CN108315484A - The primer and detection method of tobacco mosaic virus (TMV) LAMP detections - Google Patents
The primer and detection method of tobacco mosaic virus (TMV) LAMP detections Download PDFInfo
- Publication number
- CN108315484A CN108315484A CN201810317475.1A CN201810317475A CN108315484A CN 108315484 A CN108315484 A CN 108315484A CN 201810317475 A CN201810317475 A CN 201810317475A CN 108315484 A CN108315484 A CN 108315484A
- Authority
- CN
- China
- Prior art keywords
- mosaic virus
- tobacco mosaic
- tmv
- lamp
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
- C12N15/1013—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by using magnetic beads
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primers and detection method of tobacco mosaic virus (TMV) LAMP detections, the wherein primer of tobacco mosaic virus (TMV) LAMP detections, it is characterised in that including：Positive outer primer F3；Reversed outer primer B3；Positive inner primer FIP；Reversed inner primer BIP.Place that purpose of the invention is to overcome the shortcomings in the prior art, provides a kind of primer of tobacco mosaic virus (TMV) LAMP detections；Another object of the present invention is to provide a kind of primed method using above-mentioned primer detection tobacco mosaic virus (TMV), this method have the characteristics that quickly, detection sensitivity is high, easy to operate, result directly can be with interpretation.
Description
Technical field
The present invention relates to a kind of primers of tobacco mosaic virus (TMV) LAMP detections, are drawn using above-mentioned the invention further relates to a kind of
The method of analyte detection tobacco mosaic virus (TMV), belongs to biotechnology.
Background technology
Tobacco mosaic virus (TMV) tobacco mosaic virus abridge TMV, are RNA virus, special infection plant, especially
Tobacco and other plants of Solanaceae are the representative species that Tobamovirus belongs to.The virus is this base of Ivanov D.I.Iwanowski
In the presence that 1892 demonstrate this TMV for the first time.Stanley W.M.Stanley is in nineteen thirty-five first from tobacco disease leaf is squeezed the juice
It is separated to the crystallization of TMV virus shapes, to recognize that this protein also contains nucleic acid, and cause of disease is exactly this virus certainly.It should
Virus is extremely stable, because can be proliferated in large quantities in sick leaf, so can purify 2 grams of crystallizations in squeezing the juice from 1 liter of sick leaf.TMV particles
Long 300 nanometers, 18 nanometers of diameter, it is 2 × 10 to have a molecular weight6The single stranded RNA of dalton.Nucleic acid is by 2130 molecular weight
The protein subunit of 17530 dalton is wrapped up.The host range of TMV is very extensive, has been known to 198 in 22 section plants
Kind plant all has infectivity, such as tobacco and various vegetables, is the most commonly used virus of parasitic scope in current plant virus
One of.
The lethal temperature of the virus was 90-93 DEG C through 10 minutes, diluted point of accumulation 106Times, the longevity in vitro 72-96 hours.
Aseptically pathogenicity reaches the several years, live 30 years in dry diseased tissues memory or more.And the virus has different strains, China
Mainly have 4 strains such as common strain, tomato strain, macula lutea strain and pearl spot, because of pathogenicity difference and with other virus answer
Close the diversity for infecting and causing symptom.
TMV can be overwintering in various plants, and primary source of infection is band invalid body and other host plant, in addition fully not decomposed
, the malicious fertilizer of band can also be led to First aggression.It is mainly propagated by juice, and slightly friction causes the microtrauma mouth, virus to be to the strong leaf of disease
It can invade, not invade from big wound and natural aperture, bred in parenchyma cell after intrusion, be infected afterwards into vascular tissue whole
Strain.Under the conditions of 22-28 DEG C, infected plant starts aobvious disease after 7-14 days, and field is grasped by sick seedling and strong seedling friction or farming
It is infected again.In addition the insect of the biting mouthparts such as the locust in vega, oriental tobacco budworm can also propagate.
Since the Virus parasite range is wide, multiple kinds of crops can be infected and easily propagated, hidden and invade with viral residuum
It contaminates the time and very long, brings great difficulty to the virus is prevented, can all cause the damage that can not be estimated to crops every year
It loses, therefore most economical effective control strategy is just detected to seedling, it is found that the timely of TMV viruses is eliminated, on source
Prevention virus is held to close.
