CN103060476A - MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination - Google Patents
MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination Download PDFInfo
- Publication number
- CN103060476A CN103060476A CN2013100269780A CN201310026978A CN103060476A CN 103060476 A CN103060476 A CN 103060476A CN 2013100269780 A CN2013100269780 A CN 2013100269780A CN 201310026978 A CN201310026978 A CN 201310026978A CN 103060476 A CN103060476 A CN 103060476A
- Authority
- CN
- China
- Prior art keywords
- mmv
- mosaic virus
- time fluorescence
- probe
- real
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a MP (movement protein)-gene-based PCR (polymerase chain reaction) detection method for performing rapid molecular identification on cucumber green mottle mosaic virus (CGMMV), and a probe and primer combination applied to the method. The sequences of primers and a probe include forward primer MMV-F1, downstream primer MMV-R1 and fluorescence probe MMV-1. The method comprises the following steps of: (1) extracting total RNA (Ribose Nucleic Acid) of plant tissue from a sample to be tested; (2) introducing the downstream primer MMV-R1 for implementing synthesis of a reverse transcription template cDNA with taking the total RNA as a template; (3) performing real-time fluorescence PCR amplified reaction when the forward primer, the downstream primer and the fluorescence probe are arranged in a fluorescence PCR instrument; and (4) comparing a collected fluorescence curve CT value with a standard curve CT value after the reaction is ended, and judging the detection result. The method can be applied to the field of molecular diagnosis on biological species.
Description
Technical field
The present invention relates to a kind of cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene, and the detection that is applied in the method probe and combination of primers.
Background technology
Cucumber green mottle mosaic virus (
Cucumber green mottle moasic virus, CGMMV) be subordinate to Tombusviridae (
Tombusviridae) Tobamovirus (
Tobamovirus), be one of important virus of serious harm ground family crop, be typical Seed-borne Virus.This virus is found first on the cucumber of nineteen thirty-five in Britain and is reported, so called after cucumber virus 3 (CV3) and cucumber virus-4 (CV4), is recorded and narrated by Anisworth.The CGMMV strain is numerous, comprise Britain and European reporting typical strain (
Cucumber green mottle mosaic virus), cucumber peach jaurel floral leaf strain (
Cucumber aucuba mosaicvirus), the watermelon strain of Japan Report (
Watermelon strain) and Japanese cucumber strain (
Japanese cucumber strain), foreign eastern strain (
Yodo strain) and India C strain (
Indian strain C).Korea S has reported the strains such as CGMMV-KW, CGMMV-KM4, CGMMV-HY and CGMMV-KOW.Also there was the report of some strains system in China in recent years, as separate from Guangxi, CGMMV-GX, the CGMMV-LN on the ground such as Liaoning, Liaoning etc.
Cucumber green mottle mosaic virus worldwide extensively distributes, mainly be distributed in Britain, Germany, Holland, Denmark, Finland, Sweden, Greece, Russia, Romania, the Spain in Europe, the Brazil in South America, the countries and regions such as the Israel in Asia, Pakistan, Iran, India, Saudi Arabia, Japan, Korea S.The report of existing this virus of TaiWan, China in 1987.Find that at China Liaoning, Guangxi, Guangdong province this virus causes harm in recent years, cause the farm crop underproduction even the total crop failures in various degree such as watermelon, cucumber, muskmelon, pumpkin, financial loss is very serious.
The host range of CGMMV is narrow, comprises Chenopodiaceae, Solanaceae and cucurbitaceous plant, mainly infects the plants such as cucumber cucurbitaceous, watermelon, muskmelon, pumpkin, balsam pear, sponge gourd, summer squash and cucurbit.It is variant because of the difference of host, environment and strain that CGMMV infects the symptom that causes, generally cause plant strain growth slowly, downgrade, blade is mottled, concavo-convex, deformity and blister, the pulp variable color, rots and fibrosis.Infect behind the cucumber and yellow speckle occurs at young leaves, the later stage is floral leaf and with the projection of strong green, fading between vein is the greenbelt shape; Plant is downgraded, and fruit is impaired serious, produces silvery white streak on the surface, and output can descend 15%; Show as light-duty leaf mottle after infecting watermelon, plant is downgraded, and fructescence serious symptom, fruit surface form strong green circle spot, and inside the pulp variable color occurs and rots.Cause stem end young leaves macula lutea to occur at muskmelon, but with the blade aging sx↓.Show as after the pumpkin plant is susceptible dwarfing, green arteries and veins and floral leaf etc. symptom.
