CN106119420A - Cucumber mosaic virus LAMP primer, test kit and detection method - Google Patents

Cucumber mosaic virus LAMP primer, test kit and detection method Download PDF

Info

Publication number
CN106119420A
CN106119420A CN201610649664.XA CN201610649664A CN106119420A CN 106119420 A CN106119420 A CN 106119420A CN 201610649664 A CN201610649664 A CN 201610649664A CN 106119420 A CN106119420 A CN 106119420A
Authority
CN
China
Prior art keywords
primer
mosaic virus
lamp
cucumber mosaic
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610649664.XA
Other languages
Chinese (zh)
Inventor
陈定虎
管维
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201610649664.XA priority Critical patent/CN106119420A/en
Publication of CN106119420A publication Critical patent/CN106119420A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses cucumber mosaic virus LAMP primer, test kit and detection method, wherein said primer includes: forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reversely inner primer BIP.The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber mosaic virus LAMP primer;It is a further object to provide a kind of test kit comprising above-mentioned primer;It is a further object to provide a kind of method using mentioned reagent box detection cucumber mosaic virus, this detection method has: primer specificity is strong, equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result directly can be with features such as interpretations.

Description

Cucumber mosaic virus LAMP primer, test kit and detection method
Technical field
The present invention relates to a kind of cucumber mosaic virus LAMP primer, the invention still further relates to a kind of reagent including above-mentioned primer Box;The invention still further relates to a kind of method using mentioned reagent box detection cucumber mosaic virus.
Background technology
Cucumber mosaic virus Cucumber mosaic virus abridges CMV, is plant Bromoviridae Bromoviridae, the representative species of Cucumovirus Tobamovirus, for worldwide distribution, especially in Temperate Region in China It is distributed the widest.Virion such as is at the axial symmetry icosahedron, and without peplos, the particle size of three components is consistent, and diameter is about 29nm, RNA1 and RNA2 are respectively wrapped in a particle, be wrapped in another one particle, be commonly present and defend together with RNA3 with RNA4 Star RNA molecule.
This virus host scope is the widest, can infect more than 1000 kind of dicotyledon such as Fructus Cucumidis sativi, Fructus Lycopersici esculenti and monocotyledon Such as Cymbidium ensifolium (L.) Sw., Fructus Musae, it is, on Cereal, herbage, woody and herbaceous ornamental, vegetable and fruit tree, the widest, harm maximum occurs Virus.This virus can be propagated in non-persistent mode by more than 60 kinds of aphids, and propagates easily by mechanical inoculation.
Owing to this Virus parasite scope is wide, and easily propagate, the band virus residuum latent infection time the longest, give anti- Control this virus and bring great difficulty, the most all can cause an immeasurable loss to crops, the most most economical effectively Control strategy is just to detect seedling, finds eliminating in time of CMV virus, holds preventing and treating virus and close on source.
The detection method of plant virus mainly has biology, serology and molecular biology three kinds, biological method at present It is exactly the presence or absence detecting virus with virus indicator plant, it is generally required to 7-10 days;Serological method is to resist according to antigen The specific binding of body detects virus, typically has only to about 4-6 hour, it require that specific antiserum, and Detection sensitivity is the highest, there is also non-specific problem;Molecular biology method is primarily referred to as PCR method, the method fast and Accuracy is the highest, however it is necessary that detecting instrument and the relevant device of costliness, and for as this virus of CMV, due to it Dilution point of accumulation is 104Times, will sick juice be diluted to 10000 times after just lose infecting potential, therefore need sensitivity the highest Potential CMV could be detected by detection method, and three of the above method sensitivity is all difficult to reach, and so will there is missing inspection Possibility, so being badly in need of the new detection method of research.
Summary of the invention
The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber mosaic virus LAMP draws Thing;
It is a further object to provide a kind of test kit comprising above-mentioned primer;
It is a further object to provide a kind of method using mentioned reagent box detection cucumber mosaic virus, this inspection Survey method has: primer specificity is strong, and equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result is direct Can be with features such as interpretations.
In order to achieve the above object, the present invention uses below scheme:
A kind of cucumber mosaic virus LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
One cucumber mosaic virus LAMP kit of the present invention, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
3, cucumber mosaic virus LAMP kit according to claim 2, it is characterised in that described LAMP reaction Liquid buffer is composed of the following components:
4, cucumber mosaic virus LAMP kit according to claim 2, it is characterised in that described fluorescent dye is Calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
One cucumber mosaic virus LAMP detection method of the present invention, it is characterised in that comprise the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put into sterilizing examination Guan Zhong, prepares premixed liquid on ice;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on sterilizing test tubes Bottom;20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side Face carries out sight and looks into;If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control Fluorescence, and it is judged to feminine gender.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that extract sample RNA described in step A, Concrete extraction according to the following steps:
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that step E middle-ultraviolet lamp irradiation unit Ultraviolet ray range: wavelength 240-260nm or 350-370nm.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that outer primer and inner primer in described primer Ratio be l:2-1:10.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that described primer includes that 1.6 μ l are the most outside Primers F 3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that expand temperature in step D and be preferably 63 ℃。
In sum, relative to prior art, it provides the benefit that the present invention:
Paramagnetic particle method is used to extract the RNA of WSSV and devise according to the coat protein encoding gene of the main strain of WSSV herein The universal primer of the LAMP amplification of detection WSSV coat protein large subunit, and establish the system of WSSV LAMP detection, pass through Body series highly sensitive in one hour can detect the viral existence of WSSV, and detection sensitivity reaches 10fg, and ratio is general Logical PCR to exceed 1,000 times, and has preferable specificity.The instrument and equipment that additionally this method is the most expensive, it is only necessary to one Individual couveuse, simple to operate, testing result directly can carry out interpretation by the reaction of color, is especially suitable for basic unit one line Use, have broad application prospects and extraordinary practical value in terms of the propagating materials Viral diagnosis such as seedling, flowers.
Primer specificity of the present invention is preferable, highly sensitive;Detection method is the shortest.Need expensive detector Device, testing cost is low.Easy and simple to handle
Detailed description of the invention
Below in conjunction with detailed description of the invention, the invention will be further described:
Material employed in following example of the present invention:
1. material
1.1 cucumber mosaic virus (CMV), tobacco mosaic virus (TMV) (TMV) are purchased from AGDIA company of the U.S..
1.2 main agents and consumptive material
(1) RNA amplification reaction kit Loopamp RNA Amplification kit;
(2)Fluorescence visual detection test kit;
(3)Fluorescence Detection Reagent;
(4)Reaction tubes etc. are all purchased in Beijing Lanpu Biological Technology Co., Ltd.;
1.3 key instrument equipment
(1)-80 DEG C of deep freezer;
(2) the most freezing desk centrifuge of Labofuge400R;
(3) micropipettor, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L,;
(4) ultrapure water system, Milli-Q Academic, Millipore company;
(5) superclean bench;
(6) eddy mixer;
(7) the real-time transmissometer of LAMP, LA-320C, Rong Yan biotech firm of Japan.
Embodiment 1
One cucumber mosaic virus LAMP primer of the present invention, including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
Embodiment 2
One cucumber mosaic virus LAMP kit of the present invention, this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Embodiment 3
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre- Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti- Body is answered to include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side Face carries out sight and looks into;If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control Fluorescence, and it is judged to feminine gender.
Embodiment 4
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre- Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti- Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60 DEG C, keeps constant temperature 1 hour, then at 80 DEG C Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350- 370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 5
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre- Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti- Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350- 370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 6
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre- Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti- Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 63 DEG C, keeps constant temperature 1 hour, then at 80 DEG C Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350- 370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
The ultimate principle of the present invention and principal character and advantages of the present invention have more than been shown and described.The skill of the industry The art personnel simply explanation it should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description The principle of the present invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these Changes and improvements both fall within scope of the claimed invention.Claimed scope by appending claims and Its equivalent defines.

