CN106310225A

CN106310225A - Application of Caspase recruitment domain protein 6 (Card6) in hepatic ischemia reperfusion injury

Info

Publication number: CN106310225A
Application number: CN201610875051.8A
Authority: CN
Inventors: 李红良; 王晓占; 毛文哲
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2016-09-30
Filing date: 2016-09-30
Publication date: 2017-01-11
Anticipated expiration: 2036-09-30
Also published as: CN106310225B

Abstract

The invention discloses an application of Caspase recruitment domain protein 6 (Card6) in hepatic ischemia reperfusion injury and belongs to the field of functions and applications of genes. According to the application, hepatic-cell specific Card6 gene knockout mice and Card6 transgenic mice serve as experimental subjects, functions of a Card6 gene are researched through a hepatic ischemia reperfusion injury model, and the condition that Card6 plays a role in improving the hepatic ischemia reperfusion injury is discovered, so that the Card6 has the applications as follows: an application of the Card6 in screening of drugs for preventing, relieving and/or treating the hepatic ischemia reperfusion injury as a drug target, wherein the screening of the drugs for preventing, relieving and/or treating the hepatic ischemia reperfusion injury means screening the drugs capable of promoting Card6 expression; an application of the Card6 in preparation of drugs for preventing, relieving and/or treating the hepatic ischemia reperfusion injury.

Description

Caspase raises territory albumen 6(Card6) in Ischemia-reperfusion Injury in Rat Application

Technical field

The invention belongs to function and the application of gene, relate to Caspase and raise territory albumen 6(Card6) lack liver The application of blood Reperfusion injury damaging the spleen and stomach, be specifically related to Card6 in screening or preparation prevention, alleviate and/or treat hepatic ischemia/reperfusion injury and fill again Application in note damage medicine.

Background technology

Clinically during hepatotomy, process severe liver trauma and liver transplantation, it usually needs block liver Door blood flow, not only originally ischemia time impaired hepatocyte damage after blood supply is recovered and do not alleviate, the phenomenon increased the weight of occurs on the contrary, It is referred to as hepatic ischemia-reperfusion injury (hepatic ischemia reperfusion injury, HIRI) [1].HIRI can make Liver metabolism, function of detoxification reduce, severe patient causes liver failure, directly influence the prognosis of disease, success rate of operation and Survival.How to alleviate HIRI, be the great difficult problem that faces of current surgery of liver.

HIRI is the pathophysiological process that multifactor participation, a many A signal pathways play a role jointly, its machine of falling ill System illustrates the most completely.HIRI relate to hepatocyte and multiple nonparenchymal cell such as sinusoidal endothelial cell, kupffer cell, Interaction between sternzellen and the inflammatory cell of infiltration, the complement system of activation also assists in wherein [2].Its pathology is special Point is mainly: the activation of (1) kupffer cell, lymphocyte and neutrophilic granulocyte causes hepatic tissue cell impaired；(2) calcium surpasses Load, oxygen-derived free radicals and the release of cytokine and activation cause inflammatory reaction, apoptosis, necrosis；(3) sinusoidal endothelial cell Infringement causes microcirculation disturbance, increases the weight of tissue ischemia further, causes the irreversible lesion [3] such as necrocytosis apoptosis.

From the eighties in last century, people begin look for alleviating the approaches and methods of HIRI, surgical intervention, lack Blood pretreatment, medical preconditioning and Ischemia postconditioning etc. [4] are the most gradually applied to clinic.But up to now, above-mentioned strategy is not yet The HIRI damage problem to liver clinically can be properly settled.Along with going deep into of the field such as molecular biology and technique for gene engineering Research, the preventing and treating that targeted therapy is HIRI for critical function gene relevant for HIRI opens new approach.

