CN106282406A - Cucumber green mottle mosaic LAMP primer, test kit and detection method - Google Patents
Cucumber green mottle mosaic LAMP primer, test kit and detection method Download PDFInfo
- Publication number
- CN106282406A CN106282406A CN201610649681.3A CN201610649681A CN106282406A CN 106282406 A CN106282406 A CN 106282406A CN 201610649681 A CN201610649681 A CN 201610649681A CN 106282406 A CN106282406 A CN 106282406A
- Authority
- CN
- China
- Prior art keywords
- primer
- lamp
- mottle mosaic
- green mottle
- cucumber green
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention discloses cucumber green mottle mosaic LAMP primer, test kit and detection method, wherein said primer includes: forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reversely inner primer BIP.The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber green mottle mosaic LAMP primer；It is a further object to provide a kind of test kit comprising above-mentioned primer；It is a further object to provide a kind of method using mentioned reagent box detection cucumber green mottle mosaic, this detection method has: primer specificity is strong, equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result directly can be with features such as interpretations.
Description
Technical field
The present invention relates to a kind of cucumber green mottle mosaic LAMP primer, the invention still further relates to a kind of include above-mentioned primer
Test kit；The invention still further relates to a kind of method using mentioned reagent box detection cucumber green mottle mosaic.
Background technology
Cucumber green mottle mosaic virus Cucumber green mottle mosaic virus, CGMMV is Tobacco mosaic
Tobamovirus Tobamovirus member, for single strand RNA virus, the shaft-like 300nm × 18nm of virion.Cucumber green mottle mosaic
Poison is typical Seed-borne Virus, and stable strong, main Distribution Area Britain in Europe, Germany, Holland, Denmark, Russia, uncommon
Cured, Austrian, Czechoslovakia, Finland, Yugoslavia, Romania, Poland, Hungary, Spain, Sweden, Ukraine,
LV Latvia；Brazil of South America；The Japan in Asia, India, Korea S, Pakistan, Israel, Saudi Arabia, Iran, in
Some areas, state continent and Taiwan Province etc..Along with world economy and trade contact frequently, various countries and interlocal introduce a fine variety and plant matter and hand over
Change so that the constantly diffusion of this virus, extensively occur in some calabash crop growing spots.China 2005 is first in Liaoning Middle area
Secondary discovery cucumber green mottle mosaic virus infects Citrullus vulgaris, and occurs serious, and susceptible watermelon flesh is overdone shape, make crop quality and
Yield significantly declines, so that causing great economic loss.This virus natural infection is mainly the Fructus Cucumidis sativi of cucurbitaceous plant, west
Melon, Fructus Melo, Pericarpium Lagenariae hispidae, Fructus Cucurbitae moschatae, calabash, Fructus Luffae, Fructus Momordicae charantiae etc., Fructus Cucumidis sativi Symptoms is that blade is mottled and protruding, lopsided, causes plant
Downgrading, fruit can produce Huang or silver color streak, fruit is badly damaged, and yield can decline 15%；Infected water melon leaf light-duty
Leaf mottle, plant dwarfing, fruit maturation phase serious symptom, fruit surface strong green circle speckle, there is sarcocarp variable color and rots in inside.
It is the major transmission path of CGMMV with seed culture of viruses and mechanical inoculation, such as the Citrullus vulgaris mode of production of calabash seedling grafting
Being the key factor of this disease generation diffusion, the susceptible seed as stock is also mainly to infect source.These Cucurbitaceae are made at present
This virus kind of thing also nonreactive.Therefore, strengthen the quarantine introducing Cucurbitaceae seed, the Citrullus vulgaris, sweet particularly lesion introduced
Melon, the virus quarantine of the seeds such as Fructus Cucurbitae moschatae is the best measure blocking or suppressing this virus that diffusion occurs.
The detection method of plant virus mainly has biology, serology and molecular biology three kinds, biological method at present
It is exactly the presence or absence detecting virus with virus indicator plant, it is generally required to 7-10 days；Serological method is to resist according to antigen
The specific binding of body detects virus, typically has only to about 4-6 hour, it require that specific antiserum, and
Detection sensitivity is the highest, there is also non-specific problem；Molecular biology method is primarily referred to as PCR method, the method fast and
Accuracy is the highest, however it is necessary that detecting instrument and the relevant device of costliness, and for as this virus of CGMMV, virus
Particle is highly stable, though dilution for many times, it may have infecting potential, therefore the detection method needing sensitivity the highest could be by potential
CGMMV detect, three of the above method sensitivity is all difficult to reach, and so will there is the possibility of missing inspection, thus be badly in need of
Study new detection method.
