CN115478105B

CN115478105B - Application of SIRT4 in treating liver ischemia diseases

Info

Publication number: CN115478105B
Application number: CN202211026818.1A
Authority: CN
Inventors: 陈三洋; 朱长举; 余起文; 宋耀东
Original assignee: First Affiliated Hospital of Zhengzhou University
Current assignee: First Affiliated Hospital of Zhengzhou University
Priority date: 2022-08-25
Filing date: 2022-08-25
Publication date: 2023-06-30
Anticipated expiration: 2042-08-25
Also published as: CN115478105A

Abstract

The invention belongs to the technical field of medical biology, and discloses application of SIRT4 in treatment of liver ischemia diseases. The application is especially applied to screening or preparing medicines for treating liver ischemia-reperfusion injury caused by liver ischemia-reperfusion injury as medicine targets, wherein the medicines contain SIRT4 agonists, SIRT4 genes or SIRT4 proteins, and the expression of SIRT4 is regulated so as to relieve the liver ischemia-reperfusion injury. The invention provides an application of SIRT4 gene in preparing a medicament for treating liver ischemia diseases for the first time, takes SIRT4 gene knockout mice, liver cell specific SIRT4 high expression mice and wild type C57 mice as experimental objects, researches the effect of SIRT4 gene in liver ischemia reperfusion through a liver ischemia reperfusion injury model, and provides a new administration way for clinically treating the liver ischemia diseases caused by liver ischemia reperfusion injury.

Description

Application of SIRT4 in treating liver ischemia diseases

Technical Field

The invention belongs to the technical field of medical biology, and particularly relates to application of SIRT4 in treatment of liver ischemia diseases.

Background

Ischemia reperfusion injury (ischemia-reperfusion injury, IRI) of the liver is a phenomenon in which liver ischemia is caused by liver transplantation, liver resection and the like, and when reperfusion resumes blood supply, liver cell dysfunction and structural damage are aggravated. Liver ischemia reperfusion injury is one of the main factors affecting prognosis of liver transplantation patients, and can lead to early graft dysfunction, primary graft failure, acute and chronic rejection and other complications after liver transplantation, and serious liver ischemia reperfusion injury can further induce systemic diseases including inflammatory response syndrome and multiple organ dysfunction. In addition, with the economic development of China and the rapid increase of the number of patients waiting for liver transplantation, marginal liver supply (such as heart death liver supply, elderly liver supply and fatty liver supply) becomes an important source for relieving liver shortage of liver transplantation, but the sensitivity to ischemia reperfusion injury severely limits the application of the organs. Therefore, the pathogenesis of the liver ischemia reperfusion injury is deeply explored, and further, a new thought and a new target point for preventing and treating the liver ischemia reperfusion injury are discovered, so that the method has important research significance and clinical value.

Liver ischemia reperfusion injury is a pathophysiological process in which multiple factors and multiple signal pathways are jointly involved, and the pathogenesis of the liver ischemia reperfusion injury is not completely elucidated up to now. At present, domestic and foreign researches are consistent to consider that the ischemia reperfusion injury of the liver is divided into two typical stages of ischemia and reperfusion, and the liver has a unique tissue injury mechanism. As the availability of ATP decreases during the ischemic phase, ATP-dependent ion channels begin to fail, the cellular metabolic rate decreases, anaerobic glycolysis activates, and hepatocytes die rapidly. Reperfusion injury involves direct and indirect cytotoxic mechanisms by which the liver produces reactive oxygen species that stimulate inflammatory responses, including macrophage and neutrophil infiltration and cytokine production, ultimately leading to apoptosis and necrosis of hepatocytes. Therefore, excessive inflammation and extensive apoptosis are two important factors in the liver ischemia reperfusion injury process.

Starting from the 80 s of the last century, global scholars have sought ways and methods to alleviate hepatic ischemia reperfusion injury, including ischemic preconditioning for surgical intervention, post-ischemic conditioning, and drug preconditioning, but these methods have not yet achieved exact clinical results. The rapid development in the fields of molecular biology, genetic engineering technology and the like at present opens up a new way for finding the targeted therapy of important functional genes related to liver ischemia reperfusion injury.