Caspase raises territory albumen 6(Caspase recruitment domain protein 6, Card6) be CARD(Caspase recruitment domain protein) one of the important member of family is that the one of latest find exists Inflammation and immunologic process rise the albumen [5] of important regulative, wide expression in the heart of mammal, liver, lung, kidney, In the histoorgans such as skeletal muscle [6,7].Card6 take part in that body is congenital or the signal transduction of multiple receptor in adaptive immunity, Scalable NOD sample receptor (Nod like receptors, NLRs) and Toll-like receptor (Toll like receptors, The expression of the proinflammatory inflammation factor TLRs) relied on, plays an important role [8,9] in the immunne response and inflammatory reaction of body. There are some researches show, Card6 can pass through its Core amino acids domain (Core) and RIP kinase families member's RICK, RIP1 phase Interaction.Separately having research to point out, Card6 expresses in the derived from bone marrow macrophage that β-IFN and γ-IFN induces and raises, may [9] are all played a significant role in pathogen immunoreation, innate immunity and the adaptive immunity regulation of body.HIRI is also One and inflammation and immune closely-related pathological changes, study Card6 function in HIRI pathogenic process, hope that it becomes anti- Control an important potential target spot of HIRI.

List of references:

1. Serracino-Inglott, F., N.A. Habib, and R.T. Mathie, Hepatic ischemia- reperfusion injury. Am J Surg, 2001. 181(2): p. 160-6.

2. Li, A.M., et al., Effects of therapeutic hypercapnia on inflammation and apoptosis after hepatic ischemia-reperfusion injury in rats. Chin Med J (Engl), 2010. 123(16): p. 2254-8.

3. de Rougemont, O., P. Dutkowski, and P.A. Clavien, Biological modulation of liver ischemia-reperfusion injury. Curr Opin Organ Transplant, 2010. 15(2): p. 183-9.

4. Li, J., et al., The mechanisms and strategies to protect from hepatic ischemia-reperfusion injury. Eur Rev Med Pharmacol Sci, 2015. 19(11): p. 2036-47.

5. Li, L., et al., Caspase recruitment domain 6 protects against cardiac hypertrophy in response to pressure overload. Hypertension, 2014. 64(1): p. 94-102.

6. Stehlik, C., et al., Card6 is a modulator of NF-kappa B activation by Nod1-and Cardiak-mediated pathways. J Biol Chem, 2003. 278(34): p. 31941-9.

7. Dufner, A., S. Pownall, and T.W. Mak, Caspase recruitment domain protein 6 is a microtubule-interacting protein that positively modulates NF- kappaB activation. Proc Natl Acad Sci U S A, 2006. 103(4): p. 988-93.

8. Dufner, A. and T.W. Mak, CARD tricks: controlling the interactions of Card6 with RICK and microtubules. Cell Cycle, 2006. 5(8): p. 797-800.

9. Dufner, A., et al., Card6 is interferon inducible but not involved in nucleotide-binding oligomerization domain protein signaling leading to NF- kappaB activation. Mol Cell Biol, 2008. 28(5): p. 1541-52。

Summary of the invention

For solving defect and the deficiency of clinical prevention Ischemia-reperfusion Injury in Rat prior art, it is an object of the invention to really Determine the mutual relation between expression and the Ischemia-reperfusion Injury in Rat of Card6 gene, it is provided that one is used for treating hepatic ischemia and fills The new opplication of the target gene Card6 of note damage, i.e. Card6 prevents, alleviates and/or treats liver as drug targets in screening and lacks Application in the medicine of blood reperfusion injury, and Card6 is used for preventing, alleviating and/or treat law during ischemia/reperfusion in preparation Application in the medicine of damage, and then Card6 gene is applied to the treatment of Ischemia-reperfusion Injury in Rat.

The purpose of the present invention is achieved through the following technical solutions:

The present invention, with hepatocyte specific C ard6 knock out mice and Card6 transgenic mice as experimental subject, is lacked by liver The function of blood reperfusion injury scale-model investigation Card6 gene.Result shows: compared with wild type C57BL/6 mice, and hepatocyte is special Opposite sex Card6 knock out mice hepatic necrosis area substantially increases；Compared with nontransgenic mice, Card6 transgenic mice Hepatic necrosis area then significantly reduce.This prompting Card6 gene has the effect of liver function protecting, anti-in research for Card6 Effect played in the novel targets for the treatment of the liver ischemia and New Policy provides theoretical foundation and Clinical Basis.

