CN106119420A - Cucumber mosaic virus LAMP primer, test kit and detection method - Google Patents
Cucumber mosaic virus LAMP primer, test kit and detection method Download PDFInfo
- Publication number
- CN106119420A CN106119420A CN201610649664.XA CN201610649664A CN106119420A CN 106119420 A CN106119420 A CN 106119420A CN 201610649664 A CN201610649664 A CN 201610649664A CN 106119420 A CN106119420 A CN 106119420A
- Authority
- CN
- China
- Prior art keywords
- primer
- mosaic virus
- lamp
- cucumber mosaic
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses cucumber mosaic virus LAMP primer, test kit and detection method, wherein said primer includes: forward outer primer F3, reverse outer primer B3, forward inner primer FIP, and reversely inner primer BIP.The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber mosaic virus LAMP primer;It is a further object to provide a kind of test kit comprising above-mentioned primer;It is a further object to provide a kind of method using mentioned reagent box detection cucumber mosaic virus, this detection method has: primer specificity is strong, equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result directly can be with features such as interpretations.
Description
Technical field
The present invention relates to a kind of cucumber mosaic virus LAMP primer, the invention still further relates to a kind of reagent including above-mentioned primer
Box;The invention still further relates to a kind of method using mentioned reagent box detection cucumber mosaic virus.
Background technology
Cucumber mosaic virus Cucumber mosaic virus abridges CMV, is plant Bromoviridae
Bromoviridae, the representative species of Cucumovirus Tobamovirus, for worldwide distribution, especially in Temperate Region in China
It is distributed the widest.Virion such as is at the axial symmetry icosahedron, and without peplos, the particle size of three components is consistent, and diameter is about
29nm, RNA1 and RNA2 are respectively wrapped in a particle, be wrapped in another one particle, be commonly present and defend together with RNA3 with RNA4
Star RNA molecule.
This virus host scope is the widest, can infect more than 1000 kind of dicotyledon such as Fructus Cucumidis sativi, Fructus Lycopersici esculenti and monocotyledon
Such as Cymbidium ensifolium (L.) Sw., Fructus Musae, it is, on Cereal, herbage, woody and herbaceous ornamental, vegetable and fruit tree, the widest, harm maximum occurs
Virus.This virus can be propagated in non-persistent mode by more than 60 kinds of aphids, and propagates easily by mechanical inoculation.
Owing to this Virus parasite scope is wide, and easily propagate, the band virus residuum latent infection time the longest, give anti-
Control this virus and bring great difficulty, the most all can cause an immeasurable loss to crops, the most most economical effectively
Control strategy is just to detect seedling, finds eliminating in time of CMV virus, holds preventing and treating virus and close on source.
The detection method of plant virus mainly has biology, serology and molecular biology three kinds, biological method at present
It is exactly the presence or absence detecting virus with virus indicator plant, it is generally required to 7-10 days;Serological method is to resist according to antigen
The specific binding of body detects virus, typically has only to about 4-6 hour, it require that specific antiserum, and
Detection sensitivity is the highest, there is also non-specific problem;Molecular biology method is primarily referred to as PCR method, the method fast and
Accuracy is the highest, however it is necessary that detecting instrument and the relevant device of costliness, and for as this virus of CMV, due to it
Dilution point of accumulation is 104Times, will sick juice be diluted to 10000 times after just lose infecting potential, therefore need sensitivity the highest
Potential CMV could be detected by detection method, and three of the above method sensitivity is all difficult to reach, and so will there is missing inspection
Possibility, so being badly in need of the new detection method of research.
Summary of the invention
The invention aims to overcome weak point of the prior art, it is provided that a kind of cucumber mosaic virus LAMP draws
Thing;
It is a further object to provide a kind of test kit comprising above-mentioned primer;
It is a further object to provide a kind of method using mentioned reagent box detection cucumber mosaic virus, this inspection
Survey method has: primer specificity is strong, and equipment is simple, and quickly, detection sensitivity is high, stopped pipe detects, simple to operate, result is direct
Can be with features such as interpretations.
