CN106421815B - Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat - Google Patents

Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat Download PDF

Info

Publication number
CN106421815B
CN106421815B CN201610873011.XA CN201610873011A CN106421815B CN 106421815 B CN106421815 B CN 106421815B CN 201610873011 A CN201610873011 A CN 201610873011A CN 106421815 B CN106421815 B CN 106421815B
Authority
CN
China
Prior art keywords
dusp14
ischemia
reperfusion injury
rat
liver
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610873011.XA
Other languages
Chinese (zh)
Other versions
CN106421815A (en
Inventor
李红良
张晓晶
王晓占
毛文哲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan University WHU
Original Assignee
Wuhan University WHU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan University WHU filed Critical Wuhan University WHU
Priority to CN201610873011.XA priority Critical patent/CN106421815B/en
Publication of CN106421815A publication Critical patent/CN106421815A/en
Application granted granted Critical
Publication of CN106421815B publication Critical patent/CN106421815B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/916—Hydrolases (3) acting on ester bonds (3.1), e.g. phosphatases (3.1.3), phospholipases C or phospholipases D (3.1.4)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a kind of dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat, belong to the function and application field of gene.The present invention is using liver cell specificity Dusp14 knock out mice and Dusp14 transgenic mice as experimental subjects, the function of Dusp14 gene is studied by Ischemia-reperfusion Injury in Rat model, it was found that Dusp14 has the function of improving Ischemia-reperfusion Injury in Rat, therefore, Dusp14 is with following application: application of the Dusp14 as drug targets in the drug of screening prevention, alleviation and/or treatment Ischemia-reperfusion Injury in Rat, and screening prevention, the drug for alleviating and/or treating Ischemia-reperfusion Injury in Rat refer to that screening enough promotes the drug of Dusp14 expression；Application of the Dusp14 in preparation prevention, the drug alleviated and/or treat Ischemia-reperfusion Injury in Rat.