As one of the SIRT family members, deacetylase 4 (Sirtuins, SIRT 4) is mainly involved in regulating glutamine catabolism. Unlike SIRT1-3 and SIRT7, which are mainly used as lysine deacetylases, SIRT4 can be used as ADP-ribose transferase to regulate energy metabolism and also can be used as lysine deacetylase to regulate protein acetylation modification. SIRT4 has attracted considerable attention in regulating oxidative stress as a mediator of cellular environmental adaptive responses. Chen H et al found that SIRT4 regulates rat tooth papilla cell differentiation by inhibiting ROS production. In addition, SIRT4 plays an important role in lipid peroxidation, and SIRT4 overexpression can remarkably inhibit the oxidation rate of liver fatty acids. Other studies report that SIRT4 is a key molecule for regulating the immunity of organisms and can reduce non-alcoholic fatty liver by inhibiting inflammatory reaction. However, as a key molecule for regulating inflammation and oxidative stress, the role of SIRT4 in the course of ischemia reperfusion injury of the liver has not been reported. Because inflammatory reaction and oxidative stress are closely related to pathogenesis of liver ischemia reperfusion injury, elucidating function of SIRT4 in liver ischemia reperfusion injury pathogenesis is expected to become an important potential target point for liver ischemia reperfusion injury treatment.

Disclosure of Invention

In view of the problems and deficiencies in the prior art, it is an object of the present invention to provide the use of SIRT4 in the treatment of hepatic ischemic disease.

Based on the above purpose, the invention adopts the following technical scheme:

the first aspect of the invention provides an application of SIRT4 as a drug target for screening drugs for preventing, relieving or/and treating liver ischemia diseases.

Preferably, the liver ischemia disease is a liver ischemia disease caused by liver ischemia reperfusion injury.

In a second aspect, the invention provides the use of SIRT4 in the manufacture of a medicament for the prevention, alleviation and/or treatment of liver ischemia disorders.

In a third aspect, the invention provides a medicament for preventing, alleviating and/or treating liver ischemia, the medicament comprising a SIRT4 agonist, a SIRT4 gene or a SIRT4 protein.

Preferably, the SIRT4 agonist is a small molecule, antibody or synergistic nucleic acid that targets to enhance or increase SIRT4 expression.

Preferably, the medicament further comprises a pharmaceutically acceptable carrier.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention provides an application of SIRT4 gene in preparing a medicament for treating liver ischemia diseases for the first time, in particular to an application of SIRT4 gene serving as a medicament target in screening medicaments for preventing, relieving and/or treating liver ischemia reperfusion injury. The SIRT4 gene has the following application in drug screening of liver ischemia reperfusion injury: 1) The SIRT4 gene can be used as a drug target for diagnosing and treating liver ischemia reperfusion injury, and an in vitro cell model or an animal model with high SIRT4 gene expression is constructed and used for screening and diagnosing and/or treating drugs for liver ischemia reperfusion injury; 2) The in vitro cell model or animal model is utilized, SIRT4 is used as target spot to design a small molecular compound specific agonist, thereby providing a new therapeutic molecule for treating liver ischemia reperfusion injury. The invention verifies the effect of SIRT4 gene in liver ischemia reperfusion injury model by using SIRT4 gene knockout mice and SIRT4 gene high expression mice at animal level, the method is true and reliable, and provides a new drug administration way for clinically treating liver ischemia diseases caused by liver ischemia reperfusion injury.

(2) The invention takes SIRT4 gene knockout mice, hepatocyte-specific SIRT4 gene high expression mice and wild C57 mice as experimental objects, and researches the effect of SIRT4 genes in liver ischemia reperfusion through a liver ischemia reperfusion injury model. In one example, SIRT4 knockout mice have significantly increased serum transaminase (ALT/AST) after liver ischemia reperfusion, and significantly increased liver necrosis area, necrosis degree, and inflammatory response compared to control mice; and the aminotransferase (ALT/AST) of the mice with high expression of the liver cell specific SIRT4 gene mediated by adeno-associated virus (AAV) is obviously reduced, and the liver necrosis area, the necrosis degree and the inflammatory response are obviously reduced. The SIRT4 gene has the effects of inhibiting liver necrosis and inflammatory reaction and protecting liver function in liver ischemia reperfusion, and provides theoretical basis and clinical basis for SIRT4 in researching new target and strategy for preventing and treating liver ischemia.

Drawings

FIG. 1 is a schematic diagram showing SIRT4 protein expression after ischemia reperfusion injury of mouse liver and hepatocytes detected by Western Blot in an embodiment of the present invention; wherein A is the expression level of SIRT4 protein in liver tissues after ischemia reperfusion injury of the liver of the mouse, B is the expression level of SIRT4 protein in liver cells after ischemia reperfusion injury of the liver cells, and GAPDH is an internal reference control;

FIG. 2 is a schematic diagram of the construction process of SIRT4 knockout mice in the embodiment of the present invention;

FIG. 3 is a schematic diagram of SIRT4 protein expression level in liver tissues of a SIRT4 gene knockout mouse and a SIRT4 gene high expression mouse detected by Western Blot in the embodiment of the invention; wherein, A is SIRT4 protein expression level in the liver tissue of the SIRT4 gene knockout mouse, B is SIRT4 protein expression level in the liver tissue of the SIRT4 gene high expression mouse, and WT: wild-type mice, KO: SIRT4 knockout mice, AAV-GFP: empty virus control, AAV-SIRT4: SIRT4 gene high expression mice and GAPDH are internal reference controls;