The research of the present invention demonstrates: in Ischemia-reperfusion Injury in Rat model, and Card6 has suppression hepatic necrosis, subtracts Few hepatocellular apoptosis, the effect of liver function protecting.

A kind of Card6 gene function in Ischemia-reperfusion Injury in Rat, is mainly reflected in Card6 and has liver function protecting Effect, particularly Card6 has the effect improving Ischemia-reperfusion Injury in Rat.

Improve the function of Ischemia-reperfusion Injury in Rat for Card6, Card6 has a following application:

Card6 as drug targets in screening prevention, alleviate and/or treat the application in the medicine of Ischemia-reperfusion Injury in Rat. This application is the purpose of non-diagnostic and treatment；Described screening prevents, alleviates and/or treat the medicine of Ischemia-reperfusion Injury in Rat Thing, refers to screen the medicine that enough promotion Card6 express.

Card6 application in preparation prevents, alleviates and/or treat the medicine of Ischemia-reperfusion Injury in Rat.

The present invention has such advantages as relative to prior art and effect:

(1) present invention discover that the New function of Card6 gene, i.e. Card6 gene can suppress hepatic tissue ischemical reperfusion injury, and Closely related with hepatocellular apoptosis.

(2) based on Card6 protection hepatic ischemia disease in effect, its may be used for screening or preparation prevention, alleviate and/ Or the medicine for the treatment of hepatic ischemia-reperfusion injury.

Accompanying drawing explanation

Fig. 1 is Card6 in the construction strategy figure of hepatocyte specific C ard6 knock out mice and constructed mouse tissue Expressing quantity testing result figure.A is the construction strategy figure of hepatocyte specific C ard6 knock out mice；B is in tissue The Western Blot testing result figure of Card6 expressing quantity.

Fig. 2 is in the construction strategy figure of hepatocyte specific C ard6 transgenic mice and constructed mouse liver tissue Card6 expressing quantity testing result figure.A is the construction strategy figure of hepatocyte specific C ard6 transgenic mice；B is liver In tissue, (wherein TG1, TG2, TG3, TG4 are different to turn base to the Western Blot testing result figure of Card6 expressing quantity Because of individual mice).

Fig. 3 is the mice downright bad situation comparison diagram at different time points liver.A is that WT and Card6-LKO mice is in difference Time point liver HE colored graph and necrosis area statistics block diagram；B is that NTG and Card6-TG mice is at different time points liver HE Colored graph and necrosis area statistics block diagram (*: P ＜ 0.05 vs WT I/R group；#:P ＜ 0.05 vs NTG I/R group).

Fig. 4 is the mice content statistical figure at different time points serum alt and AST.A is WT and Card6-LKO Mice adds up block diagram at the content of different time points liver serum alt and AST；B is that NTG and Card6-TG mice is in difference Content statistics block diagram (*: the P ＜ 0.05 vs WT Sham group of time point liver serum alt and AST；#:P ＜ 0.05 vs WT/NTG correspondence time point I/R group).

Fig. 5 is mice ischemia column cartogram of TUNEL cell number when Reperfu-sion 24h.A is that WT and Card6-LKO is little Mus is TUNEL immunofluorescence and column cartogram when Reperfu-sion 24h；B is that NTG and Card6-TG mice is when Reperfu-sion 24h TUNEL immunofluorescence and column cartogram (*: P ＜ 0.05 vs WT/NTG I/R group).

Detailed description of the invention

Below in conjunction with embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention do not limit In this.

Animal for research and raising:

Laboratory animal: select 8-10 week old, body weight wild-type mice that 24g-27g, background are male C57BL/6 strain (WT, Purchased from Beijing HFK Bio-Technology Co., Ltd.), hepatocyte specific C ard6 knock out mice (Card6-LKO) And Card6 transgenic mice (Card6-TG) (being built by Wuhan University animal experimental center teacher's Li Hongliang laboratory), non-turn DNA murine (NTG, littermate control nontransgenic mice) is experimental subject.