Description

Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat
Technical field
The invention belongs to the function of gene and application fields, are related to dual specificity phosphatase enzyme 14(Dusp14) hepatic ischemia again Application in perfusion injury, and in particular to Dusp14 is screening or preparing prevention, alleviating and/or treat Ischemia-reperfusion Injury in Rat Application in drug.
Background technique
Hepatic ischemia reperfusion (ischemia reperfusion, I/R) damage is in liver surgery or liver In transplanting, because the in vitro perfusion of liver blood flow blocking or liver donor causes hepatic ischemia/reperfusion injury, after Hepatic Perfusion restores, lead Hepar damnification is caused to aggravate the pathological processes of even dysfunction[1].Liver I/R damage is divided into according to the difference of ischemia Hot ischemic and two kinds of cooling jet flow, hot ischemic often occurs in conventional operation on liver and liver trauma, it is also possible to betide certain classes The toxic liver injury of type, hepatic sinusoid obstruction and Budd-Chiari syndrome etc.[2]；Cooling jet flow takes place mostly in organ transplant Preceding cryo-conservation[3].Liver I/R damages the damage for clinically often showing as liver function, incidence of complications and death Rate increases, and surgeon often needs to make difficult choosing between reduction intraoperative hemorrhage and reduction liver I/R damage occurrence risk It selects.The mechanism for leading to Ischemia-reperfusion Injury in Rat is more complicated, studies have shown that the activation of Kupffer cell, oxidative stress and The activation etc. of inflammatory cells signal path has been involved in this pathophysiological process[4]。
The research of mechanism and its precautionary measures about hepatic ischemia-reperfusion injury, for reducing liver I/R damage The degree for occurring or mitigating I/R damage reduces the complication of operation on liver, improves liver transfer operation success rate, promotes postoperative liver function Recovery, have important clinical meaning.For this problem, clinician explores numerous controls and mitigates I/R damage Method, including hypothermic anesthesia, controlled perfusion, hepatocyte in situ cooling down and the drug damaged using free radical resisting etc..But It is that clinical condition and patient's actual conditions limit the application and effect of the above method.
In cell, many albumen protein translation can all occur after synthesis after modification.And it is protein modified at these In, reversible phosphorylation modification of albumen is exactly a kind of modification acted on after very extensive protein translation.Protein kinase The phosphate group of endocellular liberation can be connected on substrate protein molecule by (protein kinase, PK), mediate substrate protein White hair gives birth to phosphorylation.The effect of phosphoprotein phosphatase (protein phosphatase, PP) and protein kinase is opposite, albumen Phosphatase can mediate substrate protein that dephosphorylation occurs.It is to be easiest to occur there are three types of amino acid residue in eukaryocyte Phosphorylation, be tyrosine (tyrosine, tyr), threonine (threonine, thr) and serine respectively (serine, ser).The amino acid sites that phosphorylation occurs are different, then the enzyme of corresponding dephosphorylation Be it is different, be respectively tyrosine phosphatase (protein tyrosine phosphatases, PTPs) and serine/ Threonine Phosphatases (protein serine/threonine phosphatases, PSPs).Dual specificity protein phosphatase (dual specificity protein phosphatases, DUSPs) has tyrosine phosphatase and serine/Soviet Union's ammonia The double action of acid phosphoric acid enzyme, not only can be with the dephosphorylation on catalytic tyrosine site, can also be with catalytic serine, Soviet Union Dephosphorylation on propylhomoserin site.
Dusp14 is a member in dual specificity phosphatase enzyme (DUSP) family, 198 amino of Dusp14 protein molecular overall length Acid, wherein containing the catalyst structure domain DSPs(Dual-specificity phosphatase of a dual specificity phosphatase enzyme Catalytic domain, DSPs).The catalytic activity region that phosphate group can be mediated to combine on Dusp14 molecule is H110CAAGVSR117, wherein active site is the 111st cysteine (cysteine111).Dusp14 initially as The cytoplasmic tail interaction albumen of CD28, wide expression is in the histoorgans such as the heart, liver, placenta[5].Studies have shown that Dusp14 can Adjust the phosphorylation level of ERK, JNK and P38 in primary T cells[5]；Dusp14 active site mutation (C111S) can activate ERK promotes Beta cell proliferation[6]；Dusp14 passes through TAK1-P38/JNK signal path myocardial hypertrophy caused by aortic coaractation It is middle to play important protective effect[7], and its effect in hepatic ischemia-reperfusion injury is unclear.
Bibliography:
1. Kapoor S. Hepatic ischemia-reperfusion injury from bench to bedside (Br J Surg 2010; 97: 1461-1475). Br J Surg. 2011; 98(3):459, 459-460.
