CN104946798A - Primer and method for detecting tobacco mosaic virus LAMP - Google Patents
Primer and method for detecting tobacco mosaic virus LAMP Download PDFInfo
- Publication number
- CN104946798A CN104946798A CN201510363886.0A CN201510363886A CN104946798A CN 104946798 A CN104946798 A CN 104946798A CN 201510363886 A CN201510363886 A CN 201510363886A CN 104946798 A CN104946798 A CN 104946798A
- Authority
- CN
- China
- Prior art keywords
- mosaic virus
- tobacco mosaic
- lamp
- primer
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer and method for detecting tobacco mosaic virus LAMP. The primer comprises a forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3', a backward outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3', a forward inner primer FIP:5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3' and a backward inner primer BIP:5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3'. The method comprises the following steps: extracting tobacco mosaic virus RNA; establishing a LAMP reaction system; adding a pre-reaction solution and a to-be-detected sample into a Loopamp reaction test tube; mixing; putting the mixture into a LAMP turbidity meter for reaction; and detecting the inspection result by a LAMP turbidity meter method or fluorescent visual inspection method. The invention aims at providing a primer and a method for detecting tobacco mosaic virus LAMP, wherein the method has the characteristics of high speed, high detection sensitivity, easiness in operation, direct result reading and the like.
Description
Technical field
The present invention relates to the primer that a kind of tobacco mosaic virus (TMV) LAMP detects, the invention still further relates to a kind of method adopting above-mentioned primer to detect tobacco mosaic virus (TMV), belong to biological technical field.
Background technology
Tobacco mosaic virus (TMV) tobacco mosaic virus abridges TMV, is RNA viruses, special infection plant, especially tobacco and other plants of Solanaceae, is the representative species that Tobamovirus belongs to.This virus is this base of Ivanov D.I.Iwanowski demonstrated this TMV first existence in 1892.First Stanley W.M.Stanley is separated to the crystallization of TMV virus shape in nineteen thirty-five from tobacco disease leaf is squeezed the juice, and it is to recognize this protein also containing nucleic acid, and cause of disease is exactly this virus certainly.This virus is extremely stable, because breeding in large quantities in sick leaf, so 2 grams of crystallizations of can purifying from 1 liter of sick leaf is squeezed the juice.TMV particle long 300 nanometers, diameter 18 nanometer, have a molecular weight to be 2 × 10
6daltonian single stranded RNA.Nucleic acid by 2130 molecular weight by 17530 daltonian protein subunits are wrapped up.The host range of TMV is very extensive, and existing known all have infectivity to 198 kind of plant in 22 section plants, as tobacco and various vegetables etc., is parasitic scope one of virus the most widely in current plant virus.
The fatal temperature of this virus be 90-93 DEG C through 10 minutes, dilution point of accumulation 10
6doubly, the longevity in vitro 72-96 hour.Aseptically virulence reaches the several years, survives more than 30 years in axersis tissue.And this virus has different strain, China mainly contains 4 strains such as common strain, tomato strain, macula lutea strain and pearl spot, because of virulence difference and the diversity causing symptom with the Combined Infection of other viruses.
TMV can survive the winter in various plants, and primary source of infection is band invalid body and other host plant, does not fully become thoroughly decomposed in addition, is with malicious fertilizer also can cause First aggression.It is propagated mainly through juice, and sick strong leaf slightly rubs and causes microtrauma mouth, and virus can invade, and does not invade, breed after intrusion in parenchyma cell from large wound and natural aperture, after enter vascular tissue and infect whole strain.Under 22-28 DEG C of conditions, infected plant starts aobvious disease after 7-14 days, and field is operated by sick seedling and strong seedling friction or farming infects again.The insect of the chewing mouthpartses such as the locust in addition in vega, oriental tobacco budworm also can be propagated.
Because this Virus parasite scope is wide, multiple kinds of crops can be infected and very easily propagate, be with the viral residual body latent infection time very long again, bring great difficulty to this virus of control, all can cause an immeasurable loss to farm crop every year, therefore most economical effective control strategy just detects seedling, find eliminating in time of TMV virus, source is held control virus and closes.
The detection method of current plant virus mainly contains biology, serology and molecular biology three kinds, and biological method is exactly whether detect viral existence with viral plant indicator, generally needs 7-10 days; Serological method detects virus according to the specific binding of antigen-antibody, generally only need 4-6 hours, but it needs specific antiserum(antisera), and detection sensitivity is not high, also has non-specific problem; Molecular biology method mainly refers to PCR method, and the method is fast and accuracy is also higher, but needs expensive detecting instrument and relevant device, and for this virus of picture TMV, because its dilution point of accumulation is 10
6doubly, 10 are diluted to by sick juice
6doubly just lose invasiveness, therefore need the very high detection method of sensitivity potential TMV could to be detected, above three kinds of method sensitivity are all difficult to reach, and will there is undetected possibility like this, so be badly in need of the new detection method of research.