Feeding environment: all experiment mices are all raised in Wuhan University SPF level Experimental Animal Center.SRF level mouse feed Purchased from Beijing HFK Bio-Technology Co., Ltd..Rearing conditions: room temperature between 22-24 DEG C, humidity 40-70% it Between, light and shade alternately lighting hours is 12h, freely drinks water and ingests.

Embodiment 1 hepatocyte specific C ard6 knock out mice and the structure of Card6 transgenic mice

(1) structure (construction strategy is shown in the A in Fig. 1) of hepatocyte specific C ard6 knock out mice

According to the information of Card6 gene, utilize CRISPR Design respectively in the noncoding region 4 of introne 3 and exon 4 Each target practice site designing a CRISPR, target sequence is respectively as follows:

Card6-sRNA1:GgAGAGTAGGCAACATGACT TGG；

Card6-sRNA2:gGTGAAAGCAGTTATCAGTA GGG.

Additionally devising a donor vehicle (Donor Vector) for homology reparation, it includes both sides homology Arm, middle exon 4 and two loxp sequences in the same direction.

1) structure of targeting vector: respectively two corresponding for sgRNA1 with sgRNA2 primers are fused into double-stranded DNA, then The pUC57-sgRNA(Addgene 51132 processed through restricted enzyme BsaI it is connected into T4 DNA ligase) carrier In.There is a T7 promoter this carrier upstream, may be used for follow-up In vitro transcription.

2) conditionality knock out skeleton carrier pBluescript SK (+) structure of-2loxp:

It is respectively synthesized 4 oligomerization single stranded nucleotide sequence:

Loxp1-F:AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACC GGTGAT；

Loxp1-R:ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGT CA；

Loxp2-F:GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACG CGTA；

Loxp2-R:CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTT AAGG；

Two double-strands of loxp1 and loxp2 are formed after the annealing of above-mentioned oligonucleotide sequence.By pBluescript II SK (+) carrier With HindIII(NEB, R0104L) and EcoRV(NEB, R0195L) connect into loxp1 after double digestion and anneal double-strand, then will order-checking Correct carrier BamHI(NEB, R0136L) and SpeI(NEB, R0133L) double digestion, connect into loxp2 annealing double-strand, Skeleton carrier is knocked out to conditionality, named pBluescript SK (+)-2loxp.

3) structure of donor vehicle (Donor Vector): according to design of primers principle, designs following primer (table 1), with Mice gDNA is template, the left and right homology arm of amplification donor vehicle and the exon part of centre.The product that above-mentioned amplification obtains Thing and pBluescript SK (+)-2loxp carrier through connecting one by one after digestion with restriction enzyme shown in table 1, obtain donor Carrier.

Table 1 builds primer sequence and correspondence restriction enzyme site needed for donor vehicle

Primer	Primer sequence	Restriction enzyme site
			Card6-F	GGGGTACCGTATAGATTTGTTAAAAATGAAAGTAGAGTAGGCAACATGATAACT TCGTATAGCATACATTATAGCAATTTATACTTGGAGTGAACCAACTCTTG	KpnI
Card6-R	ATAAGAATGCGGCCGCACCCTGTAGGTGTGTGCCACCTTGCCCAGCCAGACCCT ACATAAATTGCTATAATGTATGCTATACGAAGTTATTGATAACTGCTTTCACAG TTCC	NotI

4) the transcribing of targeting vector: two parts that CRIPR/Cas9 system is comprised (be responsible for dissection Cas9 albumen and Guide Cas9 protein localization to the gRNA of target site) transcribe respectively.For Cas9 albumen, by its expression vector pST1374- Cas9(Addgene 44758) carry out enzyme action with PmeI, to reclaim linearization plasmid after purification as transcription templates, use T7 MMESSAGE mMACHINE test kit (AM1345, Ambion) carries out in vitro transcription, it is thus achieved that the mRNA product capped.And use Poly (A) Tailing test kit (Ambion) is to above-mentioned product tailing, it is thus achieved that ripe mRNA product；For sgRNA, use MEGAshortscript Kit(AM1354, Ambion company) carry out in vitro transcription.To transcribe Cas9's and sgRNA that obtain MRNA uses miRNeasy Micro Kit(Qiagen, and 217084) it is purified.