FIG. 4 is a statistical histogram of transaminase (ALT/AST) levels in serum of SIRT4 knockout mice and SIRT4 gene highly expressed mice following hepatic ischemia reperfusion injury in accordance with an embodiment of the present invention; wherein, A is a statistical histogram of aminotransferase (ALT/AST) level in serum of SIRT4 knockout mice, B is a statistical histogram of aminotransferase (ALT/AST) level in serum of SIRT4 high expressing mice, and WT: wild-type mice, KO: SIRT4 knockout mice, AAV-GFP: empty virus control, AAV-SIRT4: SIRT4 gene high expression mice, sram: false operation group, IRI: mice liver ischemia reperfusion injury surgery group, n.s.:P＞0.05，**：P＜0.01；

FIG. 5 is a pathological chart of HE staining of liver tissue sections of SIRT4 knockout mice and SIRT4 gene high-expression mice after liver ischemia reperfusion injury in the embodiment of the invention; wherein A is a HE staining pathological diagram of a liver tissue slice of a SIRT4 gene knockout mouse, B is a HE staining pathological diagram of a liver tissue slice of a SIRT4 gene high-expression mouse, and WT: wild-type mice, KO: SIRT4 knockout mice, AAV-GFP: empty virus control, AAV-SIRT4: SIRT4 gene high expression mice, sram: false operation group, IRI: a mouse liver ischemia reperfusion injury surgery group;

FIG. 6 is a schematic diagram showing expression levels of inflammatory cytokines IL-1 beta, IL-6, CXCL10 and Tnfα in liver tissue cells after ischemia reperfusion injury of liver of SIRT4 knockout mice and SIRT4 high-expression mice in the examples of the present invention; wherein A is the expression level of inflammatory cytokines IL-1 beta, IL-6, CXCL10 and Tnfalpha in SIRT4 gene knockout mouse liver tissue cells, and B is the inflammatory cytokine IL in SIRT4 gene high expression mouse liver tissue cells-1 beta, IL-6, CXCL10, tnfα expression levels schematic, WT: wild-type mice, KO: SIRT4 knockout mice, AAV-GFP: empty virus control, AAV-SIRT4: SIRT4 gene high expression mice, sram: false operation group, IRI: mice liver ischemia reperfusion injury surgery group, n.s.:P＞0.05，**：P＜0.01；

FIG. 7 is a schematic diagram showing immunofluorescence staining results of liver tissues of SIRT4 knockout mice and SIRT4 gene high-expression mice after liver ischemia reperfusion injury in the embodiment of the invention; wherein A is a schematic diagram of a liver tissue immunofluorescence staining result of a SIRT4 gene knockout mouse, and B is a schematic diagram of a liver tissue immunofluorescence staining result of a SIRT4 gene high-expression mouse, and WT: wild-type mice, KO: SIRT4 knockout mice, AAV-GFP: empty virus control, AAV-SIRT4: SIRT4 gene high expression mice, sram: false operation group, IRI: the mice liver ischemia reperfusion injury surgery group.

Detailed Description

The present invention will be further described in detail below with reference to the accompanying drawings by way of examples in order to make the objects, technical solutions and advantages of the present invention more apparent. It should be understood that the specific embodiments described herein are for purposes of illustration only and are not intended to limit the scope of the invention.

It should be noted that, in the case of no conflict, the embodiments and features in the embodiments may be combined with each other. The present application will be described in detail below with reference to the accompanying drawings in conjunction with embodiments.

Experimental animals: male C57BL/6 strain, wild-type mice (WT, purchased from Beijing Vitolihua laboratory animal technologies Co., ltd.) of 8-10 weeks old and having a weight of 23-26g, SIRT4 knockout mice (SIRT 4-KO, purchased from Siro biosciences Co., ltd.) and adeno-associated virus (AAV) -mediated SIRT4 gene high expression mice (AAV-SIRT 4, AAV purchased from Heng biosciences Co., ltd.) were selected as subjects.

Feeding environment and conditions:

feeding environment: all experimental mice were housed in the SPF class laboratory animal center at Zhengzhou university. Mouse feed was purchased from Hunan Stokes Lekkda laboratory animals Co.

Feeding conditions: the mice are bred in an environment with light and shade alternating illumination time of 12 hours, humidity of 40-70 percent and room temperature of 22-24 ℃, and the mice drink and eat freely during the breeding period.