The detection method of plant virus mainly has three kinds of biology, serology and molecular biology, biological method at present
The presence or absence of virus exactly is detected with viral indicator plant, is generally required 7-10 days；Serological method is anti-according to antigen
The specific binding of body detects virus, generally only needs 4-6 hours or so, it require that the antiserum of specificity, and
Detection sensitivity is not high, and there is also have non-specific problem；Molecular biology method is primarily referred to as PCR method, this method it is fast and
Accuracy is also relatively high, but needs expensive detecting instrument and relevant device, and for as TMV, this is viral, due to it
It is 10 to dilute point of accumulation6Times, i.e., sick juice is diluted to 106Infecting potential is just lost again, therefore needs the very high detection method of sensitivity
Potential TMV could be detected, the sensitivity of three of the above method is all difficult to reach, and will have the possibility of missing inspection in this way,
So being badly in need of studying new detection method.
Current existing detection method, detecting step is cumbersome, using expensive equipment, cannot fast, easily realize mirror
The other shark's fin true and false.So existing differentiate that the detection method of the shark's fin true and false needs to be further improved.
Invention content
Place that purpose of the invention is to overcome the shortcomings in the prior art provides a kind of tobacco mosaic virus (TMV) LAMP inspections
The primer of survey；
Another object of the present invention is to provide a kind of primed method using above-mentioned primer detection tobacco mosaic virus (TMV), the party
Method have the characteristics that quickly, detection sensitivity is high, easy to operate, result directly can be with interpretation.
In order to achieve the above object, the present invention uses following scheme：
A kind of primer of tobacco mosaic virus (TMV) LAMP detections, it is characterised in that including：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC.
A kind of tobacco mosaic virus (TMV) LAMP detection method, it is characterised in that include the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, in 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C
Lower heat preservation 5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
A kind of tobacco mosaic virus (TMV) LAMP detection method as described above, it is characterised in that described (positive outer primer F3+ is anti-
To outer primer B3)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+) is 1:2-1:10.
A kind of tobacco mosaic virus (TMV) LAMP detection method as described above, it is characterised in that each 1.6 μ of the FIP and BIP
M, each 40pmol；Each 0.2 μM of F3 and B3, each 5pmol.
A kind of tobacco mosaic virus (TMV) LAMP detection method as described above, it is characterised in that the tobacco described in step A
The extraction specific steps of mosaic virus RNA：
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
A kind of tobacco mosaic virus (TMV) LAMP detection method as described above, it is characterised in that the LAMP transmissometer methods
Include real-time Turbidity measurement and/or the detection of terminal degree.
A kind of tobacco mosaic virus (TMV) LAMP detection method as described above, it is characterised in that the method for the fluorescence range estimation：
Be irradiated upwards from test tube bottom using ultraviolet lamp, wear ultraviolet protection glasses from test tube side into
Row is seen and is looked into；If with green light is sent out as positive control, it is determined as the positive, if do not sent out as negative control glimmering
Light, and it is determined as feminine gender.
In conclusion beneficial effects of the present invention：
The present invention uses ring mediated isothermal amplification loop-mediated isothermal amplification, referred to as
LAMP is a kind of new nucleic acid detection method, and principle is to utilize the primer of 4 special designings and the DNA with strand-displacement activity
Polymerase, special under constant temperature, efficient, rapidly DNA amplification new technology.The technology can amplify 10 in l hours9
Target sequence copies, and the staged collection of illustrative plates being made of different size of zone is shown on gel after amplified production electrophoresis.Tradition
Round pcr, after PCR, need to be detected PCR product into the methods of row agarose gel electrophoresis, operating procedure is numerous
It is trivial, it is time-consuming and laborious, and the harm there are ethidium bromide or isotope to human body and environment.And the LAMP skills that this research institute establishes
Art detection tobacco mosaic virus (TMV) is time saving, economic and sensibility is high.Testing result need to only utilize that LAMP transmissometers or SYBG's is green
Color fluorescence is known that whether reaction occurs by the way that whether range estimation generates white precipitate, without loaded down with trivial details detected through gel electrophoresis
Process.