5) making of Card6-floxed conditionality knock-out mice

The mRNA product of above-mentioned maturation and donor vehicle are together injected in mouse fertilized egg, carries out in being transplanted to replace-conceive rat body Cultivate.The mice obtained is identified.Take out the mice toe after raw a week or tail tissue, extract genome, and pass through PCR The positive head of method screening builds Mus.From determining the mice that homologous recombination occurs that random choose one is only used as F0 generation and carries out follow-up numerous Grow, final acquisition Card6-floxed Mice homozygous.

6) making of hepatocyte specific C ard6 knock out mice

By above-mentioned Card6-floxed mice with liver specificity Alb-Cre(purchased from The Jackson Laboratory, article No. 003574) transgenic mice copulation, screening obtains Card6^{floxed/floxed}/ Alb-Cre mice, treats that this mice length is left to 6 week old Behind the right side, lumbar injection Tamoxifen, the expression of induction Cre enzyme, two loxp in the same direction of the identification of Cre enzyme spcificity, and excise Sequence between the two and one of them loxp, finally obtain hepatocyte specific C ard6 knock out mice.

By western blotting (Western Blot) experiment detection hepatocyte specific C ard6 knock out mice liver The expression of dirty middle Card6 albumen.Extract liver, heart, cerebral tissue, renal tissue albumen, by polyacrylamide gel electricity Swimming (SDS-PAGE), checking Card6 expresses, and result is shown in the B in Fig. 1.In mouse heart, brain, renal tissue, WT type mice and Knock out mice Card6 protein expression changes of contents is little；And in liver organization, compared to WT type mice, gene knockout Mice Card6 protein expression content substantially reduces.

(2) structure (construction strategy is shown in the A in Fig. 2) of hepatocyte specific C ard6 transgenic mice

With wild type C57BL/6 mice Card6 gene cDNA as template, with forward primer (5 '-AGCTTTGTTTAAACGCCACC ATGGCTACAGAGGGTGC-3 '), downstream primer (5 '-GGACTAGTTTAACGTCTCCCTGCTCTTG-3 ') amplification mice Card6 gene (NCBI, Gene ID:239319, NM_001163138.1), the product that amplification is obtained and pCAG-CAT- (Union Medical College basis, Beijing institute teacher's Yang Qinglin laboratory provides LacZ carrier, and preparation process sees list of references: Kim T, Zhelyabovska O, Liu J, et al. Generation of an Inducible, Cardiomyocyte- Specific Transgenic Mouse Model with PPAR b/d Overexpression[J]. Peroxisome Proliferator-Activated Receptors (PPARs), 57.) use restricted enzyme PmeI(NEB, R0560L) And SpeI(NEB, R0133L) connect after enzyme action, obtain transgene carrier pCAG-loxP-CAT-loxP-Card6-hGHpA, The expression of Card6 is obtained by CAG promoters driven.The carrier of structure is configured to fertilized embryo (C57BL/ by microinjection 6J background), obtain Card6-floxed transgenic mice.Hepatocyte specific C ard6 transgenic mice is by Card6-floxed Transgenic mice and Alb-Cre(are purchased from The Jackson Laboratory, article No. 003574) mouse hybrid breeding obtains.

By Card6 albumen in western blotting (Western Blot) the different transgenic mice liver of experiment detection Expression.Extract different transgenic mice liver organization albumen, by polyacrylamide gel electrophoresis (SDS-PAGE), checking Card6 process LAN, result is shown in the B in Fig. 2.In different transgenic mice bodies, Card6 protein expression content is relative to NTG mice Have and improve in various degree.