Summary of the invention
The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber green mottle mosaic
LAMP primer；
It is a further object to provide a kind of test kit comprising above-mentioned primer；
It is a further object to provide a kind of method using mentioned reagent box detection cucumber green mottle mosaic,
This detection method has: primer specificity is strong, and equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result
Directly can be with features such as interpretations.
In order to achieve the above object, the present invention uses below scheme:
A kind of cucumber green mottle mosaic LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’。
One cucumber green mottle mosaic LAMP kit of the present invention, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
The wherein product specification of this test kit: 40 times.
Cucumber green mottle mosaic LAMP kit as above, it is characterised in that described LAMP reactant liquor buffer
Composed of the following components:
Cucumber green mottle mosaic LAMP kit as above, it is characterised in that described fluorescent dye is that calcium is yellowish green
Element；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
One cucumber green mottle mosaic LAMP detection method of the present invention, it is characterised in that comprise the following steps:
A, extraction sample RNA；
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put into sterilizing examination
Guan Zhong, prepares premixed liquid on ice；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on sterilizing test tubes
Bottom；20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CGMM VRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes；
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side
Face carries out sight and looks into；If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control
Fluorescence, and it is judged to feminine gender.
Cucumber green mottle mosaic LAMP detection method as above, it is characterised in that extract sample described in step A
RNA, extracts the most according to the following steps:
A1, take 0.1g the susceptible tissue of CGMMV and CMV add 1mL extraction buffer be ground；
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O；
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption；
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times；
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min；
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is CGMMV's and CMV
RNA。
Cucumber green mottle mosaic LAMP detection method as above, it is characterised in that step E middle-ultraviolet lamp irradiates dress
The ultraviolet ray range put: wavelength 240-260nm or 350-370nm.
Cucumber green mottle mosaic LAMP detection method as above, it is characterised in that in described primer, outer primer is with interior
The ratio of primer is l:2-1:10.
Cucumber green mottle mosaic LAMP detection method as above, it is characterised in that described primer is just including 1.6 μ l
Outwards primers F 3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber green mottle mosaic LAMP detection method as above, it is characterised in that expand temperature in step D preferred
It it is 63 DEG C.
In sum, relative to prior art, it provides the benefit that the present invention:
The present invention uses paramagnetic particle method extract the RNA of CGMMV and set according to the coat protein encoding gene of the main strain of CGMMV
Count the universal primer of the LAMP amplification of detection CGMMV, and establish the system that CGMMV LAMP detects, can by body series
With the existence detecting CGMMV virus highly sensitive in hour, detection sensitivity reaches 10fg, wants than regular-PCR
Exceed 1,000 times, and there is preferable specificity.The instrument and equipment that additionally this method is the most expensive a, it is only necessary to couveuse
, simple to operate, testing result directly can carry out interpretation by the reaction of color, is especially suitable for the use of basic unit one line,
The propagating materials Viral diagnosis aspect such as seedling, flowers has broad application prospects and extraordinary practical value.
Primer specificity of the present invention is preferable, highly sensitive；Detection method is the shortest.Need expensive detector
Device, testing cost is low.Easy and simple to handle
Detailed description of the invention
Below in conjunction with detailed description of the invention, the invention will be further described:
Material employed in following example of the present invention:
1. material
1.1 cucumber green mottles virus (CGMMV), cucumber mosaic virus (Cucumber mosaic virus, CMV) are purchased from
AGDIA company of the U.S..
1.2 main agents and consumptive material
(1) RNA amplification reaction kit Loopamp RNA Amplification kit；
(2)Fluorescence visual detection test kit；
(3)Fluorescence Detection Reagent；
(4)Reaction tubes etc. are all purchased in Beijing Lanpu Biological Technology Co., Ltd.；
1.3 key instrument equipment
(1)-80 DEG C of deep freezer；
(2) the most freezing desk centrifuge of Labofuge400R；
(3) micropipettor, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L,；
(4) ultrapure water system, Milli-Q Academic, Millipore company；
(5) superclean bench；
(6) eddy mixer；
(7) the real-time transmissometer of LAMP, LA-320C, Rong Yan biotech firm of Japan.
Embodiment 1
One cucumber green mottle mosaic LAMP primer of the present invention, including:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’。
Embodiment 2
One cucumber green mottle mosaic LAMP kit of the present invention, this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
The wherein product specification of this test kit: 40 times.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Embodiment 3
One cucumber green mottle mosaic LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA；
B, set up LAMP reaction system:
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes；20 μ L LAMP are anti-
Body is answered to include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CGMM VRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes；
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side
Face carries out sight and looks into；If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control
Fluorescence, and it is judged to feminine gender.