In order to achieve the above object, the present invention uses below scheme:
A kind of cucumber mosaic virus LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;Wherein said forward inner primer FIP comprises
F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
One cucumber mosaic virus LAMP kit of the present invention, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;Wherein said forward inner primer FIP comprises
F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
3, cucumber mosaic virus LAMP kit according to claim 2, it is characterised in that described LAMP reaction
Liquid buffer is composed of the following components:
4, cucumber mosaic virus LAMP kit according to claim 2, it is characterised in that described fluorescent dye is
Calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
One cucumber mosaic virus LAMP detection method of the present invention, it is characterised in that comprise the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put into sterilizing examination
Guan Zhong, prepares premixed liquid on ice;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on sterilizing test tubes
Bottom;20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side
Face carries out sight and looks into;If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control
Fluorescence, and it is judged to feminine gender.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that extract sample RNA described in step A,
Concrete extraction according to the following steps:
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that step E middle-ultraviolet lamp irradiation unit
Ultraviolet ray range: wavelength 240-260nm or 350-370nm.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that outer primer and inner primer in described primer
Ratio be l:2-1:10.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that described primer includes that 1.6 μ l are the most outside
Primers F 3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber mosaic virus LAMP detection method as above, it is characterised in that expand temperature in step D and be preferably 63
℃。
In sum, relative to prior art, it provides the benefit that the present invention:
Paramagnetic particle method is used to extract the RNA of WSSV and devise according to the coat protein encoding gene of the main strain of WSSV herein
The universal primer of the LAMP amplification of detection WSSV coat protein large subunit, and establish the system of WSSV LAMP detection, pass through
Body series highly sensitive in one hour can detect the viral existence of WSSV, and detection sensitivity reaches 10fg, and ratio is general
Logical PCR to exceed 1,000 times, and has preferable specificity.The instrument and equipment that additionally this method is the most expensive, it is only necessary to one
Individual couveuse, simple to operate, testing result directly can carry out interpretation by the reaction of color, is especially suitable for basic unit one line
Use, have broad application prospects and extraordinary practical value in terms of the propagating materials Viral diagnosis such as seedling, flowers.
Primer specificity of the present invention is preferable, highly sensitive;Detection method is the shortest.Need expensive detector
Device, testing cost is low.Easy and simple to handle
Detailed description of the invention
Below in conjunction with detailed description of the invention, the invention will be further described:
Material employed in following example of the present invention:
1. material
1.1 cucumber mosaic virus (CMV), tobacco mosaic virus (TMV) (TMV) are purchased from AGDIA company of the U.S..
1.2 main agents and consumptive material
(1) RNA amplification reaction kit Loopamp RNA Amplification kit;
(2)Fluorescence visual detection test kit;
(3)Fluorescence Detection Reagent;
(4)Reaction tubes etc. are all purchased in Beijing Lanpu Biological Technology Co., Ltd.;
1.3 key instrument equipment
(1)-80 DEG C of deep freezer;
(2) the most freezing desk centrifuge of Labofuge400R;
(3) micropipettor, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L,;
(4) ultrapure water system, Milli-Q Academic, Millipore company;
(5) superclean bench;
(6) eddy mixer;
(7) the real-time transmissometer of LAMP, LA-320C, Rong Yan biotech firm of Japan.
Embodiment 1
One cucumber mosaic virus LAMP primer of the present invention, including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
Embodiment 2
One cucumber mosaic virus LAMP kit of the present invention, this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Embodiment 3
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti-
Body is answered to include:
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Lower holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses from test tube side
Face carries out sight and looks into;If sending green glow as positive control, then it is judged to the positive, if do not sent as negative control
Fluorescence, and it is judged to feminine gender.