Claims (10)

1. a cucumber mosaic virus LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
2. a cucumber mosaic virus LAMP kit, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
Cucumber mosaic virus LAMP kit the most according to claim 2, it is characterised in that described LAMP reactant liquor delays Rush liquid composed of the following components:
Cucumber mosaic virus LAMP kit the most according to claim 2, it is characterised in that described fluorescent dye is that calcium is yellow Verdazulene;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
5. a cucumber mosaic virus LAMP detection method, it is characterised in that comprise the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put in sterilizing test tubes, Premixed liquid is prepared on ice;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes; 20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, negative right it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants According to response sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, instantaneous Being centrifuged makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, and the positive is right The positive control with CMVRNA is used according to reaction,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then protect at 80 DEG C Holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses and enter from test tube side Row sight is looked into;If sending green glow as positive control, then it is judged to the positive, if not sending glimmering as negative control Light, and it is judged to feminine gender.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that extract sample described in step A Product RNA, extracts the most according to the following steps:
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at Magnet DdH is sucked under effect2O;
A3, combination: add the sample of 100 μ L in PCR pipe, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, inhale under room temperature Attached;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that step E middle-ultraviolet lamp irradiates The ultraviolet ray range of device: wavelength 240-260nm or 350-370nm.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that outer primer in described primer It is l:2-1:10 with the ratio of inner primer.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that described primer includes 1.6 μ l Forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that expand temperature in step D It is preferably 63 DEG C.
CN201610649664.XA 2016-08-09 2016-08-09 Cucumber mosaic virus LAMP primer, test kit and detection method Pending CN106119420A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610649664.XA CN106119420A (en) 2016-08-09 2016-08-09 Cucumber mosaic virus LAMP primer, test kit and detection method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610649664.XA CN106119420A (en) 2016-08-09 2016-08-09 Cucumber mosaic virus LAMP primer, test kit and detection method