2. Lentsch A B, Kato A, Yoshidome H, et al. Inflammatory mechanisms and therapeutic strategies for warm hepatic ischemia/reperfusion injury. Hepatology. 2000; 32(2):169-173.
3. Busuttil R W, Tanaka K. The utility of marginal donors in liver transplantation. Liver Transpl. 2003; 9(7):651-663.
4. Massip-Salcedo M, Rosello-Catafau J, Prieto J, et al. The response of the hepatocyte to ischemia. Liver Int. 2007; 27(1):6-16
5. Marti F, Krause A, Post NH, Lyddane C, Dupont B, Sadelain M, King PD (2001) Negative-feedback regulation of CD28 costimulation by a novel mitogen-activated protein kinase phosphatase,MKP6. J Immunol. 2001; 166:197– 206
6. Klinger S, Poussin C, Debril MB, et al. Increasing GLP-1-induced b-cell proliferation by silencing the negative regulators of signaling cAMP response element modulator-α and Dusp14. Diabetes. 2008; 57:584–593.
7. Li CY, Zhou Q, Yang LC, et al. Dual-specificity phosphatase 14 protects the heart from aortic banding-induced cardiac hypertrophy and dysfunction through inactivation of TAK1-P38MAPK/-JNK1/2 signaling pathway. Basic research in cardiology. 2016; 111(2):19。
Summary of the invention
For the defect and deficiency for solving the clinical prevention Ischemia-reperfusion Injury in Rat prior art, it is an object of the invention to true Determine the correlation between the expression and Ischemia-reperfusion Injury in Rat of Dusp14 gene, one kind is provided and is filled again for treating hepatic ischemia The new opplication of the target gene Dusp14 of damage is infused, i.e. Dusp14 is lacked as drug targets in screening prevention, alleviation and/or treatment liver Application and Dusp14 in the drug of blood reperfusion injury are in preparation for preventing, alleviating and/or treating law during ischemia/reperfusion Application in the drug of damage, and then the treatment Dusp14 gene applied to Ischemia-reperfusion Injury in Rat.
The purpose of the invention is achieved by the following technical solution:
The present invention is led to using liver cell specificity Dusp14 knock out mice and Dusp14 transgenic mice as experimental subjects Cross the function of Ischemia-reperfusion Injury in Rat model research Dusp14 gene.The result shows that: compared with wild type C57BL/6 mouse, Liver cell specificity Dusp14 knock out mice hepatic necrosis area obviously increases；Compared with nontransgenic mice, Dusp14 The hepatic necrosis area of transgenic mice is then obviously reduced.This prompt Dusp14 gene has the function of liver function protecting, to grind Study carefully Dusp14 effect played in the novel targets and new strategy of prevention and treatment hepatic ischemia disease and provides theoretical foundation and clinical base Plinth.
Research of the invention demonstrates: in Ischemia-reperfusion Injury in Rat model, Dusp14, which has, to be inhibited hepatic necrosis, subtracts The effect of few hepatocellular apoptosis, liver function protecting.
A kind of function of Dusp14 gene in Ischemia-reperfusion Injury in Rat, being mainly reflected in Dusp14 has protection liver function The effect of energy, especially Dusp14 have the function of improving Ischemia-reperfusion Injury in Rat.
Improve the function of Ischemia-reperfusion Injury in Rat for Dusp14, Dusp14 has following application:
Dusp14 is as drug targets in screening prevention, the drug alleviated and/or treat Ischemia-reperfusion Injury in Rat Using.The application is the purpose of non-diagnosing and treating；Screening prevention, alleviation and/or the treatment Ischemia-reperfusion Injury in Rat Drug, refer to screening enough promote Dusp14 expression drug.
Application of the Dusp14 in preparation prevention, the drug alleviated and/or treat Ischemia-reperfusion Injury in Rat.
The present invention has the following advantages and effects with respect to the prior art:
(1) present invention discover that the new function of Dusp14 gene, i.e. Dusp14 gene are able to suppress hepatic tissue ischemia-reperfusion Damage, and it is closely related with hepatocellular apoptosis.
(2) effect in hepatic ischemia disease is being inhibited based on Dusp14, is can be used for screening or preparing prevention, alleviates And/or the drug for the treatment of Ischemia-reperfusion Injury in Rat.
Detailed description of the invention
Fig. 1 is liver cell specificity Dusp14 knock out mice and Dusp14 transgenic mice construction strategy figure.A is liver The construction strategy figure of cell-specific Dusp14 knock out mice；B is the structure of liver cell specificity Dusp14 transgenic mice Build policy map.
Fig. 2 is Western Blot detection liver cell specificity Dusp14 knock out mice and Dusp14 transgenic mice The result figure of Dusp14 expression quantity in liver organization.A is the testing result figure of liver cell specificity Dusp14 knock out mice； B be liver cell specificity Dusp14 transgenic mice testing result figure (TG1, TG2, TG3, TG4 indicate that different transgenosis is small Mouse individual).
Fig. 3 is the downright bad situation comparison diagram of mouse liver in different time points.A is WT and Dusp14-KO mouse in difference Time point liver HE colored graph and necrosis area count histogram；B is NTG and Dusp14-TG mouse liver in different time points HE colored graph and necrosis area statistics histogram (0.05 vs of #:P < corresponds to I/R group).