Obtaining of embodiment 2 Mouse Liver ischemical reperfusion injury (ischemia/reperfusion injury, I/R) model ?

(1) laboratory animal packet: male C57BL/6 strain wild-type mice, hepatocyte specific C ard6 knock out mice and Card6 transgenic mice, nontransgenic mice, set up Ischemia-reperfusion Injury in Rat model by hepatic ischemia reperfusion (I/R). It is randomly divided into 8 groups: C57BL/6J strain wild-type mice sham operated rats (WT Sham) and I/R operation group (WT I/R), hepatocyte Specific C ard6 knock out mice sham operated rats (LKO Sham) and I/R operation group (LKO I/R), nontransgenic mice vacation Operation group (NTG Sham) and I/R operation group (NTG I/R), Card6 transgenic mice sham operated rats (TG Sham) and I/R hands Art group (TG I/R).

(2) Ischemia-reperfusion Injury in Rat I/R model surgery (use noinvasive vascular clamp folder close middle period and lobus sinister portal vein and Hepatic artery, makes the hepatic ischemia/reperfusion injury of about 70%) operating process:

1) operation consent 12h is to mice fasting, can freely drink water.

2) operation consent is with after 3% pentobarbital sodium success anesthetized mice, is put down sleeping fixed limb, with shaver by mice Abdominal part art district hair shaves, and sterilizes art district with 10% iodine tincture and 75% ethanol.

3) take median abdominal incision and enter abdomen, expose a liver left side, the hepatic pedicle in middle period.

4) close middle period and the portal vein of lobus sinister and Hepatic artery with noinvasive vascular clamp folder, make the hepatic ischemia/reperfusion injury of about 70%, to prevent There is serious mesenteric vein congestion.After 0.5min, compared with non-blacked lobus dexter, it is seen that block leaf and bleach, illustrate to block into Merit.Now, noting recording the ischemia time started, maintain ischemia about 60 minutes, period covers otch with wet saline gauze, and notes The insulation (mice of Sham group removes vascular clamp the most at once blocking, recovery ischemia hepatic blood flow) of meaning mice.

5) ischemia removes vascular clamp after 60 minutes, recovers the liver blood flow of ischemia, is then shut off abdominal cavity, and point two-layer closes abdomen, First internal layer is sewed it up, then stitch skin, postoperative mice is placed in clean cage and individually raises, observe.

Embodiment 3 hepatic necrosis area and the mensuration of liver function index (AST, ALT)

The evaluation index of the hepatic ischemia-reperfusion injury order of severity mainly include hepatic necrosis area and liver function index (AST, ALT), these indexs all with hepatic ischemia-reperfusion injury order of severity positive correlation.

(1) draw materials

Sham operated rats (Sham) and ischemia-reperfusion group mice is taken, at cervical dislocation respectively at postoperative 1h, 3h, 6h, 12h, 24h Extremely, take blood 1mL from postcava immediately, separate serum.Unification simultaneously takes ischemic region leftlobe of liver tissue size about 1.5cm × 1cm × 0.2cm is dehydrated after fixing 24h in 10% neutral formalin, and embedding carries out HE dyeing after carrying out paraffin section.

Separate serum: the EP pipe standing 1-2h at room temperature collecting blood makes blood natural coagulation.4℃、4000rpm/min Centrifugal 30min, is sufficiently separated serum.Draw serum 20 μ L, 20 μ L, 30 μ L respectively with micropipettor, that 30 μ L set to 0 .2mL is aseptic In EP pipe, EP pipe is marked, is stored in-80 DEG C of refrigerators subsequently standby.

(2) paraffin specimen section is prepared

1) primary operational program includes: embedding frame process → flowing water flushing → dehydration → transparent → waxdip → embedding → section → stand After sheet → dry or toast standby.

2) paraffin section of 5 μm is cut by the standardization program of paraffin slicing machine standby.