Embodiment 4
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 5
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 65 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
Embodiment 6
One cucumber mosaic virus LAMP detection method of the present invention, comprises the following steps:
A, extraction sample RNA;
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at magnetic
DdH is sucked under the effect of ferrum2O;
A3, combination: add the sample of 100 μ L in PCR pipe, by liquid-transfering gun compressing mixing sample and nanometer magnetic bead, room temperature
Lower absorption;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C,
10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV;
B, set up LAMP reaction system:
The various reagent of test kit China preserved at taking-20 DEG C at room temperature thaw, and be immediately placed on and preserve on ice after defrosting;
Take various reagent respectively by the response magnitude test kit needed for detection, put in sterilizing test tubes, prepare on ice pre-
Mixed liquid;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;20 μ L LAMP are anti-
Body is answered to include:
Wherein said primer includes 1.6 μ l forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primers
FIP, 0.2 μ l reverse inner primer BIP.
Described LAMP reactant liquor buffer is composed of the following components:
Described fluorescent dye is calcein;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
Described primer sequence:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3;;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
C, sample-adding:
Detected sample RNA to be detected, the moon it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
Property control reaction sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing,
Brief centrifugation makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, sun
Property control reaction use with the positive control of CMV RNA,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 63 DEG C, keeps constant temperature 1 hour, then at 80 DEG C
Constant temperature is kept within 5 minutes, to make enzyme-deactivating to terminate reaction;
E, detection:
Ultraviolet lamp is used to be irradiated from sterilizing test tubes bottom up, wavelength 240-260nm or 350-
370nm.Wear ultraviolet protection glasses to carry out sight from test tube side and look into;If sending green glow as positive control, then it is judged to
The positive, if not sending fluorescence as negative control, and is judged to feminine gender.
The ultimate principle of the present invention and principal character and advantages of the present invention have more than been shown and described.The skill of the industry
The art personnel simply explanation it should be appreciated that the present invention is not restricted to the described embodiments, described in above-described embodiment and description
The principle of the present invention, without departing from the spirit and scope of the present invention, the present invention also has various changes and modifications, these
Changes and improvements both fall within scope of the claimed invention.Claimed scope by appending claims and
Its equivalent defines.
Claims (10)
1. a cucumber mosaic virus LAMP primer, it is characterised in that including:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’。
2. a cucumber mosaic virus LAMP kit, it is characterised in that this test kit includes:
Wherein said primer includes:
Forward outer primer F3:5 ' GGTAACTCACCGGTTTTGGT3 ';
Reversely outer primer B3:5 ' CGGGAGCATCCGTGAGAT3 ';
Forward inner primer FIP:
5’TGTCGCCGATATCAGCACGC-CGGAGTTCAGGCCAACAA3’;
Wherein said forward inner primer FIP comprises F1c and F2:
F1c:5 ' TGTCGCCGATATCAGCACGC3 ';
F2:5 ' CGGAGTTCAGGCCAACAA3 ';
Reversely inner primer BIP:
5’GTACGCCGTCCTGGTTTACTCG-TGCTCGACGTCGACATGAA3’;
Wherein said reverse inner primer BIP includes containing B1c and B2:
Wherein B1c:5 ' GTACGCCGTCCTGGTTTACTC3 ';
B2:5’TGCTCGACGTCGACATGAA3’;
The wherein product specification of this test kit: 40 times.
Cucumber mosaic virus LAMP kit the most according to claim 2, it is characterised in that described LAMP reactant liquor delays
Rush liquid composed of the following components:
Cucumber mosaic virus LAMP kit the most according to claim 2, it is characterised in that described fluorescent dye is that calcium is yellow
Verdazulene;Described enzymatic solution is Bst archaeal dna polymerase and AMV reverse transcriptase mixed liquor.