Fig. 4 mouse content statistical comparison figure of serum alt and AST in different time points.A is that WT and Dusp14-KO is small Liver serum alt and the content of AST count histogram to mouse in different time points；B is NTG and Dusp14-TG mouse in difference Time point liver serum alt and the content of AST count histogram (0.05 vs WT Sham group of *: P <；0.05 vs of #:P < WT/NTG corresponds to time point I/R group).
Fig. 5 mouse ischemic Reperfu- sion for 24 hours when TUNEL cell number column statistical chart.A is WT and Dusp14-KO mouse Reperfu- sion for 24 hours when TUNEL immunofluorescence column statistical chart；B be NTG and Dusp14-TG mouse Reperfu- sion for 24 hours when TUNEL Immunofluorescence column statistical chart (0.05 vs of #:P < corresponds to I/R group).
Specific embodiment
Present invention will now be described in further detail with reference to the embodiments and the accompanying drawings, but embodiments of the present invention are unlimited In this.
Animal for research and raising:
Experimental animal: select 8-10 week old, weight in 24g-27g, the wild-type mice that background is male C57BL/6 strain (WT is purchased from Beijing HFK Bio-Technology Co., Ltd.), liver cell specificity Dusp14 knock out mice (Dusp14-KO) it (is tested by Wuhan University animal experimental center teacher Li Hongliang with Dusp14 transgenic mice (Dusp14-TG) Room building), nontransgenic mice (NTG, littermate control nontransgenic mice) be experimental subjects.
Feeding environment: all experiment mices are raised in Wuhan University SPF grades of Experimental Animal Center.SRF grades of mouse feeds Purchased from Beijing HFK Bio-Technology Co., Ltd..Rearing conditions: room temperature between 22-24 DEG C, humidity 40-70% it Between, it is 12h that light and shade, which replaces lighting hours, and free water is ingested.
The building of 1 liver cell specificity Dusp14 knock out mice of embodiment and Dusp14 transgenic mice
(1) building of liver cell specificity Dusp14 knock out mice (construction strategy is shown in Figure 1A)
According to the information of Dusp14 gene, one is respectively designed in introne 2 and 3 respectively using CRISPR Design The target practice site of CRISPR.Target sequence is respectively as follows:
Dusp14-sRNA1:ggATAAGTCATTTTCTATTGACCAT TGG；
Dusp14-sRNA2:GGTTCTCCCGAGAGGGTTTCTACGC TGG.
Furthermore the donor vehicle (Donor Vector) for homologous reparation has also been devised, it includes that two sides are homologous Arm, intermediate exon 3 and two loxp sequences in the same direction.
1) building of targeting vector: corresponding two primers of sgRNA1 and sgRNA2 are fused into double-stranded DNA respectively, then It is connected into T4 DNA ligase by the processed pUC57-sgRNA(Addgene 51132 of restriction enzyme BsaI) carrier In.There is a T7 promoter in the carrier upstream, can be used for subsequent In vitro transcription.
2) conditionity knocks out the building of skeleton carrier pBluescript SK (+) -2loxp:
It is respectively synthesized 4 oligomerization single stranded nucleotide sequences:
Loxp1-F:AGCTTGACGTCATAACTTCGTATAGCATACATTATAGCAATTTATACC GGTGAT；
Loxp1-R:ATCACCGGTATAAATTGCTATAATGTATGCTATACGAAGTTATGACGT CA；
Loxp2-F:GATCCCTTAAGATAACTTCGTATAGCATACATTATAGCAATTTATACG CGTA；
Loxp2-R:CTAGTACGCGTATAAATTGCTATAATGTATGCTATACGAAGTTATCTT AAGG；
Two double-strands of loxp1 and loxp2 are formed after above-mentioned oligonucleotide sequence annealing.By pBluescript II SK (+) Carrier HindIII(NEB, R0104L) and EcoRV(NEB, R0195L) connect after double digestion and anneal double-strand into loxp1, then will Correct carrier BamHI(NEB, R0136L is sequenced) and SpeI(NEB, R0133L) double digestion, it connects double into loxp2 annealing Chain obtains conditionity and knocks out skeleton carrier, is named as pBluescript SK (+) -2loxp.
3) building of donor vehicle (Donor Vector): according to design of primers principle, designing following primer (table 1), with Mouse gDNA is template, expands the left and right homology arm (LA and RA) of donor vehicle and the exon part (M) of centre.Above-mentioned expansion It connects, obtains after increasing obtained product and pBluescript SK (+) -2loxp the carrier digestion with restriction enzyme shown in the table 1 To donor vehicle.
Primer sequence needed for table 1 constructs donor vehicle and corresponding restriction enzyme site
4) transcription of targeting vector: (it is responsible for the Cas9 egg of dissection in two parts for including to CRIPR/Cas9 system White and guidance Cas9 albumen navigates to the gRNA of target site) it is transcribed respectively.For Cas9 albumen, by its expression vector PST1374-Cas9(Addgene 44758) with PmeI digestion is carried out, to recycle linearization plasmid after purification as transcription templates, use T7 mMESSAGE mMACHINE kit (AM1345, Ambion) is transcribed in vitro, and capped mRNA product is obtained.It is used in combination Poly (A) Tailing kit (Ambion) obtains mature mRNA product to above-mentioned product tailing；For sgRNA, make With MEGAshortscript Kit(AM1354, Ambion company) it is transcribed in vitro.Will the obtained Cas9 of transcription and The mRNA of sgRNA use miRNeasy Micro Kit(Qiagen, 217084) purified.