(3) HE dyeing

Mainly comprise the following steps: 55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% ethanol 1min → 95% ethanol 1min → 70% Ethanol 1min → distilled water 1min → haematoxylin solution 5min → washing 1min → 1% hydrochloride alcohol 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, magnesium sulfate 2g, distilled water 100mL) 1min → washing 1min → Yihong solution 3-5min → steaming Distilled water washes away loose colour → 70% ethanol 1s → 95% ethanol 1s → 100% ethanol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of dimethylbenzene Drying up in the most dry mounting → fume hood immediately, microscope is taken pictures.

(4) mice serum ALT, AST assay

1) from-80 DEG C of refrigerators, take out serum sample, be immediately placed on ice, at room temperature treat that sample melts；

2) at room temperature, 4000 revs/min are centrifuged 1 minute, allow the serum of EP tube wall assemble at the bottom of pipe.

3) according to operating process, open automatic clinical chemistry analyzer (Sysmex, Chemix 180i), clean sample injector.

4) according to the flag sequence of automatic clinical chemistry analyzer specimen disc, EP pipe to be measured is put into one by one.

5) reagent detection dish is accurately installed, begins to use automatic clinical chemistry analyzer to detect ALT, AST level.

WT and Card6-LKO group HE coloration result after hepatic ischemia-reperfusion injury is shown under the A in Fig. 3: microscope Visible Sham group hepatic tissue is normal, and hepatic tissue structure is neat, without obvious proliferation of fibrous tissue.I/R group is along with Reperfu-sion The prolongation of time, hepatic tissue structural fuzzy, arrangement disorder.Differ in size in it, necrosis region in irregular shape, necrosis region Interior hepatocyte structural fuzzy, arrangement disorder, detachment, compare with normal liver, in the lobules of liver of necrotic liver, see large stretch of necrosis region, Inflammatory reaction band seen from slough edge, there is typical downright bad change in liver cell nuclear, it is seen that karyopycnosis.This phenomenon is lacking After blood Reperfu-sion, 24h peaks.Test result indicate that, give the infarct size after Card6-LKO mice I/R and be significantly greater than WT Group mice (A in Fig. 3)；Contrary, the infarct size after Card6-TG mice I/R is significantly less than NTG group mice (in Fig. 3 B), therefore, Card6 plays an important role in the damage that hepatic ischemia reperfusion causes.

Fig. 4 is shown in the content statistical result of serum alt and AST.Result shows in I/R group each time point ALT, AST level Obviously higher than Sham group, after Reperfu-sion, 6h peaks, and declines subsequently, ALT, AST water after Card6-LKO mice I/R Flat apparently higher than WT group mice (A in Fig. 4)；ALT, AST level after Card6-TG mice I/R is substantially less than NTG group mice (B in Fig. 4).

After embodiment 4 ischemia-reperfusion, hepatocellular apoptosis situation measures

With TUNEL test kit dyeing detection apoptosis, TUNEL test kit: ApopTag Plus In Situ Apoptosis Fluorescein Detection Kit (S7111, Chemicon).Detailed process is:

1) paraffin section is placed in baking box, 60 DEG C of roasting sheets 30 minutes；

2) dimethylbenzene, 5 minutes × 3 times；

3) 100% ethanol, 5 minutes × 2 times；95% ethanol, 5 minutes；70% ethanol, 5 minutes；

4) ddH₂O rinses, 5 minutes × 2 times；

5) E.C. 3.4.21.64 37 DEG C hatches 15 minutes；

6) PBS rinses 5min × 2 time；

7) Equilibration Buffer is directly dripped in tissue (13 μ L/cm²), incubated at room at least 10s；

8) discard Equilibration Buffer, drip TdT Enzyme working solution (77 μ L Reaction Buffer+33 μ L TdT Enzyme) in tissue (11 μ L/cm²), put wet box and hatch 1h in 37 DEG C；

9) section is placed in fills Stop/Wash Buffer working solution (1mL Stop/Wash Buffer+34mL ddH₂O) In color jar after vibration 15s in incubated at room 10min(waiting process, by the Anti-Digoxigenin of appropriate amount Conjugate sucking-off, as in EP pipe, lucifuge is placed at room temperature so that it is balance is to room temperature)；

10) PBS rinses 1min × 3 time；

11) get rid of the liquid of tissue excessive residual gently, tissue surrounding liquid is inhaled 3 dropping Anti-Digoxigenin Fluorescein working solution (53%Blocking Solution+ 47%Anti-Digoxigenin Conjugate) is in tissue Upper (13 μ L/cm²), put room temperature lucifuge in wet box and hatch 30min；

12) PBS rinsing 2min × 4 time (PBS every time renewed)；

13) SlowFade Gold antifade reagent with DAPI(Invitrogen, S36939) mounting；Cryptoscope Lower observation, takes pictures.If needing to preserve, 4 DEG C of preservations in dark wet box.

Have detected postoperative 24 hours hepatocellular apoptosis situations of each group of mice I/R, result such as Fig. 5 institute by TUNEL test kit Showing, Card6-LKO mouse liver cell apoptosis quantity substantially increases (A in Fig. 5) than wild-type mice, Card6-TG Mouse Liver Apoptosis quantity substantially reduces (B in Fig. 5) than nontransgenic mice, when this shows Card6 and hepatocyte ischemia-reperfusion Apoptosis is correlated with.These results indicate that Card6 process LAN can reduce hepatic tissue ischemical reperfusion injury, and and hepatocellular apoptosis Closely related.

The above results shows, Card6 transgenic mice is in the damage that hepatic ischemia reperfusion causes, and mouse liver is downright bad Area substantially reduces, and liver function is obviously improved, and hepatocellular apoptosis quantity also significantly reduces.Prove that Card6 gene is at hepatic ischemia/reperfusion injury Disease model has important protective effect.

Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention are not by above-described embodiment Limit, the change made under other any spirit without departing from the present invention and principle, modify, substitute, combine, simplify, All should be the substitute mode of equivalence, within being included in protection scope of the present invention.

SEQUENCE LISTING

<110>Wuhan University

<120>Caspase raises territory albumen 6(Card6) application in Ischemia-reperfusion Injury in Rat

<130> 1

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 23

<212> DNA

<213> Mus musculus

<400> 1

ggagagtagg caacatgact tgg 23

<210> 2

<211> 23

<212> DNA

<213> Mus musculus

<400> 2

ggtgaaagca gttatcagta ggg 23

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp1-F

<400> 3

agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp1-R

<400> 4

atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50

<210> 5

<211> 52

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp2-F

<400> 5

gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52

<210> 6

<211> 52

<212> DNA

<213> Artificial Sequence

<220>

<223> loxp2-R

<400> 6

ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52

<210> 7

<211> 104

<212> DNA

<213> Artificial Sequence

<220>

<223> Card6-F

<400> 7

ggggtaccgt atagatttgt taaaaatgaa agtagagtag gcaacatgat aacttcgtat 60

agcatacatt atagcaattt atacttggag tgaaccaact cttg 104

<210> 8

<211> 112

<212> DNA

<213> Artificial Sequence

<220>

<223> Card6-R

<400> 8

ataagaatgc ggccgcaccc tgtaggtgtg tgccaccttg cccagccaga ccctacataa 60

attgctataa tgtatgctat acgaagttat tgataactgc tttcacagtt cc 112

<210> 9

<211> 37

<212> DNA

<213> Artificial Sequence

<220>

<223>forward primer

<400> 9

agctttgttt aaacgccacc atggctacag agggtgc 37

<210> 10

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223>downstream primer

<400> 10

ggactagttt aacgtctccc tgctcttg 28

Claims

1.Card6 is as drug targets answering in screening prevents, alleviates and/or treat the medicine of Ischemia-reperfusion Injury in Rat With, it is characterised in that: described application is the purpose of non-diagnostic and treatment；Described screening prevents, alleviates and/or treats liver and lacks The medicine of blood reperfusion injury, refers to screen the medicine that enough promotion Card6 express.

2.Card6 application in preparation prevents, alleviates and/or treat the medicine of Ischemia-reperfusion Injury in Rat.