Embodiment 4
One cucumber green mottle mosaic LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA；
A1, take 0.1g the susceptible tissue of CGMMV and CMV add 1mL extraction buffer be ground；
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O；
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption；
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times；
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min；
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is CGMMV's and CMV
RNA；
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting；
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes；20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CGMM VRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction；
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into；If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 5
One cucumber green mottle mosaic LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA；
A1, take 0.1g the susceptible tissue of CGMMV and CMV add 1mL extraction buffer be ground；
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O；
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption；
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times；
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min；
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is CGMMV's and CMV
RNA；
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting；
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes；20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CGMM VRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction；
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into；If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 6
One cucumber green mottle mosaic LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA；
A1, take 0.1g the susceptible tissue of CGMMV and CMV add 1mL extraction buffer be ground；
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O；
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption；
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times；
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min；
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is CGMMV's and CMV
RNA；
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting；
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes；20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CGMM VRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 63 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction；
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into；If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
The ultimate principle of the present invention and principal character and advantages of the present invention have more than been shown and described.The skill of the industry
The art personnel simply explanation it should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description
The principle of the present invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these
Changes and improvements both fall within scope of the claimed invention.Claimed scope by appending claims and
Its equivalent defines.
Claims (10)
1. a cucumber green mottle mosaic LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’。
2. a cucumber green mottle mosaic LAMP kit, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' TTTCCGCGAGTCCCTGTC3 '；
Reversely outer primer B3:5 ' AGTACGCTTTACGGCGTTAA3 '；
Forward inner primer FIP:
5’ACAGGACCGTTGAGGAAAGCG-TGCGTTACCCTCGTCTGTC3’；
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' ACAGGACCGTTGAGGAAAGCG3 '；
F2:5 ' TGCGTTACCCTCGTCTGTC3 '；
Reversely inner primer BIP:
5’CGTTTCGCTTCTCAGCTCCACG-CGACTCAGCAGTCGTAGGA3’；
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' CGTTTCGCTTCTCAGCTCCACG3 '；
B2:5’CGACTCAGCAGTCGTAGGA3’；
The wherein product specification of this test kit: 40 times.
Cucumber green mottle mosaic LAMP kit the most according to claim 2, it is characterised in that described LAMP reaction
Liquid buffer is composed of the following components:
Cucumber green mottle mosaic LAMP kit the most according to claim 2, it is characterised in that described fluorescent dye is
Calcein；Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
5. a cucumber green mottle mosaic LAMP detection method, it is characterised in that comprise the following steps:
A, extraction sample RNA；
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put in sterilizing test tubes,
Premixed liquid is prepared on ice；Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes；
20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, negative right it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
According to response sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, instantaneous
Being centrifuged makes reaction solution concentrate on bottom sterilizing test tubes；Wherein negative control reaction uses the RNA of cucumber mosaic virus CGMMV,
Positive control reaction uses the positive control with CGMMVRNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then protect at 80 DEG C
Holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes；
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses and enter from test tube side
Row sight is looked into；If sending green glow as positive control, then it is judged to the positive, if not sending glimmering as negative control
Light, and it is judged to feminine gender.
Cucumber green mottle mosaic LAMP detection method the most according to claim 5, it is characterised in that carry described in step A
Take sample RNA, extract the most according to the following steps:
A1, take 0.1g the susceptible tissue of CGMMV and CMV add 1mL extraction buffer be ground；
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at Magnet
DdH is sucked under effect2O；
A3, combination: add the sample of 100 μ L in PCR pipe, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, inhale under room temperature
Attached；
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times；
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min；
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CGMMV and CMV.
Cucumber green mottle mosaic LAMP detection method the most according to claim 5, it is characterised in that step E middle-ultraviolet lamp
The ultraviolet ray range of irradiation unit: wavelength 240-260nm or 350-370nm.
Cucumber green mottle mosaic LAMP detection method the most according to claim 5, it is characterised in that described primer China and foreign countries
Primer is 1:2-1:10 with the ratio of inner primer.