5) production of Dusp14-floxed conditionity knock-out mice
The mRNA product of above-mentioned maturation is injected in mouse fertilized egg together with donor vehicle, is transplanted in replace-conceive rat body It is cultivated.Obtained mouse is identified.Raw mouse toe or tail tissue after a week is taken out, extracts genome, and lead to It crosses PCR method screening positive head and builds mouse.From determine occur homologous recombination mouse in select at random one be only used as F0 generation carry out after Continuous breeding, it is final to obtain Dusp14-floxed Mice homozygous.
6) production of liver cell specificity Dusp14 knock out mice
Above-mentioned Dusp14-floxed mouse and liver specificity Alb-Cre(are purchased from The Jackson Laboratory, article No. 003574) transgenic mice mating, it screens and obtains Dusp14floxed/floxed/ Alb-Cre mouse, to this Mouse is long to after 6 week old or so, and Tamoxifen is injected intraperitoneally, induces the expression of Cre enzyme, identification two of Cre enzyme spcificity are same To loxp, and cut off sequence between the two and one of loxp, finally obtain liver cell specificity Dusp14 gene Knock-out mice.
Detection liver cell specificity Dusp14 knock out mice is tested by immunoblotting (Western Blot) The expression quantity of Dusp14 albumen in liver.Hepatocyte is extracted, polyacrylamide gel electrophoresis (SDS-PAGE), verifying are passed through Dusp14 expression, is as a result shown in Fig. 2A.Compared to wild-type mice, in liver cell specificity Dusp14 knock out mice liver cell Dusp14 albumen is hardly expressed.
(2) building of liver cell specificity Dusp14 transgenic mice (construction strategy is shown in Figure 1B)
Using wild type C57BL/6 mouse Dusp14 gene cDNA as template, with upstream primer (5 '-TGCTCTAGAGCCAC CATGAGCTCCAGAGGTCACAG-3 '), downstream primer (5 '-TGCTCTAGACTAAATCCCCCAATAAGGCA-3 ') amplification it is small Mouse Dusp14 gene (NCBI, Gene ID:56405, NM_019819.3), the product and pCAG-CAT- that amplification is obtained (Beijing Union Medical College basis institute teacher Yang Qinglin laboratory provides LacZ carrier, and preparation process is referring to bibliography: Kim T, Zhelyabovska O, Liu J, et al. Generation of an Inducible, Cardiomyocyte- Speci fi c Transgenic Mouse Model with PPAR b/d Overexpression[J]. Peroxisome Proliferator-Activated Receptors (PPARs), 57.) XbaI(NEB, # R0145L are used) it connects after digestion, Transgene carrier pCAG-loxP-CAT-loxP-Dusp14-hGHpA is obtained, the expression of Dusp14 is driven by CAG promoter It arrives.The carrier of building is configured to fertilized embryo (C57BL/6J background) by microinjection, Dusp14-floxed is obtained and turns base Because of mouse.Liver cell specificity Dusp14 transgenic mice is purchased from The by Dusp14-floxed transgenic mice and Alb-Cre( Jackson Laboratory, article No. 003574) mouse hybrid breeds to obtain.
Dusp14 albumen in different transgenic mice livers is detected by immunoblotting (Western Blot) experiment Expression quantity.Different transgenic mice liver organization albumen are extracted, polyacrylamide gel electrophoresis (SDS-PAGE), verifying are passed through Dusp14 is overexpressed, and as a result sees Fig. 2 B.Compared to wild-type mice, liver cell specificity Dusp14 transgenic mice liver organization Middle Dusp14 protein expression content significantly improves.
2 mouse Ischemia-reperfusion Injury in Rat of embodiment (ischemia/reperfusion injury, I/R) model obtains ?
(1) experimental animal is grouped: male C57BL/6 strain wild-type mice, liver cell specificity Dusp14 gene knockout Mouse and Dusp14 transgenic mice, nontransgenic mice establish Ischemia-reperfusion Injury in Rat mould by hepatic ischemia reperfusion Type (I/R).It is randomly divided into 8 groups: C57BL/6J strain wild-type mice sham-operation group (WT Sham) and I/R operation group (WT I/ R), liver cell specificity Dusp14 knock out mice sham-operation group (KO Sham) and I/R operation group (KO I/R), non-turn base Because of mouse sham-operation group (NTG Sham) and I/R operation group (NTG I/R), liver cell specificity Dusp14 transgenic mice artificial hand Art group (TG Sham) and I/R operation group (TG I/R).
(2) Ischemia-reperfusion Injury in Rat I/R model surgery (using noninvasive blood vessel clip folder close middle period and lobus sinister portal vein and Arteria hepatica makes about 70% hepatic ischemia/reperfusion injury) operating process:
1) operation consent 12h gives mouse fasting, can free water.
2) after operation consent 3% yellow Jackets success anesthetized mice, fixed limb is lieed down, with shaver by mouse Abdomen art area hair shaves, and is sterilized with 10% tincture of iodine and 75% ethyl alcohol to art area.
3) take median abdominal incision into abdomen, an exposure liver left side, the hepatic pedicle in middle period.