Publications (1)

Publication Number Publication Date
CN106119420A true CN106119420A (en) 2016-11-16

Family

ID=57257387

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610649664.XA Pending CN106119420A (en) 2016-08-09 2016-08-09 Cucumber mosaic virus LAMP primer, test kit and detection method

Country Status (1)

Country Link
CN (1) CN106119420A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107177700A (en) * 2017-07-19 2017-09-19 上海市农业科学院 A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus
CN107354235A (en) * 2017-06-21 2017-11-17 陈定虎 Primer, kit and the authentication method of potato virus X identification
CN108624719A (en) * 2018-06-21 2018-10-09 中国科学院寒区旱区环境与工程研究所 A kind of kit and its detection method of specific detection lily cucumber mosaic virus

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102286637A (en) * 2011-07-21 2011-12-21 陕西省烟草研究所 Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology
CN105177178A (en) * 2015-06-25 2015-12-23 陈定虎 Tobacco mosaic virus LAMP detection kit
CN105671210A (en) * 2016-03-31 2016-06-15 陈定虎 LAMP technology-based primer, kit and detection method for detecting Plum pox virus

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102286637A (en) * 2011-07-21 2011-12-21 陕西省烟草研究所 Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology
CN105177178A (en) * 2015-06-25 2015-12-23 陈定虎 Tobacco mosaic virus LAMP detection kit
CN105671210A (en) * 2016-03-31 2016-06-15 陈定虎 LAMP technology-based primer, kit and detection method for detecting Plum pox virus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RYOTA SUZUKI ET AL.: "Development of the loop-mediated isothermal amplification method for rapid detection of cytomegalovirus DNA", 《JOURNAL OF VIROLOGICAL METHODS》 *
赵雪君 等: "蔬菜中黄瓜花叶病毒的RT-LAMP快速检测", 《园艺学报》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107354235A (en) * 2017-06-21 2017-11-17 陈定虎 Primer, kit and the authentication method of potato virus X identification
CN107177700A (en) * 2017-07-19 2017-09-19 上海市农业科学院 A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus
CN108624719A (en) * 2018-06-21 2018-10-09 中国科学院寒区旱区环境与工程研究所 A kind of kit and its detection method of specific detection lily cucumber mosaic virus

Similar Documents

Publication Publication Date Title
Wang et al. Development of a novel quantitative real‐time PCR assay with lyophilized powder reagent to detect African swine fever virus in blood samples of domestic pigs in China
Sithigorngul et al. A convenient immunochromatographic test strip for rapid diagnosis of yellow head virus infection in shrimp
Bergmann et al. Detection of koi herpes virus (KHV) genome in apparently healthy fish
WO2008079463A2 (en) Biological organism identification product and methods
CN106119420A (en) Cucumber mosaic virus LAMP primer, test kit and detection method
CN103409555B (en) Macrobrachium rosenbergii Nodavirus RT-LAMP-LFD detection method and detection kit thereof
Zhang et al. An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood
CN104946798B (en) The primer and method of tobacco mosaic virus (TMV) LAMP detections
CN106282405A (en) Rose mosaic virus LAMP primer, test kit and detection method
Magouz et al. Detection of infectious laryngotracheitis virus (Gallid herpesvirus-1) from clinically infected chickens in Egypt by different diagnostic methods
CN107365684B (en) A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method
Ashraf et al. Isolation, identification and molecular characterization of highly pathogenic Newcastle disease virus from field outbreaks
Zhang et al. Development of immunocapture reverse transcription loop‐mediated isothermal amplification assays to detect both lily symptomless virus and cucumber mosaic virus
CN105177178A (en) Tobacco mosaic virus LAMP detection kit
CN101818211B (en) Molecule detection method for cowpea severe mosaic virus
CN104419686A (en) Recombinant prrs virus hv-nsp9 and application thereof
CN102191324B (en) Trypanosoma evansi and trypanosoma lewisi dual-polymerase chain reaction (PCR) assay kit and preparation method thereof
CN104388577A (en) Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit
CN104195270B (en) The visual quick detection kit of white spot syndrome virus (WSSV) and detection method
Saeed et al. A study on transmission of Peste des petits ruminants virus between dromedary camels and small ruminants
CN106282406A (en) Cucumber green mottle mosaic LAMP primer, test kit and detection method
CN106119418A (en) Abaca bunchy top virus LAMP primer, test kit and detection method
Al-Sadawi et al. Viral agent that causing diarrhoea among children in Al-Najaf province, Iraq
CN106119419A (en) White spot syndrome virus LAMP primer, test kit and detection method
CN106222303A (en) Bean pod mottle virus LAMP primer, test kit and detection method

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20161116