% Blocking Solution + 47% Anti-Digoxigenin Conjugate) onto the tissue (13. mu.L/cm)²) Incubating in a wet box at room temperature in dark for 30 min;

12) PBS rinse 2min × 4 times (each time changing to new PBS);

13) SlowFade Gold anti reagent with DAPI (Invitrogen, S36939) coverslips; and (5) observing under a fluoroscope, and taking a picture. If necessary, the cells were stored in a dark and wet box at 4 ℃.

The apoptosis condition of the liver cells of each group of mice 24 hours after I/R operation is detected by a TUNEL kit, and the results are shown in figure 5, wherein the apoptosis quantity of the liver cells of the Card6-LKO mice is obviously increased compared with that of wild-type mice (A in figure 5), and the apoptosis quantity of the liver cells of the Card6-TG mice is obviously reduced compared with that of non-transgenic mice (B in figure 5), which indicates that the apoptosis of the Card6 is related to the ischemia reperfusion of the liver cells. These results indicate that overexpression of Card6 can reduce ischemia reperfusion injury of liver tissue, and is closely related to hepatocyte apoptosis.

The results show that in the injury caused by liver ischemia reperfusion, the mouse liver necrosis area of the Card6 transgenic mouse is obviously reduced, the liver function is obviously improved, and the number of hepatocyte apoptosis is also obviously reduced. The Card6 gene is proved to have important protection function in liver ischemia disease model.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> Wuhan university

<120> use of caspase recruitment domain protein 6 (Card 6) in liver ischemia reperfusion injury

<130> 1

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Mus musculus

<400> 1

ggagagtagg caacatgact tgg 23

<210> 2

<211> 23

<212> DNA

<213> Mus musculus

<400> 2

ggtgaaagca gttatcagta ggg 23

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp1-F

<400> 3

agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp1-R

<400> 4

atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50

<210> 5

<211> 52

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp2-F

<400> 5

gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52

<210> 6

<211> 52

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp2-R

<400> 6

ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52

<210> 7

<211> 104

<212> DNA

<213> Artificial Sequence

<220>

<223> Card6-F

<400> 7

ggggtaccgt atagatttgt taaaaatgaa agtagagtag gcaacatgat aacttcgtat 60

agcatacatt atagcaattt atacttggag tgaaccaact cttg 104

<210> 8

<211> 112

<212> DNA

<213> Artificial Sequence

<220>

<223> Card6-R

<400> 8

ataagaatgc ggccgcaccc tgtaggtgtg tgccaccttg cccagccaga ccctacataa 60

attgctataa tgtatgctat acgaagttat tgataactgc tttcacagtt cc 112

<210> 9

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223> upstream primer

<400> 9

agctttgttt aaacgccacc atggctacag agggtgc 37

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> downstream primer

<400> 10

ggactagttt aacgtctccc tgctcttg 28

Claims (1)

1. Application of Card6 protein in preparing medicine for preventing, relieving and/or treating liver ischemia-reperfusion injury.

Images