5. a cucumber mosaic virus LAMP detection method, it is characterised in that comprise the following steps:
A, extraction sample RNA;
B, set up LAMP reaction system:
From the test kit described in claim 2, take various reagent respectively as the response magnitude needed for detection, put in sterilizing test tubes,
Premixed liquid is prepared on ice;Flicking and hit sterilizing test tubes and make it mix, the brief centrifugation several seconds makes solution concentrate on bottom sterilizing test tubes;
20 μ L LAMP reactants include:
C, sample-adding:
Detected sample RNA to be detected, negative right it is separately added in three sterilizing test tubes equipped with 20 μ L LAMP reactants
According to response sample, each 5 μ L of positive control response sample, make respective total amount reach 25 μ L, cover test tube cap and touch mixing, instantaneous
Being centrifuged makes reaction solution concentrate on bottom sterilizing test tubes;Wherein negative control reaction uses deionized water as sample, and the positive is right
The positive control with CMVRNA is used according to reaction,
D, amplification:
Sterilizing test tubes in step C is placed in thermostat, at 60-65 DEG C, keeps constant temperature 1 hour, then protect at 80 DEG C
Holding constant temperature makes enzyme-deactivating to terminate reaction for 5 minutes;
E, detection:
Use ultraviolet lamp to be irradiated from sterilizing test tubes bottom up, wear ultraviolet protection glasses and enter from test tube side
Row sight is looked into;If sending green glow as positive control, then it is judged to the positive, if not sending glimmering as negative control
Light, and it is judged to feminine gender.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that extract sample described in step A
Product RNA, extracts the most according to the following steps:
A1, take 0.1g the susceptible tissue of CMV and TMV add 1mL extraction buffer be ground;
A2, cleaning nanometer magnetic bead: in taking-up nanometer magnetic bead to PCR pipe, use ddH2O cleans nanometer magnetic bead 3 times repeatedly, at Magnet
DdH is sucked under effect2O;
A3, combination: add the sample of 100 μ L in PCR pipe, with liquid-transfering gun compressing mixing sample and nanometer magnetic bead, inhale under room temperature
Attached;
A4, cleaning: remove supernatant under the effect of Magnet, nanometer magnetic bead cleans 3 times;
A5, cracking: add 50 μ L ddH2O is in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, and 95 DEG C, 10min;
A6, sampling: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of CMV and TMV.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that step E middle-ultraviolet lamp irradiates
The ultraviolet ray range of device: wavelength 240-260nm or 350-370nm.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that outer primer in described primer
It is l:2-1:10 with the ratio of inner primer.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that described primer includes 1.6 μ l
Forward outer primer F3,1.6 μ l reverse outer primer B3,0.2 μ l forward inner primer FIP, 0.2 μ l reverse inner primer BIP.
Cucumber mosaic virus LAMP detection method the most according to claim 5, it is characterised in that expand temperature in step D
It is preferably 63 DEG C.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610649664.XA CN106119420A (en) | 2016-08-09 | 2016-08-09 | Cucumber mosaic virus LAMP primer, test kit and detection method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201610649664.XA CN106119420A (en) | 2016-08-09 | 2016-08-09 | Cucumber mosaic virus LAMP primer, test kit and detection method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN106119420A true CN106119420A (en) | 2016-11-16 |
Family
ID=57257387
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201610649664.XA Pending CN106119420A (en) | 2016-08-09 | 2016-08-09 | Cucumber mosaic virus LAMP primer, test kit and detection method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN106119420A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107177700A (en) * | 2017-07-19 | 2017-09-19 | 上海市农业科学院 | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus |
CN107354235A (en) * | 2017-06-21 | 2017-11-17 | 陈定虎 | Primer, kit and the authentication method of potato virus X identification |