The present invention extracts the RNA of TMV using paramagnetic particle method and is devised according to the coat protein encoding gene of the main strains of TMV
The universal primer of the LAMP amplifications of TMV is detected, and establishes the system of TMV LAMP detections, it can be at one by this system
The highly sensitive presence for detecting TMV viruses, detection sensitivity reach 10fg, 1,000 times are higher by than regular-PCR in hour,
And with preferable specificity.In addition the instrument and equipment that this method should not be expensive a, it is only necessary to incubator, operation letter
Single, testing result can be very suitable for the use of one line of base, in seedling, flowers etc. directly by the reaction of color come interpretation
It has broad application prospects and extraordinary practical value in terms of propagating materials viral diagnosis.
Specific implementation mode
The present invention is described further With reference to embodiment：
Material employed in following embodiment of the present invention：
1.1 tobacco mosaic virus (TMV) TMV, cucumber mosaic virus CMV are purchased from AGDIA companies of the U.S..
1.2 main agents and consumptive material
(1) RNA amplification reaction kit Loopamp RNA Amplification kit；
(2)Fluorescence visual detection kit；
(3)Fluorescence Detection Reagent；
(4)Reaction tube etc. is purchased in Beijing Lanpu Biological Technology Co., Ltd.
(5) LAMP primer (positive outer primer F3, positive inner primer FIP, reversed inner primer BIP, reversed outer primer B3) is equal
By precious bioengineering (Dalian), Co., Ltd synthesizes；
1.3 key instrument equipment
(1) -80 DEG C of deep freezer；
(2) Labofuge400R high speeds freezing desk centrifuge；
(3) micropipettor, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L,；
(4) ultrapure water system, Milli-Q Academic, Millipore companies；
(5) superclean bench；
(6) eddy mixer；
(7) the real-time transmissometers of LAMP, LA-320C, Japanese Rong Yan biotech firms.
Embodiment 1
A kind of primer of tobacco mosaic virus (TMV) LAMP detections, including：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC.
Embodiment 2
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, in 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C
Lower heat preservation 5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Embodiment 3
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
(the positive reversed outer primer B3 of outer primer F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+)
It is 1:2.
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is kept the temperature at 60 DEG C of isothermal reaction 90min, last 60 DEG C
5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Embodiment 4
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
(the positive reversed outer primer B3 of outer primer F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+)
It is 1:10.
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is kept the temperature at 70 DEG C of isothermal reaction 90min, last 80 DEG C
5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Embodiment 5
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
(the positive reversed outer primer B3 of outer primer F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+)
It is 1:5.
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is kept the temperature at 65 DEG C of isothermal reaction 90min, last 70 DEG C
5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Embodiment 6
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
(the positive reversed outer primer B3 of outer primer F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+)
It is 1:8.Each 1.6 μM of the FIP and BIP, each 40pmol；Each 0.2 μM of F3 and B3, each 5pmol.
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is kept the temperature at 60 DEG C of isothermal reaction 90min, last 60 DEG C
5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Heretofore described LAMP transmissometer methods include real-time Turbidity measurement and/or the detection of terminal degree.
1. real-time Turbidity measurement
Using the real-time turbidimetric analysis turbidimetry devices of Loopamp, can be measured in real time；
2. terminal turbidimetric analysis turbidimetry：
Using Loopamp terminal turbidimetric analysis turbidimetry devices, the turbidity at the end of detection can be detected；
3. fluorescence range estimation detection
It usesFluorescence visual detection kit can judge result by range estimation.Amplification
After reaction, using ultraviolet lamp (wavelength 240~260nm, 350~370nm) from reaction tube bottom to enterprising
Row ultraviolet light irradiates, from being carried out from reaction tube side after the safety devices such as wearing spectacles.If being sent out with as positive control
Green fluorescence is then determined as the positive, if not sending out fluorescence as negative control, is determined as feminine gender.
Meeting fluoresced green after SYBR Green I dyestuffs are combined with double-stranded DNA, if dye colour is orange by
Become green, then illustrates the testing result positive.