4) portal vein and arteria hepatica that middle period and lobus sinister are closed with noninvasive blood vessel clip folder, make about 70% hepatic ischemia/reperfusion injury, to prevent Serious mesenteric vein extravasated blood occurs.After 0.5min, compared with non-blacked lobus dexter, it is seen that block leaf bleach, illustrate block at Function.At this point, paying attention to the record ischemic time started, maintains ischemic about 60 minutes, during which cover notch with wet saline gauze, and infuse It anticipates the heat preservation of mouse (mouse of Sham group successfully removes blood vessel clip blocking at once, recovery ischemic hepatic blood flow).
5) ischemic removes blood vessel clip after sixty minutes, restores the liver blood flow of ischemic, is then shut off abdominal cavity, point two layers of pass abdomen, First internal layer is sewed it up, then stitches skin, postoperative mouse is placed in clean cage and is individually raised, is observed.
The measurement of 3 hepatic necrosis area of embodiment and liver function index (AST, ALT)
The evaluation index of hepatic ischemia-reperfusion injury severity mainly includes hepatic necrosis area and liver function index (AST, ALT), these indexs are positively correlated with hepatic ischemia-reperfusion injury severity.
(1) it draws materials
Respectively at postoperative 1h, 3h, 6h, sham-operation group (Sham) and ischemia-reperfusion group mouse are taken for 24 hours, at cervical dislocation Extremely, blood 1mL is taken from inferior caval vein immediately, separates serum.Ischemic region left lobe of liver tissue size about 1.5cm × 1cm is uniformly taken simultaneously × 0.2cm fixation in 10% neutral formalin is dehydrated afterwards for 24 hours, is embedded, and carries out HE dyeing after carrying out paraffin section.
Separation serum: the EP pipe for collecting blood stands 1-2h at room temperature makes blood natural coagulation.4℃,4000rpm/min It is centrifuged 30min, is sufficiently separated serum.Draw that 20 μ L of serum, 20 μ L, 30 μ L, that 30 μ L set 0.2mL is sterile respectively with micropipettor In EP pipe, EP pipe is marked, it is spare to be then stored in -80 DEG C of refrigerators.
(2) paraffin specimen slice is prepared
1) primary operational program includes: embedding frame processing → flowing water flushing → dehydration → transparent → waxdip → embedding → slice → booth piece → is spare after drying or toasting.
2) paraffin section for cutting 5 μm with the standardization program of paraffin slicing machine is spare.
(3) HE is dyed
Key step are as follows: 55 DEG C of baking 30min → dimethylbenzene 5min, 3 times → 100% alcohol of alcohol 1min → 95% 1min → The 70% alcohol 1min → distilled water 1min → haematoxylin solution 5min → hydrochloride alcohol of washing 1min → 1% 1-3s → washing 1min → Scott liquid (sodium bicarbonate 0.35g, magnesium sulfate 2g, distilled water 100mL) 1min → washing 1min → Yihong solution 3-5min → steaming Distilled water washes away loose colour → 70% alcohol of alcohol 1s → 95% alcohol of 1s → 100% 30s, 3 times → dimethylbenzene 2min, and 3 times → take advantage of dimethylbenzene Drying, microscope are taken pictures in not dry mounting → draught cupboard immediately.
(4) mice serum ALT, AST assay
1) serum sample is taken out from -80 DEG C of refrigerators, be immediately placed on ice, melted at room temperature to sample；
2) it at room temperature, is centrifuged 1 minute for 4000 revs/min, the serum of EP tube wall is allowed to assemble to tube bottom.
3) it according to operating process, opens automatic clinical chemistry analyzer (Sysmex, Chemix 180i), cleans sample injector.
4) according to the flag sequence of automatic clinical chemistry analyzer sample disc, it is put into EP pipe to be measured one by one.
5) reagent detection plate is accurately installed, begins to use automatic clinical chemistry analyzer detection ALT, AST horizontal.
HE coloration result of Dusp14-KO, WT, Dusp14-TG and NTG group after hepatic ischemia-reperfusion injury is shown in Fig. 3: Visible Sham group hepatic tissue is normal under microscope, and hepatic tissue structure is neat, without apparent proliferation of fibrous tissue.I/R group with The extension of the time of Reperfu- sion, hepatic tissue structural fuzzy it is disorganized.It differs in size in it, necrosis in irregular shape Stove, liver cell structural fuzzy in necrosis region, disorganized, detachment are shown in big compared with normal liver in the lobuli hepatis of necrotic liver Piece necrosis region, the visible inflammatory reaction band in necrotic tissue edge, liver cell nuclear occur typical necrosis and change, it is seen that karyopycnosis.This Kind phenomenon peaks for 24 hours after ischemia-reperfusion.The experimental results showed that giving the infarct size after Dusp14-KO mouse I/R Significantly greater than WT group mouse (Fig. 3 A)；Infarct size after same Dusp14-TG mouse I/R is significantly less than NTG group mouse (figure 3B), therefore, Dusp14 damaged caused by hepatic ischemia reperfusion in play an important role.
Serum alt and the content statistical result of AST are shown in Fig. 4.The result shows that horizontal in I/R group each time point ALT, AST Obviously higher than Sham group, 6h peaks after Reperfu- sion, then declines, ALT, AST water after Dusp14-KO mouse I/R It is flat to be apparently higher than WT group mouse (Fig. 4 A)；ALT, AST level after Dusp14-TG mouse I/R is substantially less than NTG group mouse (figure 4B).