Current existing detection method, its detecting step is loaded down with trivial details, adopts expensive equipment, can not realize fast, easily differentiating the shark's fin true and false.So the detection method of the existing discriminating shark's fin true and false needs to be further improved.
Summary of the invention
The object of the invention is, in order to overcome weak point of the prior art, to provide the primer that a kind of tobacco mosaic virus (TMV) LAMP detects;
Another object of the present invention is to provide and a kind ofly adopts above-mentioned primer to detect the method for tobacco mosaic virus (TMV), and the method has fast, detection sensitivity is high, simple to operate, result directly can the feature such as interpretation.
In order to achieve the above object, the present invention adopts following scheme:
The primer that tobacco mosaic virus (TMV) LAMP detects, is characterized in that comprising:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC。
A kind of tobacco mosaic virus (TMV) LAMP detection method, is characterized in that comprising the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT
-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA
-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
A kind of tobacco mosaic virus (TMV) LAMP detection method as above, is characterized in that described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2-1:10.
A kind of tobacco mosaic virus (TMV) LAMP detection method as above, is characterized in that each 1.6 μMs of described FIP and BIP, each 40pmol; Each 0.2 μM of F3 and B3, each 5pmol.
A kind of tobacco mosaic virus (TMV) LAMP detection method as above, is characterized in that the extraction concrete steps of the tobacco mosaic virus RNA described in steps A:
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
A kind of tobacco mosaic virus (TMV) LAMP detection method as above, is characterized in that described LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
A kind of tobacco mosaic virus (TMV) LAMP detection method as above, is characterized in that the method that described fluorescence is estimated:
Use UV irradiation equipment upwards to irradiate bottom test tube, wear ultraviolet protection glasses and carry out sight from test tube side and look into; Send green glow if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender.
In sum, beneficial effect of the present invention:
The present invention adopts ring mediated isothermal amplification loop-mediated isothermal amplification, being called for short LAMP is a kind of new nucleic acid detection method, its principle utilizes the primer of 4 particular design and have the archaeal dna polymerase of strand-displacement activity, special under constant temperature, efficiently, the new technology of DNA amplification rapidly.This technology can amplify 10 in l hour
9target sequence copies, and shows the staged collection of illustrative plates be made up of the zone of different size after amplified production electrophoresis on gel.Traditional round pcr, after PCR terminates, need PCR primer to be carried out to the methods such as agarose gel electrophoresis and detect, complex operation step, wastes time and energy, and there is the harm to human body and environment of ethidium bromide or isotropic substance.And the LAMP technology that this institute sets up detect tobacco mosaic virus (TMV) save time, economical and susceptibility is high.Whether detected result only need utilize the green fluorescence of LAMP turbidimeter or SYBG or whether be produced white precipitate occurred with regard to knowing reaction by range estimation, and does not need loaded down with trivial details detected through gel electrophoresis process.
The present invention adopts the RNA of paramagnetic particle method extraction TMV and devises the universal primer of the LAMP amplification detecting TMV according to the coat protein encoding gene of the main strain of TMV, and establish the system of TMV LAMP detection, can the highly sensitive existence detecting TMV virus in hour by body series, detection sensitivity reaches 10fg, 1,000 times to be exceeded than regular-PCR, and there is good specificity.The instrument and equipment that present method is not expensive in addition, only need an insulation can, simple to operate, detected result directly can carry out interpretation by the reaction of color, be applicable to very much the use of basic unit one line, have broad application prospects and extraordinary practical value in the reproductive material such as seedling, flowers Viral diagnosis.
Accompanying drawing explanation
Fig. 1 is LAMP specific test result of the present invention;
Fig. 2 is the result of LAMP sensitivity evaluation of the present invention.
Embodiment
Below in conjunction with embodiment, the present invention is described further:
In following examples of the present invention adopt material:
1.1 tobacco mosaic virus (TMV) TMV, cucumber mosaic virus CMV purchased from American AGDIA company.
1.2 main agents and consumptive material
(1) RNA amplification reaction kit Loopamp RNA Amplification kit;
(2)
fluorescence visual detection test kit;
(3)
Fluorescence Detection Reagent；
(4)
reaction tubes etc. are all purchased in Beijing Lanpu Biological Technology Co., Ltd.
(5) LAMP primer (forward outer primer F3, forward inner primer FIP, oppositely inner primer BIP, oppositely outer primer B3) is synthesized by precious biotechnology (Dalian) company limited;
1.3 key instrument equipment
(1)-80 DEG C of deep freezer;
(2) the freezing desk centrifuge of Labofuge400R high speed;
(3) micropipet, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L;
(4) ultrapure water system, Milli-Q Academic, Millipore company;
(5) Bechtop;
(6) eddy mixer;
(7) the real-time turbidimeter of LAMP, LA-320C, Japanese Rong Yan biotech firm.