Cucumber green mottle mosaic virus mainly is present in the tissues such as pollen, the plumular axis of planting skin, sick seedling, blade, fruit.Be typical Seed-borne Virus, the biography poison rate of cucumber fresh seeds is 8%, preserves to drop to 1% afterwards in 5 months, and it is 5% that watermelon seed passes malicious rate, and soil belt poison rate is very low.Cucumber is chrysomelid might to be insect vector, the report that does not have at present aphid to pass.South Dodder Seed Chinese Dodder Seed mainly comprises amboceptor
C. subinclusaWith
C.campestris
History occurs at it and caused serious harm in the virus disease that CGMMV causes.Britain was reported on the cucumber the earliest and occured nineteen thirty-five; Japan Reports in 1969 are crossed the generation of this disease, are called as at that time " konjaku is sick "; German greenhouse cucumber in 1974 is subject to this viral influence area and reaches 5%; Sickness rate on the cucumber of USSR (Union of Soviet Socialist Republics) Georgia in 1976 area reaches 80～100%, causes the cucumber underproduction 30%; Korea S in 1989 reports that this disease big area on field crop spreads, and causes the tremendous economic loss, causes harm watermelon and the cucumber of Korea S again in 1998, and the disaster area reaches 463hm
2, cause " watermelon blood flesh is sick ", bring about great losses.TaiWan, Chinas in 1987 have the report of this disease Occurrence; Be separated to this virus at the greenhouse in Guangxi pumpkin in 2003; Big area occurs on the watermelon of Central Liaoning in 2005, harm, and this is the report that this disease occurs in the land for growing field crops first in the continent.Xiamen Entry-Exit Inspection and Quarantine Bureau repeatedly intercepted and captured this virus from the Pumpkin Seed that Japan enters the territory in 2004～2006 years.Gansu office in 2009 import in Muscovite cucumber seeds to intercepting and capturing this virus.No. 862 official documents of the Ministry of Agriculture in 2007 " People's Republic of China (PRC) enter the territory Plant Quarantine harmful organism register " are classified it as important external quarantine harmful organisms.
CGMMV is direct rod shape virus, and the about 300 * 18nm of size of particles, nucleic acid are linear single positive chain RNA, and genome length is about 6.5kb, is single-component.4 protein moleculars of genome encoding, relevant with copying of virus near two albumen of 126kDa and 183kDa of 5 ' end, wherein 183kDa reads to produce by 126kDa albumen terminator is super; Two other albumen is respectively the coat protein (Coat protein, CP) of motion albumen (Movement protein, MP) and the 17.5kDa of about 30kDa, and these two albumen are expressed by different subgenomic RNAs respectively and produced.Viral genome 5 ' end and 3 ' end contain respectively one section non-coding region (Noncoding region, NCR), and 5 ' end contains cap sequence, and 3 ' end has the similar tRNA shape structure that can accept Histidine.
Half a century, modern virusology research level improves constantly, and the Detecting technology is also in development and improvement.The Detecting method mainly comprises withered spot and plant indicator detection method, serological detection method, enzyme-labeled immunity absorption method (ELISA), negative staining electron microscope detection method, immuno-electron microscope detection method, Electronic Speculum ultrathin sectioning and conventional PCR detection method at present.
C. Varveri adopts DAS-ELISA (Double-antibody sandwich ELISA) and two kinds of enzyme-linked immunosorbent assays of F (ab') 2-ELISA that Greece's isolate is detected, and having compared the detection sensitivity of two kinds of methods, the latter exceeds 10 than the former susceptibility
3Doubly; Shim has carried out qualitative detection with the DAS-ELISA method to the sample from performance CGMMV symptom on the cucurbit; Choi etc. are with RIPA (Radioimmunoprecipitation Assay, the radioimmunoprecipitation detection method) develops into multi – RIPA technology, and detecting simultaneously CGMMV on watermelon, cucumber, summer squash and edible gourd, the minimum quantity that multi-RIPA detects CGMMV is 50ng/ml; Kawai etc. use M-ELISA (modified ELISA) to detect cucumber seeds, and the result is sensitiveer than standard ELISA, and its sensitivity is equivalent to detect 1 granulosis kind in 800 healthy seeds.Serological method is the conventional sense method of generally using at present, and workable, detected result is relatively reliable.But the method cost is higher, and is periodically long, and sensitivity is limited, is difficult to detection level virus seldom.
RT-PCR is reverse transcription RNA and utilizes the single stranded oligonucleotide primer DNA fragment specific to be carried out the method for external rapid amplifying.Zhang Yongjiang etc. (2008) have carried out DAS-EL IS A and RT-PCR detection to the different germ plasm resources of cucurbit, watermelon, 3 kinds of crops of muskmelon and the different treatment of germ plasm resource of the same race, the different germ plasm resources that result's demonstration is infected all can be with poison, and the sensitivity of RT-PCR method is far above ELISA, and set up the technological method that directly detects CGMMV from the cucurbit seed.Huang waits (2007) quietly and has detected sick leaf and the virus of the CGMMV in the withered spot of Chenopodium amaranticolor of cucumber, cucurbit, three kinds of crops of pumpkin with the method, the purpose band of the 650bp that all can increase, but the band sharpness is general, illustrate that detection level is limited.In addition, be stored in the sick leaf of freezing cucumber in-20 ℃ through test of many times all without the purpose band, can not accurately detect the sample of preserving under the test conditions is a large defective of the method.Li Hongxia etc. (2007) use the RT-PCR method that the pumpkin fruit that picks up from Gansu is detected, and have CGMMV virus in the detected result proof fruit.Slavokhotov etc. (2007) adopt the RT-PCR method to detect and separate from Muscovite two CGMMV virus strains for CP gene design primer.Chang etc. (2005) adopt the RT-PCR method to detect CGMMV virus from Korea S's water melon leaf, obtain the CP gene of 646bp, clearly are the CGMMV-HY1 strain.Deng Cong very waits (2008) with nanometer magnetic bead (Magnetic Nano Particles, MNP) and RT-PCR combination, has set up the novel method that detects CGMMV.With the RNA in the nanometer magnetic bead extraction positive material, carry out respectively the RT-PCR amplification with three groups of primers, detect the CGMMV line sensitivity of going forward side by side and measure, found that the method can detect the CGMMV in the 10ng leaf tissue, sensitivity is 1/10 of conventional sense method.Although saved time and step in the RNA leaching process, the method relies on highly sensitive antibody, has improved cost, and does not have good change in detection sensitivity, so popularize and utilization is restricted.