Hepatocellular apoptosis situation measures after 4 ischemia-reperfusion of embodiment
Detection apoptosis, UNEL kit: ApopTag Plus In Situ Apoptosis are dyed with TUNEL kit Fluorescein Detection Kit(S7111, Chemicon).Detailed process are as follows:
1) paraffin section is placed in oven, 60 DEG C roasting piece 30 minutes；
2) dimethylbenzene, 5 minutes × 3 times；
3) 100% ethyl alcohol, 5 minutes × 2 times；95% ethyl alcohol, 5 minutes；70% ethyl alcohol, 5 minutes；
4) ddH2O rinsing, 5 minutes × 2 times；
5) it is incubated for 15 minutes for 37 DEG C of Proteinase K；
6) PBS rinses 5min × 2 time；
7) Equilibration Buffer is directly added dropwise in tissue (13 μ L/cm2), it is incubated at room temperature at least 10s；
8) Equilibration Buffer is discarded, TdT Enzyme working solution (77 μ L Reaction Buffer are added dropwise + 33 μ L TdT Enzyme) in tissue (11 μ L/cm2), wet box is set in 37 DEG C of incubation 1h；
9) slice is placed in and fills Stop/Wash Buffer working solution (1mL Stop/Wash Buffer+34mL ddH2O it is incubated at room temperature in 10min(waiting process after vibrating 15s in staining jar), by the Anti-Digoxigenin of appropriate amount Conjugate is sucked out, and as in EP pipe, avoid light place at room temperature, makes its balance to room temperature)；
10) PBS rinses 1min × 3 time；
11) tissue surrounding liquid is inhaled 3 and Anti-Digoxigenin is added dropwise by the liquid for gently getting rid of tissue excessive residual Fluorescein working solution (53%Blocking Solution+ 47%Anti-Digoxigenin Conjugate) is in tissue Upper (13 μ L/cm2), it sets room temperature in wet box and is protected from light incubation 30min；
12) PBS rinses 2min × 4 time (PBS renewed every time)；
13) SlowFade Gold antifade reagent with DAPI(Invitrogen, S36939) mounting；It is glimmering Light under the microscope, is taken pictures.If needing to save, 4 DEG C of preservations in dark wet box.
The postoperative 24 hours hepatocellular apoptosis situations of each group mouse I/R are had detected by TUNEL kit, as a result such as Fig. 5 institute Show, Dusp14-KO mouse liver cell apoptosis quantity obviously increases (Fig. 5 A) than wild-type mice, Dusp14-TG mouse liver cell Apoptosis quantity obviously reduces (Fig. 5 B) than nontransgenic mice, this shows that Dusp14 withers with cell when liver cell ischemia-reperfusion Die correlation.These results indicate that hepatic tissue ischemical reperfusion injury, and and hepatocellular apoptosis can be inhibited by increasing Dusp14 expression It is closely related.
The above results show caused by hepatic ischemia reperfusion in damage, liver cell specificity Dusp14 gene knockout Mouse liver necrosis area dramatically increases, and liver function is substantially reduced, and hepatocellular apoptosis quantity also increased significantly；And liver cell is special Property Dusp14 transgenic mice hepatic necrosis area significantly reduce, liver function enhancing, hepatocellular apoptosis quantity significantly reduces.Card Bright Dusp14 gene has important protective effect in hepatic ischemia/reperfusion injury disease model.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention, It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Wuhan University
<120>dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat
<130> 1
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 28
<212> DNA
<213> Mus musculus
<400> 1
ggataagtca ttttctattg accattgg 28
<210> 2
<211> 28
<212> DNA
<213> Mus musculus
<400> 2
ggttctcccg agagggtttc tacgctgg 28
<210> 3
<211> 54
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp1-F
<400> 3
agcttgacgt cataacttcg tatagcatac attatagcaa tttataccgg tgat 54
<210> 4
<211> 50
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp1-R
<400> 4
atcaccggta taaattgcta taatgtatgc tatacgaagt tatgacgtca 50
<210> 5
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp2-F
<400> 5
gatcccttaa gataacttcg tatagcatac attatagcaa tttatacgcg ta 52
<210> 6
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> loxp2-R
<400> 6
ctagtacgcg tataaattgc tataatgtat gctatacgaa gttatcttaa gg 52
<210> 7
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 LA-F
<400> 7
ggggtacccc ggctcaatga tttcctct 28
<210> 8
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 LA-R
<400> 8
gcgtcgacca ttgggagatg tagcctgca 29
<210> 9
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 M-F
<400> 9
tctaccggtg tcaatagaaa atgacttata tgcttc 36
<210> 10
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 M-R
<400> 10
gaccttaagt agaaaccctc tcgggagaac 30
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 RA-F
<400> 11
cgacgcgtcg ctgggtgttc gggtt 25
<210> 12
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Dusp14 RA-R
<400> 12
ataagaatgc ggccgccctg gctgataaaa gggaaa 36
<210> 13
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223>upstream primer
<400> 13
tgctctagag ccaccatgag ctccagaggt cacag 35
<210> 14
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223>downstream primer
<400> 14
tgctctagac taaatccccc aataaggca 29