Cucumber green mottle mosaic LAMP detection method the most according to claim 5, it is characterised in that described primer includes
1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber green mottle mosaic LAMP detection method the most according to claim 5, it is characterised in that expand in step D
Temperature is preferably 63 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610649681.3A CN106282406A (en) | 2016-08-09 | 2016-08-09 | Cucumber green mottle mosaic LAMP primer, test kit and detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610649681.3A CN106282406A (en) | 2016-08-09 | 2016-08-09 | Cucumber green mottle mosaic LAMP primer, test kit and detection method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106282406A true CN106282406A (en) | 2017-01-04 |
Family
ID=57667494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610649681.3A Pending CN106282406A (en) | 2016-08-09 | 2016-08-09 | Cucumber green mottle mosaic LAMP primer, test kit and detection method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106282406A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215324A (en) * | 2021-06-08 | 2021-08-06 | 大连民族大学 | Primer group, kit and method for on-site constant-temperature visualization and fluorescence detection of cucumber green mottle mosaic virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146847A (en) * | 2013-03-22 | 2013-06-12 | 南京农业大学 | RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method |
| CN104946798A (en) * | 2015-06-25 | 2015-09-30 | 陈定虎 | Primer and method for detecting tobacco mosaic virus LAMP |
| CN105671210A (en) * | 2016-03-31 | 2016-06-15 | 陈定虎 | LAMP technology-based primer, kit and detection method for detecting Plum pox virus |
-
2016
- 2016-08-09 CN CN201610649681.3A patent/CN106282406A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146847A (en) * | 2013-03-22 | 2013-06-12 | 南京农业大学 | RT-LAMP (loop-mediated isothermal amplification) rapid detection kit for cucumber green mottle mosaic virus (CGMMV) and detection method |
| CN104946798A (en) * | 2015-06-25 | 2015-09-30 | 陈定虎 | Primer and method for detecting tobacco mosaic virus LAMP |
| CN105671210A (en) * | 2016-03-31 | 2016-06-15 | 陈定虎 | LAMP technology-based primer, kit and detection method for detecting Plum pox virus |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113215324A (en) * | 2021-06-08 | 2021-08-06 | 大连民族大学 | Primer group, kit and method for on-site constant-temperature visualization and fluorescence detection of cucumber green mottle mosaic virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Honjo et al. | Reservoirs of Cyprinid herpesvirus 3 (CyHV-3) DNA in sediments of natural lakes and ponds | |
| CN106119420A (en) | Cucumber mosaic virus LAMP primer, test kit and detection method | |
| Marti et al. | Detection of human adenoviruses in organic fresh produce using molecular and cell culture-based methods | |
| CN106282405A (en) | Rose mosaic virus LAMP primer, test kit and detection method | |
| CN104946798B (en) | The primer and method of tobacco mosaic virus (TMV) LAMP detections | |
| CN105779631B (en) | A kind of method that Solanaceae Ralstonia solanacearum in plant tissue is detected using LAMP technology | |
| CN106282406A (en) | Cucumber green mottle mosaic LAMP primer, test kit and detection method | |
| CN105177187B (en) | Detect sample preparation methods and purposes that Curcurbitaceae seed carries cucumber green mottle mosaic virus | |
| Bhalla et al. | Addressing the silent spread of monkeypox disease with advanced analytical tools | |
| CN103060476A (en) | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination | |
| Swanson et al. | Genome affinities and epitope profiles of whitefly‐transmitted geminiviruses from the Americas | |
| CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit | |
| CN104195270B (en) | The visual quick detection kit of white spot syndrome virus (WSSV) and detection method | |
| CN101818211A (en) | Molecule detection method for cowpea severe mosaic virus | |
| CN104419686A (en) | Recombinant prrs virus hv-nsp9 and application thereof | |
| CN106119418A (en) | Abaca bunchy top virus LAMP primer, test kit and detection method | |
| Baranwal et al. | A novel approach for simultaneous detection of Citrus yellow mosaic virus and Citrus greening bacterium by multiplex polymerase chain reaction | |
| CN106566895B (en) | PCR primer for simultaneously detecting type I, type II and type III of cyprinid herpes virus, kit and application | |
| Harper et al. | Detection of petunia vein-clearing virus: model for the detection of DNA viruses in plants with homologous endogenous pararetrovirus sequences | |
| CN109371110A (en) | A kind of LAMP detection kit of Poplar Bacterial ulcer bacteria | |
| CN106119419A (en) | White spot syndrome virus LAMP primer, test kit and detection method | |
| CN106222303A (en) | Bean pod mottle virus LAMP primer, test kit and detection method | |
| CN108315484A (en) | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections | |
| CN104561370B (en) | Primed probe group and test kit thereof for the detection of banna virus fluorescence RT-PCR | |
| López et al. | Advantages of an integrated approach for diagnosis of quarantine pathogenic bacteria in plant material |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170104 |
|
| RJ01 | Rejection of invention patent application after publication |