Summary of the invention
Technical problem to be solved by this invention is to overcome the deficiencies in the prior art, primer and the fluorescent probe of a pair of specific detection cucumber green mottle mosaic virus of a kind of movement protein gene for CGMMV (MP gene) design are provided, and optimizing reaction system and response procedures, set up the method for real-time fluorescence RT-PCR rapid detection CGMMV virus.The specificity test result shows that the method has very strong specificity, can be from TMV belongs in the virus of kind more than 10 specificity detect CGMMV virus, and can detect simultaneously the different isolates of four CGMMV.The method susceptibility is far above the detected result of conventional RT-PCR method, and the method also can directly apply to the detection of Curcurbitaceae band seed culture of viruses simultaneously, has greatly shortened detection time, and detected result accurately and reliably.
U.S. Applied Biosystems company released Real-Time Fluorescent Quantitative PCR Technique (Real-time fluorescent quantitative PCR in 1996, FQ-PCR), namely in the PCR testing process, add fluorescence dye or fluorophor, utilize the whole PCR reaction process of accumulation Real-Time Monitoring of fluorescent signal, by typical curve unknown template is carried out quantitative analysis at last.This technology has realized the leap of PCR method from qualitative to quantitative, and compare with conventional PCR, have highly sensitive, high specificity, circulation ratio by force, rapidly and efficiently, with low cost, level of automation is high, effectively solve the characteristics such as PCR pollution problem, now has been widely used in human diseases, animal virus, and numerous areas such as animals and plants disease detection and prevention.
The technical solution adopted in the present invention is: should comprise upstream primer MMV-F1, downstream primer MMV-R1 and fluorescent probe MMV-1 with probe and combination of primers based on the cucumber green mottle mosaic virus real-time fluorescence PCR detection of MP gene, its sequence is as follows respectively:
MMV-F1：5’- CACCTTTATGTCACATTGTTG-3’；
MMV-R1：5’- GAATGCATCCTTGTGTCAAC -3’；
MMV-1：5’-FAM-CTACAGGATTCCGGTACGTTCCAT-TAMRA-3’。
Described cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene may further comprise the steps:
(1) gets testing sample and extract the total RNA of plant tissue;
(2) take total RNA as template, introduce described downstream primer MMV-R1 and carry out the synthetic of reverse transcription template cDNA;
(3) place the fluorescent PCR instrument to carry out the real-time fluorescence PCR amplified reaction described upstream primer MMV-F1, described downstream primer MMV-R1 and described fluorescent probe MMV-1;
(4) after reaction finished, the fluorescent PCR instrument read the CT value and judges detected result.
When carrying out reverse transcription template cDNA synthetic in above-mentioned steps (2), its reaction system is: Total RNA 2.5 μ L, 5 * PCR damping fluid, 2 μ L, dNTP 1 μ L, downstream primer MMV-R1 (10 μ mol/L) 2 μ L, ThermoScript II 0.5 μ L adds ddH
2O is to total system 10 μ L; Reaction conditions: 37 ℃ of 15min, 85 ℃ of 5sec, 16 ℃ of 30sec, reaction saves backup template after finishing in-4 ℃.
Real-time fluorescence PCR reaction system in above-mentioned steps (3) is: 2 * premix Taq (Real Time) mixed reaction solution, 10 μ L, upstream and downstream primer (MMV-F1, MMV-R1,10 μ mol/L) each 1.25 μ L, fluorescent probe MMV-1 1 μ L, template cDNA 2 μ L add ddH
2O supplies 20 μ L; Reaction conditions is: 95 ° of C, 30s; 95 ° of C 5s, 60 ° of C 30s, 45 circulations.
In the above-mentioned steps, the working concentration scope of described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.1～0.8 μ mol/L.
Further, the working concentration of described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.5 μ mol/L.
The concentration range of described fluorescent probe MMV-1 is 0.05～0.5 μ mol/L.
Further, the concentration range of described fluorescent probe MMV-1 is 0.25 μ mol/L.
The invention has the beneficial effects as follows: the present invention is directed to the quarantine harmful organisms cucumber green mottle mosaic virus (
Ccucumber green mottle mosaic virus, CGMMV), designed Auele Specific Primer and fluorescent probe, set up the method for real-time fluorescence PCR rapid detection CGMMV, and the method has directly been applied to detection with seed culture of viruses.The method has quick and precisely, highly sensitive and omnidistance stopped pipe, need not the advantages such as electrophoresis detection, has reduced the contact of toxic reagent, also tapers to detection time within 2 hours, has improved greatly efficient.Whole process adopts fluorescent signal to amplify and the omnidistance control of computer, reduces personal errors, has improved sensitivity, and high nearly 100 times of the Conventional RT-PCR sensitivity that evidence the method is crossed than system optimization is applicable to the detection of viral low levels.
Description of drawings
Fig. 1 is that real-time fluorescence PCR detects CGMMV specific detection interpretation of result synoptic diagram, wherein, C4: from the cucumber green mottle mosaic virus (CGMMV-GD-LZ) of Leizhou, Guangdong, D4: from the cucumber green mottle mosaic virus (CGMMV-GD-GZ) of gaozhou,guangdong, E4: from the cucumber green mottle mosaic virus (CGMMV-GD-LF) in Lufeng, Guangzhou, E5: from the cucumber green mottle mosaic virus (CGMMV-DIA) of Agdia, F4: Tomato mosaic virus (ToMV), G4: the blue ring spot virus (ORSV) of radula, H4: prv (PRSV), F5:Kyuri green mottle mosaic virus (KGMMV), G5: little summer squash green mottle mosaic virus (ZGMMV), H5: tobacco mosaic virus (TMV) (TMV), F6: No. 2, watermelon mosaic virus (WMV-2), G6: the light mottle virus of capsicum (PMMV), H6: plantago mosaic virus (RMV), F7: marmor tritici (WSBMV), G7: standard control group, H7: water control group;
Fig. 2 is CGMMV virus Analysis of test results synoptic diagram in band seed culture of viruses, wherein, D7: the sub-1(CGMMV-Cu1 of cucumber band seed culture of viruses), D8: the sub-2(CGMMV-Cu2 of cucumber band seed culture of viruses), D9: cucumber band seed culture of viruses: (CGMMV-Sq), D10: summer squash band seed culture of viruses (CGMMV-Pu), G10: cucumber green mottle mosaic virus (CGMMV-GD-LZ) control group, G11: standard control group, D11: water control group;
Fig. 3 is the kinetic curve that described real-time fluorescence PCR detects CGMMV sensitivity, wherein, and 10 times of diluents of 1-2:CGMMV virus; 3-4:10
2Times diluent; 5-6:10
3Times diluent; 7-8:10
4Times diluent; 9-10:10
5Times diluent; 11-12:10
6Times diluent; 13-14:10
7Times diluent;
Fig. 4 is the typical curve that described real-time fluorescence PCR detects CGMMV sensitivity.
Embodiment
The below is described in detail the present invention.Should may further comprise the steps based on the cucumber green mottle mosaic virus real-time fluorescence PCR detection method of MP gene:
One, selects for test materials.The viral sample for test that the present invention adopts sees Table 1.
Table 1 is for the test viral sample
Main agents and instrument that the present invention uses are as follows: pcr amplification reagent is given birth to worker's biotechnology company limited by Shanghai and is provided; Primer and probe are synthetic by precious biotechnology (Dalian) company limited; Other reagent are by common molecular biology experiment operational provisions.Fluorescent PCR instrument: Luo Shi LightCycler 480 quantitative real time PCR Instruments; Table model high speed centrifuge Eppendorf 5415D.
Two, get testing sample and extract the total RNA of plant tissue.
Adopt liquid nitrogen to carry out the pre-treatment of test sample, the total RNA of plant extracts according to test kit (TaKaRa Code:D9108A) method, and operation steps is as follows:
(1) in refrigerator, gets the mortar that freezing sample places precooling, add liquid nitrogen, be ground to rapidly Powdered;
(2) rapidly powdered samples is transferred in the 2ml centrifuge tube, adds 1ml RNAiso Plus, the thermal agitation mixing, until sample is the homogenate shape, room temperature leaves standstill 5min;
(3) 12000g, 4 ℃ of centrifugal 5min;
(4) carefully draw supernatant (1ml), be transferred in the new 2ml centrifuge tube.
(5) add the chloroform (200 μ L) of 1/5 volume in the mentioned solution, cover tightly the pipe lid, concuss 15sec, after solution was fully emulsified, room temperature left standstill 5min;
(6) 12000g, 4 ℃ of centrifugal 15min;
(7) the careful centrifuge tube that takes out from whizzer, this moment, solution divided three layers.The careful supernatant liquid (400 μ L) of drawing is transferred in the new 2ml centrifuge tube;
(8) add the Virahol of equal-volume (400 μ L) in the above-mentioned clear liquid, the abundant mixing of the centrifuge tube that turns upside down, room temperature leaves standstill 10min;
(9) 12000g, 4 ℃ of centrifugal 10min manage the end adularescent precipitation this moment;
(10) supernatant discarded carefully slowly adds 75% ethanol of 1ml precooling along the centrifuge tube tube wall, is sure not to touch precipitation.The centrifuge tube washing precipitation of turning upside down lightly;
(11) 12000g, 4 ℃ of centrifugal 5min discard ethanol carefully, keep precipitation;
(12) under the room temperature state dry about 10 minutes;
(13) treat that ethanol fully dries after, add 60 μ L, RNase-free H2O dissolution precipitation in the centrifuge tube;
(14) RNA after the dissolving is stored in-20 ℃ of refrigerators, and is for subsequent use.
Three, according to the nucleotide sequence of the different strains of listed CGMMV among the GenBank, utilize DNAStar software package PrimerSelect design primer and probe.The synthetic of primer and probe finished relevant information such as the table 2 of primer and fluorescent probe by Shanghai biotechnology company limited.
Table 2 Auele Specific Primer and probe
Four, take total RNA as template, introduce described downstream primer MMV-R1 and carry out the synthetic of reverse transcription template cDNA.
Take total RNA as template, make the synthetic cDNA of primer reverse transcription with downstream primer MMV-R1, add in the 0.2mlPCR pipe: Total RNA 2.5 μ L, 5 * PCR damping fluid, 2 μ L, dNTP 1 μ L, MMV-R1 (10 μ mol/L) 2 μ L, ThermoScript II 0.5 μ L adds ddH
2O is to total system 10 μ L.Reaction conditions: 37 ℃ of 15min, 85 ℃ of 5sec, 16 ℃ of 30sec, reaction saves backup template after finishing in-4 ℃.
Five, place the fluorescent PCR instrument to carry out the real-time quantitative fluorescence PCR amplified reaction described upstream primer MMV-F1, described downstream primer MMV-R1 and described fluorescent probe MMV-1.Its reaction system is: 2 * premix Taq (Real Time) mixed reaction solution, 10 μ L, and each 1.25 μ L of upstream and downstream primer (MMV-F1, MMV-R1,10 μ mol/L), fluorescent probe MMV-1 1 μ L, template cDNA 2 μ L add ddH
2O supplies 20 μ L; Reaction conditions is: 95 ° of C, 30s; 95 ° of C 5s, 60 ° of C 30s, 45 circulations.Specific as follows:
1, the optimization of primer and concentration and probe concentration
The working concentration scope of described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.1～0.8 μ mol/L, and the concentration range of described fluorescent probe MMV-1 is 0.05～0.5 μ mol/L.The working concentration of described upstream primer MMV-F1 and described downstream primer MMV-R1 by 0.25 μ mol/L for gradient is set, described fluorescent probe concentration is set to 0.1 μ mol/ L, 0.25 μ mol/ L, 0.5 μ mol/ L and four concentration of 0.75 μ mol/ L, primer is carried out different proportioning tests with concentration and probe concentration, according to CT value and tracing pattern, determine optimum concn and proportioning.The working concentration of getting described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.5 μ mol/L, and the concentration of described fluorescent probe MMV-1 is 0.25 μ mol/L.
2, the optimization of loop parameter
Luo Shi LightCycler 480 quantitative real time PCR Instruments according to use in the laboratory are optimized test conditionss such as annealing temperature, loop parameters, reach best amplification efficiency with expectation.
3, specific detection
The Fluorescence PCR assay of setting up with test to Tobamovirus (
Tobamovirus) the nine kind viruses high with the CGMMV homology, and a marmor tritici carries out specific detection.
4, sensitivity detects
With the CGMMV positive product cDNA of reverse transcription, dilution is 10 respectively
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7Seven concentration gradients join in the Fluorescence PCR system, carry out sensitivity and detect.Each gradient is done two repetitions.
Six, after the PCR reaction finishes, compare by fluorescence curve CT value and the known typical curve CT value of collecting, judge detected result.
Seven, results and analysis.
1, specificity checking
Sample in the his-and-hers watches 1 carries out Fluorescence PCR, detects the specificity of primer and probe.The result as depicted in figs. 1 and 2, the different isolates of all CGMMV virus all have specific amplification, the Ct value is between 22～25, other several viruses all do not have fluorescent signal.Show that this group primer that this test is adopted has very strong specificity.
2, sensitivity detects
Real-time fluorescence PCR sensitivity detected result is seen Fig. 3 and Fig. 4, and all test concentrations of CGMMV positive detection sample all detect fluorescent signal, and the Ct value is relevant with dna profiling concentration, and template concentrations is 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6The time, the Ct value of amplification is respectively 14.6,18.1,21.6,24.9,28.0,31.6.10
-7Concentration under the fluorescent PCR amplification curve obvious, the Ct value between two Duplicate Samples is respectively 34.66 and 35.49, has embodied good reproducibility, shows that the detection limit of the method is 10
-7Below.
Since in January, 2007; cucumber green mottle mosaic virus real-time fluorescence PCR Fast Detection Technique is applied at each branch port of Zhuhai inspection and quarantine bureau; in entering the territory vegetable seed CGMMV quarantine, the inspection and quarantine port brought into play vital role; use this achievement to the Quarantine on production site of Curcurbitaceae seed and allocation and transportation quarantine and Seed Market quarantine examination of law enforcement action with Guangdong Province's Plant Quarantine station cooperation simultaneously; investigation is found; Guangdong Province mainly contains the Leizhou City; Gaozhou City; Lufeng City and Haifeng County generation cucumber green mottle mosaic virus are sick; 2927 mu of areas occur; in more than 400 batches in the selective examination detection Curcurbitaceae seed; successively find wax gourd; about 975 kilograms of the band such as pumpkin seed culture of viruses; in time take active and effective quarantine treatment measures according to the relevant laws rules; effectively stop epidemic situation to be propagated, protected China's agricultural production security.Therefore, this technology is in that effectively to resist the ecological benefits and the social benefit that obtain aspect CGMMV invasion, protection China agroforestry production safety, maintaining ecological balance, assurance public health security and the foreign trade huge.
The present invention is according to the MP gene sequence characteristic, with reference to Tobamovirus among the GenBank (
Tobamovirus) other kinds sequence, Auele Specific Primer and probe have been screened in design, and optimizing reaction system and reaction conditions are set up the real-time fluorescence PCR detection method of specific detection CGMMV.Detected result shows that the real-time fluorescence quantitative PCR detection method of foundation can detect 10
7The sample of weaker concn, sensitivity are higher than conventional PCR far away.The method is directly used in detection band seed culture of viruses, from wax gourd, pumpkin, cucumber seeds and summer squash seed, detects CGMMV respectively, realized quick, the accurate and stable detection with seed culture of viruses.The real-time fluorescence PCR detection method of the specific detection CGMMV that the present invention sets up has accurate sensitivity, and ageing strong, cost is low, and the characteristics that sensing range is wide are highly suitable for applying of inspection and quarantine port.
The movement protein gene (MP gene) that the present invention is directed to CGMMV designs primer and the fluorescent probe of a pair of specific detection cucumber green mottle mosaic virus, and optimizing reaction system and response procedures, has set up the method for real-time fluorescence PCR detection CGMMV virus.The specificity test result shows that the method has very strong specificity, can be from TMV belongs in the virus of kind more than 10 specificity detect CGMMV virus, and can detect simultaneously the different isolates of four CGMMV.The method susceptibility is far above the detected result of conventional RT-PCR method, and the method also can directly apply to the detection of Curcurbitaceae band seed culture of viruses simultaneously, has greatly shortened detection time, and detected result accurately and reliably.
The present invention can be applicable to the living species molecular diagnosis field.
SEQUENCE LISTING
＜110〉Chen Weidong, Liao Li, Wang Lan, Liang Yuying, Quan Yongbing, Chi Yuanli, Xu Miaofeng
＜120〉based on cucumber green mottle mosaic virus real-time fluorescence PCR detection method and probe and the combination of primers of MP gene
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
＜213〉artificial sequence
<220>
<221> misc_feature
<222> (1)…(21)
＜223〉upstream primer MMV-F1
<400> 1
cacctttatg tcacattgtt g 21
<210> 2
<211> 20
<212> DNA
＜213〉artificial sequence
<220>
<221> misc_feature
<222> (1)…(20)
＜223〉downstream primer MMV-R1
<400> 2
<210> 3
<211> 24
<212> DNA
＜213〉artificial sequence
<220>
<221> misc_feature
<222> (1)… (24)
＜223〉fluorescent probe MMV-1
<400> 3
ctacaggatt ccggtacgtt ccat 24
<210> 4
<211> 1585
<212> DNA
＜213〉artificial sequence
<220>
<221> misc_feature
<222> (1)…(1585)
＜223〉cucumber green mottle mosaic virus MP gene fragment amplification recombinant plasmid sequence
<400> 4
catgccaacg gctgtattgt ttaccctgac cctttaaaat taattagtaa attaggtaat 60 aagagtcttg tagggtatga gcatgttgag gagtttcgta tatctctcct cgacgttgct 120 catagtttgt ttaatggtgc ttatttccat ttactcgacg atgcaatcca cgaattattt 180 cctaatgctg ggggttgcag ttttgtaatt aattgtttgt gtaagtattt gagtgataag 240 cgccttttcc gtagtcttta catagatgtc tctaagtaag gtgtcagtcg agaactcgtt 300 gaaacctgag aagtttgtca aaatctcttg ggtcgataag ttgctcccta actatttttc 360 cattcttaag tatttatcta taactgactt tagtgtagtt aaagctcaga gctatgaatc 420 cctcgtgcct gtcaagttgt tgcgtggtgt tgatcttaca aaacaccttt atgtcacatt 480 gttgggcgtt gtggtttctg gtgtatggaa cgtaccggaa tcctgtaggg gtggtgctac 540 tgttgctctg gttgacacaa ggatgcattc tgttgcagag ggaactatat gcaaattttc 600 agctcccgcc accgtccgcg aattctctgt taggttcata cctaattatt ctgtcgtggc 660 tgcggatgcc cttcgcgatc cttggtcttt atttgtgaga ctctctaatg tgggtattaa 720 agatggtttc catcctttga ctttagaggt cgcttgttta gtcgctacaa ctaactctat 780 tatcaaaaag ggtcttagag cttctgtagt cgagtctgtc gtctcttccg atcagtctat 840 tgtcctagat tctttatccg agaaagttga acctttcttt gacaaagttc ctatttcagc 900 ggctgtaatg gcaagagatc ccagttatag gtctaggtcg cagtctgtcg gtggtcgtgg 960 taagcggcat tctaaacctc caaatcggag gttggactct gcttctgaag agtccagttc 1020
tgtttctttt gaagatggct tacaatccga tcacacctag caaacttatt gcgtttagtg 1080
cttcttatgt tcccgtcagg actttactta attttctagt tgcttcacaa ggtaccgctt 1140
tccagactca agcgggaagg gattctttcc gcgagtccct gtctgcgtta ccctcgtctg 1200
tcgtagatat taattctaga ttcccagatg cgggttttta cgctttcctc aacggtcctg 1260
tgttgaggcc tatcttcgtt tcgcttctca gctccacgga tacgcgtaat agggtcattg 1320
aggttgtaga tcctagcaat cctacgactg ctgagtcgct taacgctgta aagcgtactg 1380
atgacgcgtc tacagccgct agggctgaga tagataattt aatagagtct atttctaagg 1440
gttttgatgt ttacgacagg gcttcatttg aagccgcgtt ttcggtagtc tggtcagagg 1500
ctaccacctc gaaagcttag tttcgagggt cttctgatgg tggtgcacac caaagtgcat 1560
agtgctttcc cgttcactta aatcg 1585
Claims (7)
1. the cucumber green mottle mosaic virus real-time fluorescence PCR based on the MP gene detects with probe and combination of primers, it is characterized in that it comprises upstream primer MMV-F1, downstream primer MMV-R1 and fluorescent probe MMV-1, and its sequence is as follows respectively:
MMV-F1：5’- CACCTTTATGTCACATTGTTG-3’；
MMV-R1：5’- GAATGCATCCTTGTGTCAAC -3’；
MMV-1：5’-FAM-CTACAGGATTCCGGTACGTTCCAT-TAMRA-3’。
2. one kind is carried out the method that real-time fluorescence PCR detects based on utilizing of MP gene probe as claimed in claim 1 and combination of primers to cucumber green mottle mosaic virus, it is characterized in that the method may further comprise the steps:
(1) gets testing sample and extract the total RNA of plant tissue;
(2) take total RNA as template, introduce described downstream primer MMV-R1 and carry out the synthetic of reverse transcription template cDNA;
(3) place the fluorescent PCR instrument to carry out the real-time fluorescence PCR amplified reaction described upstream primer MMV-F1, described downstream primer MMV-R1 and described fluorescent probe MMV-1;
(4) after reaction finished, the fluorescent PCR instrument read the CT value and judges detected result.
3. the cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene according to claim 2, it is characterized in that, when in described step (2), carrying out reverse transcription template cDNA synthetic, its reaction system is: Total RNA 2.5 μ L, 5 * PCR damping fluid, 2 μ L, dNTP 1 μ L, downstream primer MMV-R1 (10 μ mol/L) 2 μ L, ThermoScript II 0.5 μ L adds ddH
2O is to total system 10 μ L; Reaction conditions: 37 ℃ of 15min, 85 ℃ of 5sec, 16 ℃ of 30sec, reaction saves backup template after finishing in-4 ℃.
4. the cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene according to claim 2, it is characterized in that, real-time fluorescence PCR reaction system in described step (3) is: 2 * premix Taq (Real Time) mixed reaction solution, 10 μ L, upstream and downstream primer (MMV-F1, MMV-R1,10 μ mol/L) each 1.25 μ L, fluorescent probe MMV-1 1 μ L, template cDNA 2 μ L add ddH
2O supplies 20 μ L; Reaction conditions is: 95 ° of C, 30s; 95 ° of C 5s, 60 ° of C 30s, 45 circulations.
5. according to claim 2 to 4 each described cucumber green mottle mosaic virus real-time fluorescence PCR detection methods based on the MP gene, it is characterized in that, the working concentration scope of described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.1～0.8 μ mol/L, and the concentration range of described fluorescent probe MMV-1 is 0.05～0.5 μ mol/L.
6. the cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene according to claim 5 is characterized in that, the working concentration of described upstream primer MMV-F1 and described downstream primer MMV-R1 is 0.5 μ mol/L.
7. the cucumber green mottle mosaic virus real-time fluorescence PCR detection method based on the MP gene according to claim 6 is characterized in that, the concentration of described fluorescent probe MMV-1 is 0.25 μ mol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310026978.0A CN103060476B (en) | 2013-01-25 | 2013-01-25 | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310026978.0A CN103060476B (en) | 2013-01-25 | 2013-01-25 | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060476A true CN103060476A (en) | 2013-04-24 |
| CN103060476B CN103060476B (en) | 2015-03-11 |
Family
ID=48103367
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310026978.0A Expired - Fee Related CN103060476B (en) | 2013-01-25 | 2013-01-25 | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060476B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103487579A (en) * | 2013-09-07 | 2014-01-01 | 福建省农业科学院果树研究所 | Test strip for quickly detecting cucumber green mottle mosaic virus (CGMMV) |
| CN104357580A (en) * | 2014-10-09 | 2015-02-18 | 江苏省农业科学院 | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) method for detecting various viruses of cucurbit plant with two-step method as well as special primer group for method |
| CN105177187A (en) * | 2015-10-14 | 2015-12-23 | 浙江大学 | Preparing method and application of sample for detecting cucumber green mottle mosaic viruses carried by cucurbitaceae seeds |
| CN106770941A (en) * | 2016-12-09 | 2017-05-31 | 江苏大学 | A kind of method for determining greenhouse cucumber old leaf |
| CN113215324A (en) * | 2021-06-08 | 2021-08-06 | 大连民族大学 | Primer group, kit and method for on-site constant-temperature visualization and fluorescence detection of cucumber green mottle mosaic virus |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101186950A (en) * | 2007-06-07 | 2008-05-28 | 中国检验检疫科学研究院 | Primer and probe for detecting cucumber green mottle mosaic virus |
| CN101368217A (en) * | 2008-09-18 | 2009-02-18 | 中国农业科学院植物保护研究所 | Fast detecting method for cucumber green mottle mosaic virus |
-
2013
- 2013-01-25 CN CN201310026978.0A patent/CN103060476B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101186950A (en) * | 2007-06-07 | 2008-05-28 | 中国检验检疫科学研究院 | Primer and probe for detecting cucumber green mottle mosaic virus |
| CN101368217A (en) * | 2008-09-18 | 2009-02-18 | 中国农业科学院植物保护研究所 | Fast detecting method for cucumber green mottle mosaic virus |
Non-Patent Citations (2)
| Title |
|---|
| 张卫东等: "RT-PCR法特异性快速检测黄瓜绿斑驳花叶病毒", 《江西农业大学学报》 * |
| 李淑菊等: "利用RT-PCR对黄瓜病毒病毒原种类进行检测", 《华北农学报》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103487579A (en) * | 2013-09-07 | 2014-01-01 | 福建省农业科学院果树研究所 | Test strip for quickly detecting cucumber green mottle mosaic virus (CGMMV) |
| CN103487579B (en) * | 2013-09-07 | 2015-07-08 | 福建省农业科学院果树研究所 | Test strip for quickly detecting cucumber green mottle mosaic virus (CGMMV) |
| CN104357580A (en) * | 2014-10-09 | 2015-02-18 | 江苏省农业科学院 | Multiplex RT-PCR (reverse transcription-polymerase chain reaction) method for detecting various viruses of cucurbit plant with two-step method as well as special primer group for method |
| CN105177187A (en) * | 2015-10-14 | 2015-12-23 | 浙江大学 | Preparing method and application of sample for detecting cucumber green mottle mosaic viruses carried by cucurbitaceae seeds |
| CN105177187B (en) * | 2015-10-14 | 2018-08-14 | 浙江大学 | Detect sample preparation methods and purposes that Curcurbitaceae seed carries cucumber green mottle mosaic virus |
| CN106770941A (en) * | 2016-12-09 | 2017-05-31 | 江苏大学 | A kind of method for determining greenhouse cucumber old leaf |
| WO2018103138A1 (en) * | 2016-12-09 | 2018-06-14 | 江苏大学 | Method for determining aged leaf of greenhouse cucumber |
| CN106770941B (en) * | 2016-12-09 | 2019-05-31 | 江苏大学 | A kind of method of determining greenhouse cucumber old leaf |
| CN113215324A (en) * | 2021-06-08 | 2021-08-06 | 大连民族大学 | Primer group, kit and method for on-site constant-temperature visualization and fluorescence detection of cucumber green mottle mosaic virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060476B (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Reingold et al. | Seed disinfection treatments do not sufficiently eliminate the infectivity of Cucumber green mottle mosaic virus (CGMMV) on cucurbit seeds | |
| Fidan et al. | Robust molecular detection of the new Tomato brown rugose fruit virus in infected tomato and pepper plants from Turkey | |
| CN111424118B (en) | Multiplex composite PCR detection method for passionflower virus pathogen | |
| CN103060476B (en) | MP (movement protein)-gene-based real-time fluorescence polymerase chain reaction (PCR) detection method for cucumber green mottle mosaic virus (CGMMV), and probe and primer combination | |
| CN111363856A (en) | Method for simultaneously detecting four tomato viruses by multiple RT-PCR | |
| CN106868164B (en) | Primer for detecting phytophthora camphorata and nested PCR detection method | |
| Li et al. | An improved reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of two cherry flexiviruses in Prunus spp. | |
| Mallik et al. | Detection and differentiation of Potato virus Y strains from potato using immunocapture multiplex RT-PCR | |
| CN103194544B (en) | A kind of reagent of assistant identification nepovirus and application thereof | |
| CN101818211B (en) | Molecule detection method for cowpea severe mosaic virus | |
| Silva et al. | Detection of tomato mosaic virus in tomato seed and treatment by thermotherapy | |
| CN104946796A (en) | Kit and detection method for detecting tomato spotted wilf virus by RT-LAMP method | |
| Kang et al. | Molecular characterization and detection of a genetically distinct tomato chlorosis virus strain in Taiwan | |
| CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit | |
| CN103740865B (en) | Method for rapidly and sensitively detecting tobacco mosaic virus | |
| Jiang et al. | Development of a novel real-time quantitative PCR method for detection of Ilyonectria robusta, the predominant species causing ginseng rusty root rot | |
| CN108977581B (en) | Real-time RT-PCR detection kit for alfalfa mosaic virus and detection method thereof | |
| Budzanivska et al. | Epidemiology of sharka disease in Ukraine | |
| Güvenateş et al. | Molecular determination of the presence of some grapevine viruses and phylogenetic analyses of grapevine Virus A in Tokat province grapevine area | |
| Kwak et al. | Characterization of Melon necrotic spot virus Occurring on Watermelon in Korea | |
| Wang et al. | Molecular and cytopathologic evidences for a mixed infection of multiple viruses on Lanzhou lily (Lilium davidii var. unicolor) in Northwestern China/Molekularer und cytopathologischer Nachweis einer Mischinfektion der Lanzhou-Lilie (Lilium davidii var. unicolor) mit verschiedenen Viren in Nordwest-China | |
| CN105274241A (en) | Molecular detection primer and quick detection method for thielaviopsis basicola | |
| KR101139802B1 (en) | Primers for detecting orchid infecting virusinfect and screening method of virus using same | |
| CN105779653B (en) | For detecting the dual RT-PCR kit and detection method of radix pseudostellariae virus | |
| CN108588265A (en) | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of cloves phytophthora |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150311 Termination date: 20160125 |
|
| EXPY | Termination of patent right or utility model |