Claims (2)

1.Dusp14 answering in screening prevention, the drug alleviated and/or treat Ischemia-reperfusion Injury in Rat as drug targets With, it is characterised in that: the application is the purpose of non-diagnosing and treating；Screening prevention, alleviation and/or the treatment liver lacks The drug of blood reperfusion injury refers to that screening enough promotes the drug of Dusp14 expression.
Application of the 2.Dusp14 in preparation prevention, the drug alleviated and/or treat Ischemia-reperfusion Injury in Rat.
CN201610873011.XA 2016-09-30 2016-09-30 Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat Active CN106421815B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610873011.XA CN106421815B (en) 2016-09-30 2016-09-30 Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610873011.XA CN106421815B (en) 2016-09-30 2016-09-30 Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat

Publications (2)

Publication Number Publication Date
CN106421815A CN106421815A (en) 2017-02-22
CN106421815B true CN106421815B (en) 2019-08-20

Family

ID=58171859

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610873011.XA Active CN106421815B (en) 2016-09-30 2016-09-30 Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat

Country Status (1)

Country Link
CN (1) CN106421815B (en)

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Dusp14 protects against hepatic ischaemia-reperfusion injury via Tak1 suppression;Wang X et al.;《J Hepatol》;20170906;118-129
Inhibiton of NF-kappaB activation during ischemia reduces hepatic ischemia/reperfusion injury in rats;Matsui N et al.;《J Toxicol Sci》;20050531;103-110
The dual-specificity phosphatase DUSP14 negatively regulates tumor necrosis factor- and interleukin-1-induced nuclear factor-κB activation by dephosphorylating the protein inase TAK1;Zheng H et al.;《J Biol Chem》;20121210;819-825

Also Published As

Publication number Publication date
CN106421815A (en) 2017-02-22

Similar Documents

Publication Publication Date Title
Shen et al. Conditional knockout of focal adhesion kinase in endothelial cells reveals its role in angiogenesis and vascular development in late embryogenesis
JP6199936B2 (en) Tissue regeneration promoter by mobilization of bone marrow mesenchymal and / or pluripotent stem cells in blood
Simonet et al. Pulmonary malformation in transgenic mice expressing human keratinocyte growth factor in the lung.
Li et al. c-Jun is essential for organization of the epidermal leading edge
Di Siena et al. Activated c-Kit receptor in the heart promotes cardiac repair and regeneration after injury
CN104450602B (en) Non-human mammal animal model of neuropsychiatric disease and preparation method and application thereof
Simirskii et al. Conditional deletion of β1-integrin from the developing lens leads to loss of the lens epithelial phenotype
Oshima et al. Angiogenic acceleration of Neu induced mammary tumor progression and metastasis
Wu et al. Microphthalmia resulting from MSX2-induced apoptosis in the optic vesicle
CN106620721A (en) Application of monocyte chemotactic protein-1 induced protein 1 (Mcpip1) to hepatic ischemia reperfusion injury
Cho et al. Partial rescue of the Na+-Ca2+ exchanger (NCX1) knock-out mouse by transgenic expression of NCX1
CN111154802B (en) Application of ECM1 gene knockout mice in screening anti-hepatic fibrosis drugs
CN106421815B (en) Dual specificity phosphatase enzyme 14(Dusp14) application in Ischemia-reperfusion Injury in Rat
CN111485003B (en) Construction method and application of retinal vascular disease model
KR101133289B1 (en) A composition containing zebrafish AKAP?? and a use of AKAP?? mutant zebrafish as a animal model
Yee et al. Cardiac and neurological abnormalities in v-fps transgenic mice.
Akhmametyeva et al. Regulation of the neurofibromatosis 2 gene promoter expression during embryonic development
CN105031654A (en) Method for improving blood-brain barrier permeability by regulating Swiprosin-1 expression
Fu et al. A hemidesmosome-to-cytoplasm translocation of small heat shock proteins provides immediate protection against heat stress
CN106620722A (en) Application of TNF (tumor necrosis factor) receptor associated factor 5 (Traf5) to ischemia reperfusion injury
CN106492230B (en) Function and application of the leukocytic immunity globulin sample receptor B4 in treatment nonalcoholic fatty liver and type II diabetes
CN106310225B (en) Application of caspase recruitment domain protein 6 (Card 6) in liver ischemia-reperfusion injury
CN106699867A (en) Leg1 protein, Leg1 gene and application thereof to non-human animals
CN103784974A (en) Application of interferon regulatory factor 8 (IRF8) in cerebral apoplexy disease
CN110551691A (en) construction of idiopathic basal ganglia calcification pathogenic gene mutation mouse model

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant