CN106620722A - Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury - Google Patents

Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury Download PDF

Info

Publication number
CN106620722A
CN106620722A CN201610873155.5A CN201610873155A CN106620722A CN 106620722 A CN106620722 A CN 106620722A CN 201610873155 A CN201610873155 A CN 201610873155A CN 106620722 A CN106620722 A CN 106620722A
Authority
CN
China
Prior art keywords
traf5
reperfusion injury
liver
ischemia reperfusion
mouse
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610873155.5A
Other languages
Chinese (zh)
Inventor
李红良
王晓占
毛文哲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan University WHU
Original Assignee
Wuhan University WHU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan University WHU filed Critical Wuhan University WHU
Priority to CN201610873155.5A priority Critical patent/CN106620722A/en
Publication of CN106620722A publication Critical patent/CN106620722A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K49/00—Preparations for testing in vivo
    • A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
    • A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
    • C12Q1/52—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving transaminase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pathology (AREA)
  • Epidemiology (AREA)
  • Toxicology (AREA)
  • Analytical Chemistry (AREA)
  • Rheumatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Endocrinology (AREA)
  • Diabetes (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses an application of a TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury, and belongs to the field of gene functions and applications. Liver cell specific Traf5 gene knock-out mice and Traf5 transgenic mice serve as experimental objects, functions of Traf5 genes are researched by an ischemia reperfusion injury model, and the Traf5 has the function of improving ischemia reperfusion injury according to discovery, so that the Traf5 has the following applications: an application of the Traf5 serving as a drug target to screening of drugs for preventing, relieving and/or treating ischemia reperfusion injury; an application of the Traf5 to preparation of the drugs for preventing, relieving and/or treating ischemia reperfusion injury, wherein screening of the drugs for preventing, relieving and/or treating ischemia reperfusion injury refers to screening of drugs capable of promoting Traf5 expression.

Description

TNF receptor associated factors 5（Traf5）Application in Ischemia-reperfusion Injury in Rat
Technical field
The invention belongs to the function and application of gene, are related to TNF receptor associated factors 5（Traf5）In hepatic ischemia again Application in perfusion injury, and in particular to Traf5 is in screening or prepares prevention, alleviate and/or treat Ischemia-reperfusion Injury in Rat Application in medicine.
Background technology
Hepatic ischemia-reperfusion injury（Ischemia reperfusion injury, IRI）Be in liver surgery or In person's liver transplant, because liver blood flow blocking or the ECP of liver donor cause hepatic ischemia/reperfusion injury, when Hepatic Perfusion it is extensive After multiple, hepar damnification is caused to increase even handicapped pathological processes[1].Liver IR is one and is related to various kinds of cell class The complex process of type and different pathway molecule media.Cellular damage can occur in ischemic stage, during may also occur at Reperfu- sion, most Cause cell death by Apoptosis and necrosis eventually.The blood flow of supply liver interrupts at normal body temperature（Such as hepatectomize） When, Warm ischemia injury can be produced；Cooling jet flow is produced in liver transplantation cold-penetration note and then during preserving to damage[2].Cause hepatic ischemia The mechanism of reperfusion injury is more complicated, and research shows, the activation of Kupffer cells, oxidative stress and inflammatory cells letter Activation of number path etc. has been involved in this pathophysiological process[3]。
Liver IRI clinically often shows as the infringement of liver function, and incidence of complications and the death rate increase；Liver It is also one of target organ of many Cytokines as the major organs for producing cell factor in vivo, liver IRI can be serious Liver postoperative function is affected, is the key reason for inducing dyshepatia and hepatic failure[4], and then there is multiple organ dysfunction Cascade reaction；The research of mechanism and its precautionary measures with regard to hepatic ischemia-reperfusion injury, for sending out for reduction liver IRI Degree that is raw or mitigating IRI, reduces the complication of operation on liver, improves liver transfer operation success rate, promotes the recovery of postoperative liver function, With important clinical meaning；Further seek the mechanism of IRI and and develop more targeted prophylactico-therapeutic measures accordingly Vital effect will be played to the development of following surgery of liver.
TNF（TNF）Receptor associated factor (tumor necrosis factor receptor- Associated factor, Traf) it is intracellular important signal conductive protein, it can be with various TNFR and IL-1R/TLR Family member combines, and participates in adjusting the activation of the multi-signal Signal Transduction Pathways such as NF- κ B and JNK, and with adjusting, normal and tumour is thin The propagation of born of the same parents, survival, apoptosis, participate in inflammatory reaction, inducing endothelial cell and the several functions such as sprout[5].In mammal body at present 7 Traf family members are found altogether, are respectively Traf1-7.C-terminal characteristic knots of the TRAF comprising about 230 amino acid Structure domain, mediation Traf albumen forms homologous or heterodimer or with reference to other adapter molecules and signal transducers.Except Traf1 Outward, Traf2-7 also includes a highly conserved N-terminal ring structure domain（RING finger domain）.Traf5 is Traf One kind in family member.The result of study of the past shows that Traf5 can mediate CD30, CD40, LT- β R, LMP-1, Fn14 etc. Signal transduction, by activating the signal transduction pathway such as NF- κ B and JNK, play inhibited apoptosis, to participate in inflammatory reaction etc. more Plant function.Traf5 expression is wide, and height is expressed in lung, and moderate is expressed in spleen, thymus gland, kidney, but water during other are organized in mammary gland etc. It is flat very low[6].Recent studies have shown that Traf5 in IBI[7], inflammatory bowel disease[8]In play an important role； Traf5 can affect the myocardial hypertrophy that arch of aorta constriction causes to develop by MEK-ERK signal paths[9].At present, Traf5 Effect in hepatic ischemia-reperfusion injury is not clear.
Bibliography：
1. Kapoor S. Hepatic ischemia-reperfusion injury from bench to bedside (Br J Surg 2010; 97: 1461-1475). Br J Surg. 2011; 98(3):459, 459-460.
2. Abu-Amara M, Yang SY, Tapuria N, et al. Liver ischemia/reperfusion injury: processes in flammatory networks-a review. Liver Transpl, 2010, 16 (9):1016-1032.
3. Massip-Salcedo M, Rosello-Catafau J, Prieto J, et al. The response of the hepatocyte to ischemia. Liver Int. 2007; 27(1):6-16.
4. Orci LA, Toso C, Mentha G, et a1. Systematic review and meta-analysis of the effect of perioperative steroids on ischemia reperfusion injury and Surgical stress response in patients undergoing liver resection.Br J Surg, 2013, 100(5): 600-609.
5. Aggarwal BB. Tumour necrosis factors receptor associated signaling molecules and their role in activation of apoptosis, JNK and NF-κB. Ann Rheum Dis, 2000, 59(suppl I):i6-i16.
6. Zapata JM, Krajewska M, Krajewski S, et al. TNFR-associated factor family protein expression in normal tissues and lymphoid malignancies. J Immunol, 2000, 165(9):5084-5096.
7. Wang L, Lu Y, Guan H, et al. Tumor necrosis factor receptor-associated factor 5 is an essential mediator of ischemic brain infarction. J Neurochem, 2013, 126 (3):400-144.
8. Shen J, Qiao YQ, Ran ZH, et al. Up-regulation and pre-activation of TRAF3 and Traf5 in inflammatory bowel disease. Int J Med Sci, 2013, 10 (2): 156-163.
9. Bian Z et al. Disruption of tumor necrosis factor receptor as factor 5 exacerbates pressure overload cardiac hypertrophy and fibrosis. J Cell Biochem, 2014, 115(2):349-358。
The content of the invention
To solve the defect and deficiency of clinical prevention Ischemia-reperfusion Injury in Rat prior art, it is an object of the invention to really Determine the correlation between the expression of Traf5 genes and Ischemia-reperfusion Injury in Rat, there is provided one kind is filled again for treating hepatic ischemia The new opplication of the target gene Traf5 that note is damaged, i.e. Traf5 is used as drug targets are in screening prevention, alleviation and/or treat hepatic ischemia Application in the medicine of reperfusion injury, and Traf5 prepare for prevent, alleviate and/or treat law during ischemia/reperfusion damage Application in the medicine of wound, and then Traf5 genes are applied to the treatment of hepatic ischemia disease.
The purpose of the present invention is achieved through the following technical solutions：
The present invention is lacked with liver cell specificity T raf5 knock out mice and Traf5 transgenic mices as experimental subjects by liver The function of blood reperfusion injury scale-model investigation Traf5 genes.As a result show：Compared with wild type C57BL/6 mouse, liver cell is special Different in nature Traf5 knock out mice hepatic necrosis area substantially increases；Compared with nontransgenic mice, Traf5 transgenic mices Hepatic necrosis area be then obviously reduced.This prompting Traf5 gene has the effect of liver function protecting, is that research Traf5 is preventing Control the effect played in the novel targets and New Policy of hepatic ischemia and provide theoretical foundation and Clinical Basis.
The research of the present invention is demonstrated：In Ischemia-reperfusion Injury in Rat model, Traf5 has suppression hepatic necrosis, subtracts Few hepatocellular apoptosis, the effect of liver function protecting.
A kind of function of Traf5 genes in Ischemia-reperfusion Injury in Rat, is mainly reflected in Traf5 and has liver function protecting Effect, particularly Traf5 has improves the effect of Ischemia-reperfusion Injury in Rat.
Improve the function of Ischemia-reperfusion Injury in Rat for Traf5, Traf5 has following application：
Applications of the Traf5 as drug targets in screening prevention, the medicine alleviated and/or treat Ischemia-reperfusion Injury in Rat. The application is the purpose of non-diagnostic and treatment；The medicine of described screening prevention, alleviation and/or treatment Ischemia-reperfusion Injury in Rat Thing, refers to that screening enough promotes the medicine of Traf5 gene expressions.
The present invention has the following advantages and effect relative to prior art：
（1）Present invention discover that the New function of Traf5 genes, i.e. Traf5 genes can suppress hepatic tissue ischemical reperfusion injury, and It is closely related with hepatocellular apoptosis.
（2）Based on effects of the Traf5 in hepatic tissue ischemical reperfusion injury is suppressed, it can be used for screening or preparing in advance Medicine that is anti-, alleviating and/or treat Ischemia-reperfusion Injury in Rat.
Description of the drawings
Fig. 1 liver cells specificity T raf5 knock out mice and Traf5 transgenic mice construction strategy figures.A is liver The construction strategy figure of cell-specific Traf5 knock out mice；B is the structure of liver cell specificity T raf5 transgenic mices Build policy map.
Fig. 2 is Western Blot detection liver cell specificity T raf5 knock out mice and Traf5 transgenic mice groups Knit the result figure of middle Traf5 expressions.A is the testing result figure of liver cell specificity T raf5 knock out mice；B is that liver is thin The testing result figure of born of the same parents' specificity T raf5 transgenic mices（TG1, TG2, TG3, TG4 are that different transgenic mices are individual）.
Fig. 3 is downright bad situation comparison diagram of the mouse in different time points liver.A is WT and Traf5-KO mouse in difference Between put liver HE colored graphs and necrosis area statistics block diagram；B is that NTG and Traf5-TG mouse contaminate in different time points liver HE Chromatic graph and necrosis area statistics block diagram（#：The vs WT/NTG I/R groups of P ＜ 0.05）.
Fig. 4 mouse are in different time points serum alt and the content statistical comparison figure of AST.A is WT and Traf5-KO mouse Block diagram is counted in the content of different time points liver serum alt and AST；B is NTG and Traf5-TG mouse in different time The content statistics block diagram of point liver serum alt and AST（*：The vs WT/NYG Sham groups of P ＜ 0.05；#：The vs of P ＜ 0.05 WT/NTG I/R groups）.
The column statistical chart of Fig. 5 mouse ischemic TUNEL cell numbers in Reperfu- sion 24h.A exists for WT and Traf5-KO mouse TUNEL immunofluorescences column statistical chart during Reperfu- sion 24h；B is that NTG and Traf5-TG mouse TUNEL in Reperfu- sion 24h is immune Fluorescence column statistical chart（#：The vs WT/NTG I/R groups of P ＜ 0.05）.
Specific embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are not limited In this.
Animal for research and raising：
Animal used as test：From 8-10 week old, body weight in the wild-type mice that 24g-27g, background are male C57BL/6 strains（WT, Purchased from Beijing HFK Bio-Technology Co., Ltd.）, liver cell specificity T raf5 knock out mice and Traf5 turn base Because of mouse（Built by Wuhan University animal experimental center teacher Li Hongliang laboratory）, and nontransgenic mice（NTG is brood right According to nontransgenic mice）For experimental subjects.
Feeding environment：All experiment mices are raised in Wuhan University SPF level Experimental Animal Centers.SRF level mouse feeds Purchased from Beijing HFK Bio-Technology Co., Ltd..Rearing conditions：Room temperature between 22-24 DEG C, humidity 40-70% it Between, it is 12h that light and shade replaces lighting hours, and free water is ingested.
The structure of the liver cell specificity T raf5 knock out mice of embodiment 1 and Traf5 transgenic mices
（1）The structure of liver cell specificity T raf5 knock out mice（Construction strategy is shown in Figure 1A）
According to the information of Traf5 genes, using CRISPR Design each one CRISPR of design in introne 2 and 3 respectively Target practice site.Target sequence is respectively：
Traf5-sRNA1：GgAGGCTGTAGTACAGTGTGACGGC CGG；
Traf5-sRNA2：gGTTTTAAGGGTTATCTAGACTAGA AGG.
In addition have also been devised a donor vehicle for homologous reparation（Donor Vector）, it includes that both sides are homologous Arm, middle exon 3 and two loxp sequences in the same direction.
1）The structure of targeting vector：Respectively corresponding two primers of sgRNA1 and sgRNA2 are fused into into double-stranded DNA, then The pUC57-sgRNA processed through restriction enzyme BsaI is connected into T4 DNA ligases（Addgene 51132）Carrier In.There is a T7 promoter carrier upstream, can be used for follow-up In vitro transcription.
2）Conditionity knocks out the structure of skeleton carrier pBluescript SK (+) -2loxp：
It is respectively synthesized 4 oligomerization single stranded nucleotide sequences：
loxp1-F：AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACCGGTGAT；
loxp1-R：ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGTCA；
loxp2-F：GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACGCGTA；
loxp2-R：CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTTAAGG；
Two double-strands of loxp1 and loxp2 are formed after above-mentioned oligonucleotide sequence annealing.By pBluescript II SK (+) carriers Use HindIII（NEB, R0104L）And EcoRV（NEB, R0195L）Connect after double digestion into loxp1 annealing double-strands, then will sequencing Correct carrier BamHI（NEB, R0136L）And SpeI（NEB, R0133L）Double digestion, connects into loxp2 annealing double-strands, obtains Skeleton carrier is knocked out to conditionity, pBluescript SK (+) -2loxp are named as.
3）Donor vehicle（Donor Vector）Structure：According to design of primers principle, following primer is designed（Table 1）, with Mouse gDNA is template, expands the left and right homology arm of donor vehicle（LA and RA）And the extron part of centre（M）.Above-mentioned expansion The product and pBluescript SK (+) -2loxp carriers that increasing is obtained connects one by one Jing after digestion with restriction enzyme shown in table 1 Connect, obtain donor vehicle.
Table 1 builds primer sequence needed for donor vehicle and correspondence restriction enzyme site
Primer Primer sequence Restriction enzyme site
Traf5 LA-F tcgagCTCCAGTAAGCTCTAGGTTCTAAAGGTGAAGAACCCGGCCgacgt XhoI
Traf5 LA-R CGGCCGGGTTCTTCACCTTTAGAACCTAGAGCTTACTGGAGC AatII
Traf5 M-F CCGGAATTCGTCACACTGTACTACAGCCTGC EcoRI
Traf5 M-R CGGGATCCAGAAGGTCAACCCCCACCA BamHI
Traf5 RA-F cgcgtAGTCTAGATAACCCTTAAAACATTGTTCTGTTTAATGACAgc MluI
Traf5 RA-R ggccgcTGTCATTAAACAGAACAATGTTTTAAGGGTTATCTAGACTa NotI
4）The transcription of targeting vector：Two parts that CRIPR/Cas9 systems are included（The Cas9 albumen of responsible dissection and Guiding Cas9 albumen navigates to the gRNA of target site）Transcribed respectively.For Cas9 albumen, by its expression vector pST1374- Cas9（Addgene 44758）Digestion is carried out with PmeI, to reclaim linearization plasmid after purification as transcription templates, T7 is used MMESSAGE mMACHINE kits（AM1345, Ambion company）In-vitro transcription is carried out, the mRNA products for capping are obtained.And With Poly (A) Tailing kits（Ambion companies）To above-mentioned product tailing, ripe mRNA products are obtained；For SgRNA, using MEGAshortscript Kit（AM1354, Ambion company）Carry out in-vitro transcription.Transcription is obtained The mRNA of Cas9 and sgRNA uses miRNeasy Micro Kit（Qiagen, 217084）Purified.
5）The making of Traf5-floxed conditionity knock-out mices
Above-mentioned ripe mRNA products are together injected in mouse fertilized egg with donor vehicle, being transplanted in replace-conceive dams body is carried out Cultivate.The mouse for obtaining is identified.Mouse toe or tail tissue after taking-up is raw one week, extracts genome, and by PCR Method screening positive head builds mouse.From determine select at random in the mouse that homologous recombination occurs one be only used as F0 generations carry out it is follow-up numerous Grow, it is final to obtain Traf5-floxed Mice homozygous.
6）The making of liver cell specificity T raf5 knock out mice
By above-mentioned Traf5-floxed mouse and liver specificity Alb-Cre（Purchased from The Jackson Laboratory, article No. 003574）Transgenic mice mates, and screening obtains Traf5floxed/floxed/ Alb-Cre mouse, treat that the mouse length is left to 6 week old Behind the right side, lumbar injection Tamoxifen induces the expression of Cre enzymes, two loxp in the same direction of identification of Cre enzyme spcificitys, and cuts off Sequence between the two and one of loxp, finally obtain liver cell specificity T raf5 knock out mice.
By immunoblotting（Western Blot）Experiment detection liver cell specificity T raf5 knock out mice livers The expression of dirty middle Traf5 albumen.Liver, heart, brain tissue, renal tissue albumen and Hepatocyte are extracted, by poly- Acrylamide gel electrophoresis（SDS-PAGE）, Mincle expression is verified, as a result see Fig. 2A.In mouse heart, brain, renal tissue In, WT types mouse and knock out mice Traf5 protein expression changes of contents it is little；And in liver organization, compared to WT types Mouse, knock out mice Traf5 protein expression contents are substantially reduced, and Traf5 albumen is hardly expressed in liver cell.
（2）The structure of liver cell specificity T raf5 transgenic mices（Construction strategy is shown in Figure 1B）：
For further research Traf5 overexpression, for the impact of hepatic ischemia-reperfusion injury, the present invention constructs several plants of Traf5 Transgenic mice（Traf5-TG）.With wild type C57BL/6 mouse Traf5 gene cDNAs template, upstream primer is used（5’- AGCTTTGTTTAAACGCCACCATGGCTCATTCGGAGGAGCA-3’）, downstream primer（5’- CTAGCTAGCCTACAGATCCTCCAAGTCAGTTAAATCC-3’）Amplification mouse Traf5 genes（NCBI, Gene ID： 22033, NM_011633.2）, the product that amplification is obtained and pCAG-CAT-LacZ carriers（Beijing Union Medical College basis Institute teacher Yang Qinglin laboratory, preparation process is referring to bibliography：Kim T, Zhelyabovska O, Liu J, et al. Generation of an Inducible, Cardiomyocyte-Speci fi c Transgenic Mouse Model with PPAR b/d Overexpression[J]. Peroxisome Proliferator-Activated Receptors (PPARs), 57.）Use PmeI（NEB, # R0560L）And NheI（NEB, # R0131L）Connect after double digestion, obtain To transgene carrier pCAG-loxP-CAT-loxP- Traf5-hGHpA, the expression of Traf5 is obtained by CAG promoters drivens.Will The carrier of structure is configured to fertilized embryo by microinjection（C57BL/6J backgrounds）, obtain Traf5-floxed transgenosis little Mouse.Liver cell specificity T raf5 transgenic mices are by Traf5-floxed transgenic mices and Alb-Cre（Purchased from The Jackson Laboratory, article No. 003574）Mouse hybrid breeding is obtained.
By immunoblotting（Western Blot）Traf5 albumen in the different transgenic mice livers of experiment detection Expression.Different transgenic mice liver organization albumen are extracted, by polyacrylamide gel electrophoresis（SDS-PAGE）, checking Traf5 overexpression, is as a result shown in Fig. 2 B.Compared to wild-type mice, in liver cell specificity T raf5 transgenic mice liver organizations Traf5 protein expression contents are significantly improved.
The Mouse Liver Ischemia-Reperfusion Injury Model of embodiment 2（Ischemia/reperfusion injury, I/R）'s Obtain
（1）Animal used as test is grouped：Male C57BL/6 strains wild-type mice, liver cell specificity T raf5 knock out mice and Traf5 transgenic mices, nontransgenic mice, by hepatic ischemia reperfusion Ischemia-reperfusion Injury in Rat is set up（I/R）Model. It is randomly divided into 8 groups：C57BL/6J strain wild-type mice sham-operation groups（WT Sham）And I/R operation groups（WT I/R）、Traf5 Knock out mice sham-operation group（KO Sham）And I/R operation groups（KO I/R）, nontransgenic mice sham-operation group（NTG Sham）And I/R operation groups（NTG I/R）, liver cell specificity T raf5 transgenic mice sham-operation groups（TG Sham）And I/R hands Art group（TG I/R）.
（2）Ischemia-reperfusion Injury in Rat model I/R performs the operation（Using noninvasive blood vessel clip folder close middle period and lobus sinister portal vein and Arteria hepatica, makes about 70% hepatic ischemia/reperfusion injury）Operating process：
1）Operation consent 12h gives mouse fasting, can free water.
2）After operation consent is with 3% yellow Jackets success anesthetized mice, by its prostration fixed limb, with shaver by mouse Belly art area hair is shaved, and art area is sterilized with 10% tincture of iodine and 75% ethanol.
3）Take median abdominal incision and enter abdomen, exposure liver is left, the hepatic pedicle in middle period.
4）The portal vein and arteria hepatica of middle period and lobus sinister are closed with noninvasive blood vessel clip folder, about 70% hepatic ischemia/reperfusion injury is made, to prevent The serious mesenteric vein extravasated blood of generation.After 0.5min, compared with non-blacked lobus dexter, it is seen that blocking leaf bleaches, and illustrates to block into Work(.Now, note recording the ischemic time started, maintain ischemic about 60 minutes, period covers otch with wet saline gauze, and notes The insulation of meaning mouse（The mouse of Sham groups successfully remove at once blood vessel clip blocking, and recovers ischemic hepatic blood flow）.
5）Ischemic removes blood vessel clip after 60 minutes, recover the liver blood flow of ischemic, is then shut off abdominal cavity, and point two-layer closes abdomen, First internal layer is sewed it up, then stitches skin, postoperative mouse is placed in clean cage and is individually raised, observed.
The hepatic necrosis area of embodiment 3 and liver function index（AST, ALT）Measure
The evaluation index of the hepatic ischemia-reperfusion injury order of severity mainly includes hepatic necrosis area and liver function index（AST, ALT）, these indexs with hepatic ischemia-reperfusion injury order of severity positive correlation.
（1）Draw materials
Sham-operation group is taken respectively at postoperative 1h, 3h, 6h, 24h（Sham）And ischemia/reperfusion group mouse, cervical dislocation execution, Immediately blood 1mL is taken from inferior caval vein, separate serum.Simultaneously unification take ischemic region left lobe of liver tissue size about 1.5cm × 1cm × 0.2cm is fixed after 24h in 10% neutral formalin and is dehydrated, and embedding carries out carrying out HE dyeing after paraffin section.
Separate serum：The EP pipes of collect blood stand at room temperature 1-2h and make blood natural coagulation.4℃、4000rpm/min Centrifugation 30min, is sufficiently separated serum.The μ L of serum 20,20 μ L are drawn respectively with micropipettor, 30 μ L, that 30 μ L set to 0 .2mL is aseptic In EP pipes, EP pipes are marked, are subsequently stored in -80 DEG C of refrigerators standby.
（2）Prepare paraffin specimen section
1）Primary operational program includes：Embedding frame process → flowing water flushing → dehydration → transparent → waxdip → embedding → section → stand It is standby after piece → dry or toast.
2）The paraffin section for cutting 5 μm with the standardization program of paraffin slicing machine is standby.
（3）HE is dyeed
Mainly comprise the following steps：55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% alcohol 1min → 95% alcohol 1min → 70% Alcohol 1min → distilled water 1min → haematoxylin solution 5min → washing 1min → 1% hydrochloride alcohol 1-3s → washing 1min → Scott liquid（Sodium acid carbonate 0.35g, magnesium sulfate 2g, distilled water 100mL）1min → washing 1min → Yihong solution 3-5min → steaming Distilled water washes away loose colour → 70% alcohol 1s → 95% alcohol 1s → 100% alcohol 30s, 3 times → dimethylbenzene 2min, 3 times → take advantage of dimethylbenzene Dry up in not dry mounting → fume hood immediately, microscope is taken pictures.
（4）Mice serum ALT, AST assay
1）Serum sample is taken out from -80 DEG C of refrigerators, is immediately placed on ice, treat that sample melts at room temperature；
2）At room temperature, 4000 revs/min are centrifuged 1 minute, allow the serum of EP tube walls to assemble to ttom of pipe.
3）According to operating process, automatic clinical chemistry analyzer is opened（Sysmex, Chemix 180i）, clean sample injector.
4）According to the flag sequence of automatic clinical chemistry analyzer sample disc, EP pipes to be measured are put into one by one.
5）Reagent detection plate is accurately installed, begins to use automatic clinical chemistry analyzer to detect ALT, AST level.
HE coloration result of Traf5-KO, WT, Traf5-TG and NTG group after hepatic ischemia-reperfusion injury is shown in Fig. 3：It is aobvious Visible Sham groups hepatic tissue is normal under micro mirror, and hepatic tissue structure is neat, without obvious proliferation of fibrous tissue.I/R groups with The prolongation of the time of Reperfu- sion, hepatic tissue structural fuzzy, arrangement disorder.Differ in size in it, necrosis region in irregular shape, Liver cell structural fuzzy in necrosis region, arrangement disorder, detachment compares with normal liver, and in the lobuli hepatis of necrotic liver sheet is seen Typical necrosis and change in necrosis region, the visible inflammatory reaction band in slough edge, liver cell nuclear, it is seen that karyopycnosis there is.It is this Phenomenon 24h after ischemia-reperfusion peaks.Test result indicate that, the infarct size given after Traf5-KO mouse I/R is bright It is aobvious to be more than WT group mouse（Fig. 3 A）；Infarct size after same Traf5-TG mouse I/R is significantly less than NTG group mouse（Fig. 3 B）, Therefore, Traf5 plays an important role in the damage that hepatic ischemia reperfusion causes.
The content statistics of serum alt and AST is shown in Fig. 4.As a result time point ALT, AST level each in I/R groups is shown Obviously higher than Sham groups, 6h peaks after Reperfu- sion, subsequently declines, ALT, AST level after Traf5-KO mouse I/R Apparently higher than WT group mouse（Fig. 4 A）；ALT, AST level after Traf5-TG mouse I/R is substantially less than NTG group mouse（Fig. 4 B）.
Hepatocellular apoptosis situation is determined after the ischemia-reperfusion of embodiment 4
With TUNEL kits dyeing detection apoptosis, TUNEL kits：ApopTag® Plus In Situ Apoptosis Fluorescein Detection Kit（S7111, Chemicon）.Detailed process is：
1）Paraffin section is placed in baking box, 60 DEG C of roasting pieces 30 minutes；
2）Dimethylbenzene, 5 minutes × 3 times；
3）100% ethanol, 5 minutes × 2 times；95% ethanol, 5 minutes；70% ethanol, 5 minutes；
4）ddH2O is rinsed, 5 minutes × 2 times；
5）37 DEG C of Proteinase K is incubated 15 minutes；
6）PBS rinses 5min × 2 time；
7）Equilibration Buffer are directly added dropwise in tissue（13μL/cm2）, it is incubated at room temperature at least 10s；
8）Equilibration Buffer are discarded, TdT Enzyme working solutions are added dropwise（77μL Reaction Buffer +33μ L TdT Enzyme）In tissue（11μL /cm2）, put wet box and be incubated 1h in 37 DEG C；
9）Section is placed in and fills Stop/Wash Buffer working solutions（1mL Stop/Wash Buffer+34mL ddH2O）'s Vibrate in staining jar after 15s and be incubated at room temperature 10min（In waiting process, by the Anti-Digoxigenin of appropriate amount Conjugate is suctioned out, and as in EP pipes, avoid light place is at room temperature so as to balance to room temperature）；
10）PBS rinses 1min × 3 time；
11）The liquid of tissue excessive residual is gently got rid of, tissue surrounding liquid is inhaled into 3 Anti-Digoxigenin is added dropwise Fluorescein working solutions（53%Blocking Solution+ 47%Anti-Digoxigenin Conjugate）In tissue On（13μL/cm2）, put room temperature lucifuge incubation 30min in wet box；
12）PBS rinses 2min × 4 time（The PBS for renewing every time）；
13）SlowFade Gold antifade reagent with DAPI（Invitrogen, S36939）Mounting；Fluorescope Lower observation, takes pictures.If needing to preserve, 4 DEG C of preservations in dark wet box.
The postoperative 24 hours hepatocellular apoptosis situations of each group mouse I/R have detected by TUNEL kits, as a result such as Fig. 5 institutes Show, Traf5-KO mouse liver cell apoptosis quantity substantially increases than wild-type mice（Fig. 5 A）, Traf5-TG mouse liver cells wither Quantity of dying substantially is reduced than nontransgenic mice（Fig. 5 B）, this shows Traf5 with Apoptosis during liver cell ischemia-reperfusion It is related.These results indicate that increasing Traf5 expression can suppress hepatic tissue ischemical reperfusion injury, and it is close with hepatocellular apoptosis Cut is closed.
Above-mentioned achievement shows, in the damage that hepatic ischemia reperfusion causes, liver cell specificity T raf5 gene knockouts are little Mouse hepatic necrosis area is dramatically increased, and liver function is substantially reduced, hepatocellular apoptosis quantity also showed increased；And liver cell is specific The hepatic necrosis area of Traf5 transgenic mices is significantly reduced, and liver function strengthens, and hepatocellular apoptosis quantity is significantly reduced.Prove Traf5 genes have important protective effect in hepatic ischemia/reperfusion injury disease model.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention not by above-described embodiment Limit, other any Spirit Essences without departing from the present invention and the change, modification, replacement made under principle, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.
SEQUENCE LISTING
<110>Wuhan University
<120>TNF receptor associated factors 5（Traf5）Application in Ischemia-reperfusion Injury in Rat
<130> 1
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 28
<212> DNA
<213> Mus musculus
<400> 1
ggaggctgta gtacagtgtg acggccgg 28
<210> 2
<211> 28
<212> DNA
<213> Mus musculus
<400> 2
ggttttaagg gttatctaga ctagaagg 28
<210> 3
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp1-F
<400> 3
agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54
<210> 4
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp1-R
<400> 4
atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50
<210> 5
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp2-F
<400> 5
gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52
<210> 6
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp2-R
<400> 6
ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52
<210> 7
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 LA-F
<400> 7
tcgagctcca gtaagctcta ggttctaaag gtgaagaacc cggccgacgt 50
<210> 8
<211> 42
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 LA-R
<400> 8
cggccgggtt cttcaccttt agaacctaga gcttactgga gc 42
<210> 9
<211> 31
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 M-F
<400> 9
ccggaattcg tcacactgta ctacagcctg c 31
<210> 10
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 M-R
<400> 10
cgggatccag aaggtcaacc cccacca 27
<210> 11
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 RA-F
<400> 11
cgcgtagtct agataaccct taaaacattg ttctgtttaa tgacagc 47
<210> 12
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Traf5 RA-R
<400> 12
ggccgctgtc attaaacaga acaatgtttt aagggttatc tagacta 47
<210> 13
<211> 40
<212> DNA
<213> Artificial Sequence
<220>
<223>Upstream primer
<400> 13
agctttgttt aaacgccacc atggctcatt cggaggagca 40
<210> 14
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223>Downstream primer
<400> 14
ctagctagcc tacagatcct ccaagtcagt taaatcc 37

Claims (2)

1.Traf5 answering in screening prevention, the medicine alleviated and/or treat Ischemia-reperfusion Injury in Rat as drug targets With, it is characterised in that：Described application is the purpose of non-diagnostic and treatment；Described screening prevents, alleviates and/or treats liver and lacks The medicine of blood reperfusion injury, refers to that screening enough promotes the medicine of Traf5 expression.
Applications of the 2.Traf5 in the medicine for preparing prevention, alleviating and/or treat Ischemia-reperfusion Injury in Rat.
CN201610873155.5A 2016-09-30 2016-09-30 Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury Pending CN106620722A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610873155.5A CN106620722A (en) 2016-09-30 2016-09-30 Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610873155.5A CN106620722A (en) 2016-09-30 2016-09-30 Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury

Publications (1)

Publication Number Publication Date
CN106620722A true CN106620722A (en) 2017-05-10

Family

ID=58853656

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610873155.5A Pending CN106620722A (en) 2016-09-30 2016-09-30 Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury

Country Status (1)

Country Link
CN (1) CN106620722A (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103784970A (en) * 2014-01-23 2014-05-14 武汉大学 TNF (Tumor Necrosis Factor) receptor associated factor 1 (TARF1) and application of inhibitor thereof to liver ischemic disease

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103784970A (en) * 2014-01-23 2014-05-14 武汉大学 TNF (Tumor Necrosis Factor) receptor associated factor 1 (TARF1) and application of inhibitor thereof to liver ischemic disease

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
JUNFEI HU ET AL.: "Targeting TRAF3 signaling protects against hepatic ischemia/reperfusions injury", 《JOURNAL OF HEPATOLOGY 》 *
LANG WANG ET AL.: "Tumor necrosis factor receptor-associated factor 5 is an essential mediator of ischemic brain infarction", 《JOURNAL OF NEUROCHEMISTRY》 *
LING GAO ET AL.: "Tumor necrosis factor receptor-associated factor 5 (Traf5) acts as an essential negative regulator of hepatic steatosis", 《JOURNAL OF HEPATOLOGY》 *
ROLAND ANDERSSON ET AL.: "Liver ischaemia following vascular occlusion: A century’s experience", 《SCANDINAVIAN JOURNAL OF GASTROENTEROLOGY》 *
X-F ZHANG ET AL.: "TRAF1 is a key mediator for hepatic ischemia/reperfusion injury", 《CELL DEATH AND DISEASE》 *
余元勋 等主编: "《中国疾病信号通路与靶向治疗学》", 31 May 2013, 安徽科学技术出版社 *

Similar Documents

Publication Publication Date Title
Hatcher et al. TBX5 transcription factor regulates cell proliferation during cardiogenesis
Shen et al. Conditional knockout of focal adhesion kinase in endothelial cells reveals its role in angiogenesis and vascular development in late embryogenesis
JP6199936B2 (en) Tissue regeneration promoter by mobilization of bone marrow mesenchymal and / or pluripotent stem cells in blood
Shimizu et al. ROCK-I regulates closure of the eyelids and ventral body wall by inducing assembly of actomyosin bundles
CN110100788B (en) Method for constructing disease model based on gene operation strategy and application
CN106620721A (en) Application of monocyte chemotactic protein-1 induced protein 1 (Mcpip1) to hepatic ischemia reperfusion injury
Selvaraju et al. Deletion of newly described pro-survival molecule Pellino-1 increases oxidative stress, downregulates cIAP2/NF-κB cell survival pathway, reduces angiogenic response, and thereby aggravates tissue function in mouse ischemic models
US20070061907A1 (en) Inhibitor of differentiation knockout mammals and methods of use thereof
Fujita et al. Endogenous TNFα suppression of neovascularization in corneal stroma in mice
CN111154802B (en) Application of ECM1 gene knockout mice in screening anti-hepatic fibrosis drugs
CN106421789A (en) Application of Mincle and inhibitor thereof in hepatic ischemia reperfusion injuries
Gonzalez-Valdes et al. Bmi1 limits dilated cardiomyopathy and heart failure by inhibiting cardiac senescence
CN111485003B (en) Construction method and application of retinal vascular disease model
CN110167564A (en) Tjp1 expression is adjusted to adjust the regeneration of heart cell
Akhmametyeva et al. Regulation of the neurofibromatosis 2 gene promoter expression during embryonic development
CN106620722A (en) Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury
CN106421815B (en) Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat
CN106310225B (en) Application of caspase recruitment domain protein 6 (Card 6) in liver ischemia-reperfusion injury
CN115381949A (en) Application of targeted inhibition of pigment epithelium derived factor in promotion of liver regeneration and improvement of liver injury
CN106492230B (en) Function and application of the leukocytic immunity globulin sample receptor B4 in treatment nonalcoholic fatty liver and type II diabetes
CN115478105B (en) Application of SIRT4 in treating liver ischemia diseases
CN111195254B (en) LPA2 and use of agonists thereof
CN106540275B (en) Function and application of the disintegrating element for poisonous metalloproteinases 22 in treatment myocardial hypertrophy
CN106556706A (en) Function and application of the Kistin MMP-23 in myocardial hypertrophy
CN106512008B (en) Interferon regulatory factor 5(IRF5) and its inhibitor treatment myocardial hypertrophy in application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20170510