Embodiment 7
A kind of tobacco mosaic virus (TMV) LAMP detection method, includes the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnetic
DdH2O is sucked under the action of iron；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, at room temperature
Absorption；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is tobacco mosaic virus (TMV)
RNA。
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution,
It is composed of the following components:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
(the positive reversed outer primer B3 of outer primer F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+)
It is 1:15.
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, negative control reaction uses the 5 μ L of RNA of cucumber mosaic virus, blank control reaction use to go
5 μ L of ionized water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is kept the temperature at 60 DEG C of isothermal reaction 90min, last 60 DEG C
5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
Sequence table
<110>It is old, fixed tiger
<120>The primer and detection method of tobacco mosaic virus (TMV) LAMP detections
<130>The primer and detection method of tobacco mosaic virus (TMV) LAMP detections
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213> tobacco mosaic virus
<400> 1
gtgactttaa agtgtatagg taca 24
<210> 2
<211> 20
<212> DNA
<213> tobacco mosaic virus
<400> 2
atgatccagt tcctctgatc 20
<210> 3
<211> 45
<212> DNA
<213> tobacco mosaic virus
<400> 3
cgggtttgcc tgattttcaa cttcgaccct ctagttactg cacta 45
<210> 4
<211> 24
<212> DNA
<213> tobacco mosaic virus
<400> 4
cgggtttgcc tgattttcaa cttc 24
<210> 5
<211> 21
<212> DNA
<213> tobacco mosaic virus
<400> 5
gaccctctag ttactgcact a 21
<210> 6
<211> 21
<212> DNA
<213> tobacco mosaic virus
<400> 6
cgactgccga aacgttagat g 21
<210> 7
<211> 18
<212> DNA
<213> tobacco mosaic virus
<400> 7
tattgcgctc cttatggc 18
Claims (7)
1. a kind of primer of tobacco mosaic virus (TMV) LAMP detections, it is characterised in that including：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC.
2. a kind of tobacco mosaic virus (TMV) LAMP detection method, it is characterised in that include the following steps：
A, the extraction of tobacco mosaic virus RNA
Tobacco mosaic virus RNA is extracted using nanometer magnetic bead；
B, LAMP reaction systems are established
The LAMP reaction systems of 25 μ L include 20 μ L pre-reactions solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, by with
The following group is grouped as:
The sequence of the primer includes：
Positive outer primer F3：5'-GTGACTTTAAAGTGTATAGGTACA-3’；
Reversed outer primer B3：5'-ATGATCCAGTTCCTCTGATC-3’；
Positive inner primer FIP：
5'-CGGGTTTGCCTGATTTTCAACTTC-GACCCTCTAGTTACTGCACTA-3’；
The wherein described positive inner primer FIP includes F1c and F2 sequences：
F1c：CGGGTTTGCCTGATTTTCAACTTC；
F2：GACCCTCTAGTTACTGCACTA；
Reversed inner primer BIP：
5'-CGACTGCCGAAACGTTAGATG-TATTGCGCTCCTTATGGC-3’
The reversed inner primer BIP includes the sequence containing B1c and B2：
B1c：CGACTGCCGAAACGTTAGATG；
B2：TATTGCGCTCCTTATGGC；
C, each 20 μ L of above-mentioned pre-reaction solution are separately added into Loopamp reaction tubes；
D, 5 μ L of detected sample DNA to be detected are added in pre-reaction solution, total amount is made to reach 25 μ L；
E, in control reaction, using the 5 μ L of RNA of cucumber mosaic virus, blank control, which is reacted, uses deionization for negative control reaction
5 μ L of water, positive control use 5 μ L of tobacco mosaic virus RNA；
F, solution is made to be sufficiently mixed rear brief centrifugation with the mixing of pipettor liquid sucking-discharging method or close the cover tap；
G, mixture is placed in the reacting hole of LAMP transmissometers, is protected at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C
Warm 5min is with reaction was completed；
H, inspection result is detected using the method that LAMP transmissometers method or fluorescence are estimated.
3. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, it is characterised in that described (just to draw outward
The reversed outer primer B3 of object F3+)：The concentration ratio of (the positive reversed inner primer BIP of inner primer FIP+) is 1:1-1:15.
4. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 3, it is characterised in that the FIP and
Each 1.6 μM of BIP, each 40pmol；Each 0.2 μM of F3 and B3, each 5pmol.
5. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, it is characterised in that described in step A
The extraction specific steps of tobacco mosaic virus RNA：
1) sample preparation：It takes the susceptible tissue of the tobacco mosaic virus (TMV) of 0.1g that 1mL extraction buffers are added to be ground, obtains sample；
2) nanometer magnetic bead is cleaned：It takes out in nanometer magnetic bead to PCR pipe, nanometer magnetic bead is cleaned repeatedly with ddH2O 3 times, in magnet
DdH2O is sucked under effect；
3) it combines：It is added in the sample to PCR pipe of 100 μ L, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, inhales at room temperature
It is attached；
4) it cleans：Supernatant is removed under the action of magnet, nanometer magnetic bead cleans 3 times；
5) it cracks：It is added in 50 μ L ddH2O to PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min；
6) it samples：With magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
6. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, it is characterised in that the LAMP is turbid
Degree instrument method includes real-time Turbidity measurement and/or the detection of terminal degree.
7. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, it is characterised in that the fluorescence range estimation
Method：
It is irradiated upwards from test tube bottom using ultraviolet lamp, wears ultraviolet protection glasses and seen from test tube side
It looks into；If with green light is sent out as positive control, it is determined as the positive, if not sending out fluorescence as negative control, and
It is determined as feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810317475.1A CN108315484A (en) | 2018-04-10 | 2018-04-10 | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810317475.1A CN108315484A (en) | 2018-04-10 | 2018-04-10 | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108315484A true CN108315484A (en) | 2018-07-24 |
Family
ID=62897132
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810317475.1A Pending CN108315484A (en) | 2018-04-10 | 2018-04-10 | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315484A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
-
2018
- 2018-04-10 CN CN201810317475.1A patent/CN108315484A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| BRPI1015218B1 (en) | METHODS FOR DETERMINING ANTIMICROBIAN RESISTANCE | |
| CN104946798B (en) | The primer and method of tobacco mosaic virus (TMV) LAMP detections | |
| Luo et al. | Reverse-transcription, loop-mediated isothermal amplification assay for the sensitive and rapid detection of H10 subtype avian influenza viruses | |
| CN102643919A (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| Zhang et al. | Diagnostics and detection of African swine fever virus | |
| CN110408727A (en) | A kind of CPA primer sets, CPA nucleic acid test strip kit and its application detecting J subgroup avian leucosis virus | |
| JP4903722B2 (en) | Method for detecting live cells in a sample by using a virus | |
| Knüsel et al. | Virus isolation vs RT‐PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions? | |
| CN105177178A (en) | Tobacco mosaic virus LAMP detection kit | |
| CN108315484A (en) | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections | |
| CN104195270B (en) | The visual quick detection kit of white spot syndrome virus (WSSV) and detection method | |
| Rimmer et al. | Validation of high throughput methods for tissue disruption and nucleic acid extraction for ranaviruses (family Iridoviridae) | |
| CN106282405A (en) | Rose mosaic virus LAMP primer, test kit and detection method | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN106119420A (en) | Cucumber mosaic virus LAMP primer, test kit and detection method | |
| CN106435007A (en) | Primer, probe, kit and method for detecting bacillus erysipelatos-suis by fluorescent quantitative PCR (Polymerase Chain Reaction) | |
| CN115873930A (en) | Double-target-point drug-resistant salmonella detection method based on RPA-Cas12a | |
| CN110791568A (en) | LAMP primer group for rapidly detecting chicken-derived components in beef and mutton, detection kit, detection method and application | |
| CN102329889B (en) | Primer and probe and method for detecting poxvirus muris | |
| CN104099413B (en) | Fall webworms constant temperature nucleic acid detection kit and detection method thereof | |
| CN104894125B (en) | A kind of RT LAMP kits and its primer special for detecting grape A viruses | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN105039331A (en) | Peronophythora litchi LAMP primer as well as rapid detection method and application thereof | |
| CN104404157A (en) | LAMP detection primer composition for detecting phytophthora drechsler tucker, LAMP detection kit, and LAMP detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180724 |
|
| WD01 | Invention patent application deemed withdrawn after publication |