Example 1: construction of liver ischemia reperfusion injury animal model and cell model

1.1 construction of a model of ischemia reperfusion injury in the liver of mice

1.1.1 Experimental group

Mice were divided into 5 groups (6 duplicate controls per group) using the random digital table method: sham group, ischemia 60min reperfusion 3h group (IRI 3h group), ischemia 60min reperfusion 6h group (IRI 6h group), ischemia 60min reperfusion 12h group (IRI 12h group), ischemia 60min reperfusion 24h group (IRI 24h group).

1.1.2 Experimental procedure

Mice were fasted for 12h preoperatively and were free to drink water. The mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (Sigma Aldrich, P3761) at a dose of 80 mg/kg, and the anesthesia time and state of the mice were recorded. After the abdomen of the mouse is disinfected after the iodophor is soaked by a cotton swab, an abdomen middle incision is taken, the liver is probed, and bile ducts above portal vein, hepatic artery and right outer side leaf branches are fully free and exposed. The blood supply to the left lateral/central lobe of the liver was blocked with a non-invasive vascular clamp, and the success of the ischemic procedure was confirmed by observing a color change in the ischemic lobe. During ischemia, the temperature of the mice was maintained with a constant temperature blanket. 60min after ischemia, the vascular clamps were loosened to perform liver lobe reperfusion and the abdomen was closed. The lack of ischemic color change and lack of response to reperfusion are criteria for excluding further analysis. Sham mice do not block blood vessels, and other procedures are similar to ischemia reperfusion surgery.

1.1.3 sample materials

After 3h, 6h, 12h and 24h of reperfusion, the mice are anesthetized and sacrificed, and liver tissue and serum samples are collected for further detection and analysis. The specific steps of the mouse sample material are as follows: marking specimen information on the frozen vial cap and the vial body by using a marker pen, and preparing a sampling instrument, consumable materials and a sampling registry; after anesthetizing the mice, the large cross incision in the middle of the abdomen was opened, the mice left ventricle was perfused with pre-chilled saline, and blood was taken from the lower vena cava of the mice using a 1mL syringe; the ischemic liver leaves were divided into 5 parts, 1 part was immersed in 10% neutral formalin solution, and the other 4 parts were placed in a freezing tube and rapidly stored in a liquid nitrogen tank.

1.2 construction of hepatocyte ischemia reperfusion injury model

AML12 hepatocytes (pranosai biotechnology limited, cat No. CL 0602) were cultured for 24h and then divided into 2 groups (3 duplicate controls per group): control (Control) and hypoxia/reoxygenation (H/R). The Control group cells do not perform any treatment, and the H/R group cells are subjected to oxygen-deficient reoxygenation treatment. And carrying out project detection after the H/R treatment is completed.

The H/R treatment steps are as follows: hepatocytes were cultured in a normal incubator with DMEM medium with high sugar and 10% serum. The anaerobic treatment was carried out by replacing the cell culture medium with sugar-free, serum-free DMEM medium, and transferring the hepatocytes to a hypoxia incubator (1% O) ₂ ，5% CO ₂ ，94% N ₂ ). After 6H hypoxia, the hepatocytes were removed from the hypoxia incubator, the medium was replaced with DMEM medium with high sugar, 10% serum, and the hepatocytes were transferred to the normal incubator, and a hepatocyte hypoxia/reoxygenation (H/R) model was constructed to simulate a mouse liver IRI (liver ischemia reperfusion injury) model. After reoxygenation of the cells for various periods of time, hepatocytes and supernatants were collected for the next experiment.

1.3 analysis of results

The expression level of SIRT4 protein in the mouse liver tissue sample obtained in the step 1.1.3 and the mouse liver cells obtained in the step 1.2 was detected by Western Blot (Western Blot) experiment, and the results are shown in FIG. 1.

As can be seen from fig. 1, SIRT4 protein expression in liver tissue and hepatocytes was significantly lower than in the Control group (sham group and Control group) after ischemia reperfusion of mice and hepatocytes. These results suggest that SIRT4 may play an important role in hepatic ischemia reperfusion injury.

Example 2: construction of SIRT4 Gene knockout and SIRT4 Gene high expression mice

2.1 construction of SIRT4 Gene knockout mice

The construction of SIRT4 knockout mice (SIRT 4-KO) by CRISPR/Cas9 system was delegated to "Siro (Suzhou) Biotech Co., ltd.), and the schematic of the construction process is shown in FIG. 2. The construction steps are as follows: SIRT4-201 is selected as a gene locus of a knockout mouse construction strategy, and 4 sgRNA sequences (sgRNA-1: AAGGCAGCAACTCCACAGCGG; sgRNA-2: GGACACCGGTGAACCCAGCAGG; sgRNA-3: CGGCGACGTGTTCCTACTGAGG; sgRNA-4: GCTGGCGGACCGGAGCACTGCGG) are obtained by using an online CRISPR design tool (http:// choploop. Cbu. Uib. No /); the SIRT4-sgRNA expression vector was constructed using pUC57-sgRNA (Addgene, 51132) as a backbone vector. After mixing the purified Cas9 mRNA product with sgRNA, the mixture was injected into C57BL/6 mouse single cell fertilized eggs by a FemtoJet 5247 microinjection system, and the fertilized eggs after injection were transplanted into surrogate female mice. After 2 weeks of obtaining F0 generation mice, the ear tissues of the mice are taken for extracting genome DNA identification.

2.2 construction of SIRT4 Gene highly expressed mice

The "hanheng biotechnology (Shanghai) limited company" was entrusted to construct an adeno-associated virus (AAV-8) that overexpressed SIRT4, and a SIRT4 gene-highly expressed mouse (AAV-SIRT 4) was constructed by tail vein injection. The construction steps are as follows: the method comprises the steps of co-transfecting a vector plasmid (pHBAAV-CMV-MCS-3 flag-EF 1-ZsGreen) carrying SIRT4 target genes, pAAV-RC vector plasmid and pHelper vector plasmid into 293T cells by using a three-plasmid packaging system, collecting cells and a culture medium after transfection for 72 hours, concentrating and purifying to obtain SIRT4 over-expressed adeno-associated virus; control viruses used AAV-GFP expressing green fluorescent protein; the virus dose is 2×10 per mouse ¹¹ The transfection units (vg) were injected by tail vein, and each mouse was injected in a volume of 200 μl.

2.3 analysis of results

And detecting the expression quantity of SIRT4 protein in the liver of the SIRT4 gene knockout mouse and the SIRT4 gene high expression mouse by adopting a Western Blot method. The Western Blot detection steps specifically include: the mouse liver tissue protein was extracted and SIRT4 expression was verified by polyacrylamide gel electrophoresis (SDS-PAGE).

As can be seen from fig. 3, KO (SIRT 4 knockout mice) group SIRT4 protein was hardly expressed in the liver tissue of mice compared to WT group mice. In addition, compared with the mice in the control group, the expression content of SIRT4 protein in liver tissues of the mice with high SIRT4 gene expression is obviously improved.

Example 3: SIRT4 gene knockout and SIRT4 gene high expression mouse liver ischemia reperfusion injury result analysis

And (3) respectively carrying out liver ischemia reperfusion (ischemia 60min and reperfusion 6 h) on the SIRT4 gene knockout mouse obtained in the step 2.1 and the SIRT4 gene high-expression mouse obtained in the step 2.2 according to the step 1.1.2, then collecting liver tissue and serum samples of the reperfusion mice, and respectively carrying out serum ALT and AST content measurement, liver tissue paraffin section HE staining, inflammatory response measurement and immunofluorescence staining analysis.

3.1 analysis of serum ALT and AST content results

ALT and AST contents in serum of SIRT4 knockout mice and SIRT4 gene high-expression mice after liver ischemia reperfusion injury are measured, and the results are shown in figure 4. The ALT and AST content measurement steps specifically comprise: 1) Taking out a mouse serum sample from a refrigerator at the temperature of minus 80 ℃, putting the mouse serum sample on ice for thawing, and uniformly mixing; 2) According to the operation flow, a full-automatic biochemical analyzer (Sysmex, chemix 180 i) is opened, the EP pipes to be tested are placed one by one according to the marking sequence of the sample tray of the full-automatic biochemical analyzer, and ALT and AST levels are detected by using the full-automatic biochemical analyzer.

The results in FIG. 4 show that both the IRI group (the operative group of liver ischemia reperfusion injury in mice) ALT and AST levels were significantly higher in SIRT4-KO mice and AAV-SIRT4 mice than in the Sham group. And compared with IRI group, the level of ALT and AST after liver ischemia reperfusion injury of SIRT4-KO mice was significantly higher than that of WT group mice (shown in fig. 4 a), while the level of ALT and AST after liver ischemia reperfusion injury of AAV-SIRT4 mice was significantly lower than that of AAV-GFP group mice (shown in fig. 4B). Since transaminase (ALT/AST) is mainly distributed in hepatocytes, when hepatocytes are damaged, transaminase is released into blood, and thus if ALT and AST levels in blood are increased, it is suggested that hepatocytes are damaged. Therefore, liver damage in SIRT4 knockout mice is more severe.

3.2 HE staining pathological analysis of Paraffin sections of liver tissue

The pathological analysis is performed after liver tissue sections and HE staining of SIRT4 gene knockout mice and SIRT4 gene high expression mice after liver ischemia reperfusion injury, and the results are shown in figure 5.

3.2.1 Experimental procedure

The preparation method of the liver tissue paraffin specimen slice comprises the following steps: 1) The embedding frame filled with liver tissue is put into a dehydrator and is arranged according to the corresponding program operation. 2) Dehydration in gradient alcohol: ethanol (30%) for 1h; ethanol (50%) for 1h; ethanol (75%) for 1h; ethanol (85%) for 1h; ethanol (95%) for 1h; absolute ethanol for 1h. 3) And (3) transparency: xylene and absolute ethanol (1:3) for 1h; xylene and absolute ethanol (1:1) for 1h; xylene and absolute ethanol (3:1) for 1h; xylene for 1h; xylene for 1h. 4) Wax dipping: paraffin wax and xylene (1:1) for 45 min; paraffin wax for 1h. 5) Starting an embedding machine, melting paraffin, pouring the melted paraffin into an embedding mould, and then placing the paraffin-infiltrated liver tissue into the paraffin of the embedding mould with the section facing downwards. After solidification of the paraffin wax, the wax block is removed from the mold and the periphery of the wax block is trimmed with a blade. 6) And (5) placing the embedded wax blocks on an ice table for freezing for about 15 minutes. 7) The wax block is fixed in a clamping seat of a slicing machine, firstly, a slice is trimmed, the slice thickness is set to be 15-20 mu m, and the slice thickness is set to be 4 mu m after the slice is exposed. And (5) uniformly shaking a hand wheel of the slicing machine to slice. The whole slice is selected and moved into cold water by a writing brush. 8) And (5) spreading: each slice was separated with forceps, the most complete, non-wrinkled slice was selected and the slice was transferred to constant temperature (40-45 ℃) water with a slide. After about 10s, the sections are fully unfolded, the sections are fished up by using the anti-drop glass slide, and the information is marked by using a pencil. 9) The slices were placed in a 37 ℃ incubator and stored at room temperature after air-drying.

The main steps of HE staining of the liver tissue paraffin specimen slice are as follows: the slice is baked at 60 ℃ for 1h, xylene is soaked for 5min,3 times, 100% alcohol is soaked for 1min, 95% alcohol is soaked for 1min, 70% alcohol is soaked for 1min, double distilled water is soaked for 1min, hematoxylin solution is soaked for 5min, water is washed for 1min, 1% hydrochloric acid alcohol is soaked for 1-3s, water is washed for 1min, scott liquid (magnesium sulfate 2g, sodium bicarbonate 0.35g and distilled water 100 mL) is soaked for 1min, water is washed for 1min, eosin solution is soaked for 5min, double distilled water is rinsed, 70% alcohol is used for 1s, 95% alcohol is used for 1s, 100% alcohol is used for 30s,3 times, xylene is soaked for 2min,3 times, sealing is performed, airing is performed in a fume hood, and photographing is performed under a microscope.

3.2.2 analysis of results

The results of FIG. 5 show that the liver tissue of the Sham group mice under the microscope is basically normal and the structure is neat; the IRI group liver tissue structure is fuzzy, the arrangement is disordered, necrosis foci with different sizes and irregular shapes are arranged in the IRI group liver tissue structure, the liver cell structure in the necrosis foci is fuzzy, and the typical necrotic change of the liver cell nucleus occurs, so that the nucleus is contracted and dissolved. And compared with the IRI group, the area and degree of hepatic necrosis after liver ischemia reperfusion injury of the SIRT4-KO group mice were significantly higher than those of the WT group mice (shown in fig. 5 a), whereas the area and degree of hepatic necrosis after liver ischemia reperfusion injury of the AAV-SIRT4 group mice were significantly lower than those of the AAV-GFP group mice (shown in fig. 5B). Thus, SIRT4 gene knockout can significantly exacerbate mouse liver ischemia reperfusion injury.

3.3 analysis of inflammatory response results

The expression levels of inflammatory cytokines IL-1 beta, IL-6, CXCL10 and Tnfα in SIRT4 gene knockout mice and SIRT4 gene high expression mice liver tissue cells after liver ischemia reperfusion injury are detected by adopting Real-Time PCR technology, and the results are shown in figure 6. The inflammatory factors IL-1 beta, IL-6, CXCL10 and Tnfα detected by the embodiment are all translation proteins, and the change of the gene level occurs earlier and the change of the detected gene level is more sensitive because a certain time is needed from the gene transcription level to the protein translation level, so the embodiment adopts the gene detection technology to detect the expression level of inflammatory cytokines.

3.3.1 Experimental procedure

3.3.1.1 Trizol method for extracting total RNA in mouse liver tissue cells

1) Before the experiment, consumable materials such as forceps, ophthalmic scissors, steel balls, EP pipes, gun heads and the like are sterilized under high pressure for standby. 2) Taking out a tissue sample to be detected and placing the tissue sample on dry ice; shearing mung bean liver tissues with ophthalmic scissors, and placing the liver tissues in an EP tube with the volume of 1.5 mL; 4 steel balls were placed in each EP tube and 1 mLTrilzol lysate was added. 3) Precooling a grinding tank, and placing a sample into the grinding tank; setting the grinding parameters to be 30Hz/s and 90s; after finishing the polishing, it was observed whether the polishing was sufficient, and if the tissue was not completely polished, the polishing was repeated once. 4) Taking out the steel balls by using a magnet; the samples were placed in a centrifuge and centrifuged at 12000rpm for 5min, and the supernatant was transferred to a pre-chilled 1.5mL RNase free EP tube. 5) Phenol-chloroform extraction: adding 200 mu L of chloroform into each tube, vortex shaking and mixing for about 15s, and standing at room temperature for 5min; the sample was placed in a centrifuge at 4℃and centrifuged at 12000g for 15min. 6) Isopropanol precipitation: after centrifugation, the sample is divided into three layers, wherein the upper layer is a colorless water phase layer (mainly containing RNA), the middle layer is a white layer (mainly containing DNA), and the lower layer is a pink layer (mainly containing protein); carefully aspirate the upper aqueous phase into a fresh Rnase free EP tube (about 400. Mu.L), add 500. Mu.L isopropyl alcohol/1 mL Trizol, gently mix upside down, and stand for 10min at room temperature; putting the sample into a centrifuge at 4 ℃, and centrifuging for 10min by 12000 and g; note that this step was not greedy to aspirate the supernatant, note that no intermediate white material could be aspirated, otherwise the extracted RNA would be impure. 7) The supernatant was discarded, and at this time the white precipitate at the bottom of the EP tube was RNA. 8) Washing: adding 1mL precooled 75% absolute ethyl alcohol into each tube, and blowing and suspending the white precipitate by using a pipetting gun; putting the sample into a centrifuge at 4 ℃ and centrifuging 7500g for 5min; note that 75% ethanol in this step must be formulated with DEPC water. 9) After centrifugation, the supernatant was discarded, any remaining ethanol was sucked as much as possible, the ER tube was placed upside down in a fume hood for about 5min, and the ethanol was air-dried as much as possible. 10 60. Mu.L DEPC water was added to each tube to dissolve RNA in the EP tube and placed on ice. 11 Detecting RNA: the NanoDrop 2000 and corresponding software were started and the instrument was calibrated using 1 μl of ultrapure water; 1 mu L of RNA sample is dripped into a sample-adding hole of a probe, and the concentration of RNA, A260/A280 and A260/A230 are read and recorded; wherein the purity of RNA is about 1.8, and the concentration is preferably 200-2000 ng/. Mu.L. 12 RNA electrophoresis to detect the degradation of RNA: preparing 1% agarose gel, and preparing a mixed solution according to 1 mu L of RNA, 1 mu L of Marker and 8 mu L of DEPC water; mixing the mixed solution, adding the prepared agarose gel, and performing 180V constant-pressure electrophoresis for 15min; photographing and storing after electrophoresis is finished; the 18s and 28s bands of the RNA with better integrity are sharp and very clear in edge, meanwhile, the brightness of the 28s band is twice or more than twice of that of the 18s band, and no tail exists in a lane.

3.3.1.2 reverse transcription

1) The corresponding volume of 2. Mu.g RNA was calculated from the RNA concentration and DEPC water was added to a total volume of 12. Mu.L. 4. Mu.L of 4 XgDNA wind Mix was added, and after mixing and centrifugation, the sample was placed in a reverse transcriptase, set at 42℃for 2min, and after completion, the sample was taken out and placed on ice. 2) 4. Mu.L of 5 XHiScript III Qrt SuperMixa was added to each sample, and after mixing and centrifugation, the samples were placed in a reverse transcriptase, set up procedure: 50 ℃ for 1h; 5s at 85 ℃; the temperature was kept at 4 ℃. 3) And taking out the cDNA sample after finishing, and storing in a refrigerator at-80 ℃.

3.3.1.3 Real-Time fluorescent quantitative PCR (Real-Time PCR)

1) Dilution of cDNA template: the cDNA obtained by reverse transcription in step 3.3.1.2 was diluted 3-fold with DEPC water to obtain a better amplification curve. 2) The PCR system was prepared by thawing 2X ChamQ SYBR qPCR Master Mix in advance, cDNA templates, primers, etc., according to the following formulation, wherein the primer (F) and primer (R) are shown in Table 1.

TABLE 1 nucleotide sequences of primer (F) and primer (R) corresponding to inflammatory cytokine gene

3) 3 compound holes are arranged according to each index of each sample to prepare reaction mixed solution, and DNA, 2X ChamQ SYBR qPCR Master Mix and water are added and mixed uniformly. 4) After sealing the plate with a sealing film, the plate was centrifuged at 3000rpm for 2min to allow the PCR system to be sufficiently centrifuged to the bottom of the tube. 5) The plate was placed in a real-time quantitative PCR instrument and amplification reaction conditions were set as follows: 95 ℃ for 30s; then, the temperature is 95 ℃ for 5 seconds, 60 ℃ for 30 seconds, and 40 cycles are carried out; finally, the temperature is 95 ℃ for 15s,60 s and 95 ℃ for 15s.

3.3.2 analysis of results

The results of FIG. 6 show that the expression level of IL-1 beta, IL-6, CXCL10 and Tnfα inflammatory cytokine genes in liver tissues after ischemia reperfusion injury of the liver of SIRT4-KO mice is obviously higher than that of the WT mice (shown in FIG. 6A); in contrast, the levels of IL-1β, IL-6, CXCL10, tnfα inflammatory cytokine gene expression in liver tissue following ischemia reperfusion injury in AAV-SIRT4 mice were significantly lower than in AAV-GFP group mice (shown as B in FIG. 6). Thus, SIRT4 gene knockout can significantly exacerbate liver ischemia reperfusion injury and is associated with inflammatory response.

3.4 immunofluorescent staining analysis

Immunofluorescence staining technique was used to detect SIRT4 knockout mice after hepatic ischemia reperfusion injury and SIRT4 gene highly expressed mice liver tissues, and the results are shown in fig. 7.

Immunofluorescent staining of liver tissue: 1) Baking slices: the paraffin sections prepared in step 3.2.1 were placed in an oven at 60 ℃ to bake the sections for 2h. 2) Dewaxing and hydration: the sections were placed in xylene 5min x 3 times; 100% ethanol for 5min×2 times; 95% ethanol for 5min;70% ethanol for 5min; ultrapure water was used 5min X2 times. 3) Citrate high pressure antigen retrieval: pouring a proper amount of tap water into the pressure cooker, and boiling under high pressure; pouring a proper amount of citrate antigen repairing working solution into a repairing box, putting the repairing box into an autoclave, and heating with strong fire until the repairing box is boiled; placing the slices on a high-temperature-resistant slice frame, then placing the slices into a repairing box, boiling the slices with strong fire, and continuing for about 5min; taking out the repairing box, putting the repairing box into tap water for cooling, and taking out the slices. 4) Rinsing with ultrapure water for 5min×2 times. 5) The slide holder was placed in 3% hydrogen peroxide and incubated at room temperature for 20min in the dark. 6) Rinse for 5min x 3 times with 1 x PBS. 7) Closing: the sections were placed flat in a wet box, 10% BSA was added dropwise to the sections, and the wet box was placed in a 37℃incubator for 30min. 8) The blocking solution was discarded, a suitable concentration of primary antibody (CD 68, GB11067, servicebio, 1:50 edition; ly6g, GB11229, servicebio, 1:50 edition) was prepared, the primary antibody was added dropwise to the sections, and the sections were placed in a wet box overnight at 4 ℃. 9) Taking out the wet box, and rewarming at 37 ℃ for 30min. 10 Primary antibody was discarded and 1×pbs was rinsed 10min×3 times. 11 Secondary antibodies were added dropwise and incubated at 37℃for 1h.12 Secondary antibody was discarded and 1×pbs rinsed 10min×3 times. 13 DAPI was added dropwise, and the resulting film was sealed, stored at 4℃and observed with a fluorescence microscope and photographed.

The results of FIG. 7 show that the number of CD11b positive inflammatory cells in liver tissue after hepatic ischemia reperfusion injury was significantly higher in SIRT4-KO mice than in WT mice (shown in FIG. 7A); in contrast, AAV-SIRT4 mice had significantly fewer CD11B positive inflammatory cells in liver tissue following hepatic ischemia reperfusion injury than AAV-GFP group mice (shown in B in fig. 7). Thus, SIRT4 gene knockout can significantly exacerbate liver ischemia reperfusion injury and is associated with inflammatory response.

In conclusion, the invention effectively overcomes the defects in the prior art and has high industrial utilization value. The above-described embodiments are provided to illustrate the gist of the present invention, but are not intended to limit the scope of the present invention. It will be understood by those skilled in the art that various modifications and equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.

Claims

Use of sirt4 as a drug target for screening a drug for preventing, alleviating or/and treating liver ischemic disease for diagnosis and treatment of non-disease, characterized in that the liver ischemic disease is a liver ischemic disease caused by ischemia reperfusion injury of the liver.
The use of sirt4 in the manufacture of a medicament for the prevention, alleviation and/or treatment of a liver ischemic disease, wherein the liver ischemic disease is a liver ischemic disease caused by ischemia reperfusion injury of the liver.
3. The use according to claim 2, wherein the medicament comprises a SIRT4 gene or a SIRT4 protein.
4. The use according to claim 3, wherein the medicament further comprises a pharmaceutically acceptable carrier.