CN108624719A (en) * | 2018-06-21 | 2018-10-09 | 中国科学院寒区旱区环境与工程研究所 | A kind of kit and its detection method of specific detection lily cucumber mosaic virus |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102286637A (en) * | 2011-07-21 | 2011-12-21 | 陕西省烟草研究所 | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology |
CN105177178A (en) * | 2015-06-25 | 2015-12-23 | 陈定虎 | Tobacco mosaic virus LAMP detection kit |
CN105671210A (en) * | 2016-03-31 | 2016-06-15 | 陈定虎 | LAMP technology-based primer, kit and detection method for detecting Plum pox virus |
-
2016
- 2016-08-09 CN CN201610649664.XA patent/CN106119420A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102286637A (en) * | 2011-07-21 | 2011-12-21 | 陕西省烟草研究所 | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology |
CN105177178A (en) * | 2015-06-25 | 2015-12-23 | 陈定虎 | Tobacco mosaic virus LAMP detection kit |
CN105671210A (en) * | 2016-03-31 | 2016-06-15 | 陈定虎 | LAMP technology-based primer, kit and detection method for detecting Plum pox virus |
Non-Patent Citations (2)
Title |
---|
RYOTA SUZUKI ET AL.: "Development of the loop-mediated isothermal amplification method for rapid detection of cytomegalovirus DNA", 《JOURNAL OF VIROLOGICAL METHODS》 * |
赵雪君 等: "蔬菜中黄瓜花叶病毒的RT-LAMP快速检测", 《园艺学报》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107354235A (en) * | 2017-06-21 | 2017-11-17 | 陈定虎 | Primer, kit and the authentication method of potato virus X identification |
CN107177700A (en) * | 2017-07-19 | 2017-09-19 | 上海市农业科学院 | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus |
CN108624719A (en) * | 2018-06-21 | 2018-10-09 | 中国科学院寒区旱区环境与工程研究所 | A kind of kit and its detection method of specific detection lily cucumber mosaic virus |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Wang et al. | Development of a novel quantitative real‐time PCR assay with lyophilized powder reagent to detect African swine fever virus in blood samples of domestic pigs in China | |
Sithigorngul et al. | A convenient immunochromatographic test strip for rapid diagnosis of yellow head virus infection in shrimp | |
Bergmann et al. | Detection of koi herpes virus (KHV) genome in apparently healthy fish | |
WO2008079463A2 (en) | Biological organism identification product and methods | |
CN106119420A (en) | Cucumber mosaic virus LAMP primer, test kit and detection method | |
CN103409555B (en) | Macrobrachium rosenbergii Nodavirus RT-LAMP-LFD detection method and detection kit thereof | |
Zhang et al. | An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood | |
CN104946798B (en) | The primer and method of tobacco mosaic virus (TMV) LAMP detections | |
CN106282405A (en) | Rose mosaic virus LAMP primer, test kit and detection method | |
Magouz et al. | Detection of infectious laryngotracheitis virus (Gallid herpesvirus-1) from clinically infected chickens in Egypt by different diagnostic methods | |
CN107365684B (en) | A kind of paper micro-fluidic chip and its method for extracting nucleic acid and isothermal amplification method | |
Ashraf et al. | Isolation, identification and molecular characterization of highly pathogenic Newcastle disease virus from field outbreaks | |
Zhang et al. | Development of immunocapture reverse transcription loop‐mediated isothermal amplification assays to detect both lily symptomless virus and cucumber mosaic virus | |
CN105177178A (en) | Tobacco mosaic virus LAMP detection kit | |
CN101818211B (en) | Molecule detection method for cowpea severe mosaic virus | |
CN104419686A (en) | Recombinant prrs virus hv-nsp9 and application thereof | |
CN102191324B (en) | Trypanosoma evansi and trypanosoma lewisi dual-polymerase chain reaction (PCR) assay kit and preparation method thereof | |
CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit | |
CN104195270B (en) | The visual quick detection kit of white spot syndrome virus (WSSV) and detection method | |
Saeed et al. | A study on transmission of Peste des petits ruminants virus between dromedary camels and small ruminants | |
CN106282406A (en) | Cucumber green mottle mosaic LAMP primer, test kit and detection method | |
CN106119418A (en) | Abaca bunchy top virus LAMP primer, test kit and detection method | |
Al-Sadawi et al. | Viral agent that causing diarrhoea among children in Al-Najaf province, Iraq | |
CN106119419A (en) | White spot syndrome virus LAMP primer, test kit and detection method | |
CN106222303A (en) | Bean pod mottle virus LAMP primer, test kit and detection method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161116 |