Embodiment 1
The primer that tobacco mosaic virus (TMV) LAMP detects, comprising:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC。
Embodiment 2
A kind of tobacco mosaic virus (TMV) LAMP detection method, comprises the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Embodiment 3
A kind of tobacco mosaic virus (TMV) LAMP detection method, comprises the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
Described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 60 DEG C of isothermal reaction 90min, is incubated 5min at last 60 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Embodiment 4
A kind of tobacco mosaic virus (TMV) LAMP detection method, comprises the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
Described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:10.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 70 DEG C of isothermal reaction 90min, is incubated 5min at last 80 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Embodiment 5
A kind of tobacco mosaic virus (TMV) LAMP detection method, comprises the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
Described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:5.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 65 DEG C of isothermal reaction 90min, is incubated 5min at last 70 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Embodiment 6
A kind of tobacco mosaic virus (TMV) LAMP detection method, comprises the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
Described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:8.Each 1.6 μMs of described FIP and BIP, each 40pmol; Each 0.2 μM of F3 and B3, each 5pmol.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 60 DEG C of isothermal reaction 90min, is incubated 5min at last 60 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
LAMP turbidimeter method described in the present invention includes real-time Turbidity measurement and/or terminal degree detects.
1. real-time Turbidity measurement
Use the real-time turbidity measurement device of Loopamp, can detect in real time;
2. terminal turbidity measurement:
Use Loopamp terminal turbidity measurement device, the turbidity at the end of detection can be detected;
3. fluorescence range estimation detects
Use
fluorescence visual detection test kit, can be judged result by range estimation.After amplified reaction terminates, use UV irradiation equipment (wavelength 240 ~ 260nm, 350 ~ 370nm) upwards to carry out uviolizing bottom reaction tube, observe from reaction tube side after the safety appliances such as wearing spectacles.Send green fluorescence if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, be then judged to be feminine gender.
Can fluoresced green after SYBR Green I dyestuff is combined with double-stranded DNA, if dye colour orangely becomes green from what start, then illustrate that detected result is positive.
In order to verify specificity and the susceptibility of primer of the present invention, the present invention has done following test:
1, LAMP specific test
The template of reacting using TMV RNA as LAMP, CMV RNA is as negative control, by the LAMP primer of this experimental design, LAMP reaction is carried out according to the LAMP reaction conditions optimized, to verify the specificity of each primer, utilize LAMP turbidimeter and SYBR Green observation method of naked eye Synchronous reaction result.
As shown in Figure 1, CH1-7:TMV sample, CH8:CMV negative control, as seen from Figure 1, primer only detects TMV specificity result, and appearance time is all between 39-42 minute.
Two, LAMP sensitivity evaluation
By TMV RNA according to 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6doubly be diluted to concentration gradient, each extent of dilution is got 5 μ l respectively and is carried out LAMP experiment, replaces RNA template as blank, increase, to determine the sensitivity that LAMP reacts according to the LAMP reaction conditions optimized using ddH2O.
In the detected result of turbidimeter, can find out that the detection limit that LAMP reacts can reach shown in 10-5 extent of dilution and 10fg, Fig. 2.
Claims (7)
1. a primer for tobacco mosaic virus (TMV) LAMP detection, is characterized in that comprising:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC。
2. a tobacco mosaic virus (TMV) LAMP detection method, is characterized in that comprising the following steps:
The extraction of A, tobacco mosaic virus RNA
Nanometer magnetic bead is adopted to extract tobacco mosaic virus RNA;
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-TTACGGAATTACTACTCCATCT-3 ';
Reverse outer primer B3:5'-GGTCTAATACTGCGTTGTACC-3 ';
Forward inner primer FIP:
5'-TGTTTGGAACTGATTACCTAAGGCA-GTGTTCTTGTCATCAGCGT-3’；
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c：TGTTTGGAACTGATTACCTAAGGCA；
F2：GTGTTCTTGTCATCAGCGT；
Reverse inner primer BIP:
5'-CTGTCGTTCAACGACAATTCAGC-ACTTTAAAGTCACTATCAGGGA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c：ACTTTAAAGTCACTATCAGGGA；
B2：CTGTCGTTCAACGACAATTCAGC；
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses the RNA 5 μ L of cucumber mosaic virus, and blank reaction uses deionized water 5 μ L, and positive control uses tobacco mosaic virus RNA 5 μ L;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
3. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, is characterized in that described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2-1:10.
4. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 3, is characterized in that each 1.6 μMs of described FIP and BIP, each 40pmol; Each 0.2 μM of F3 and B3, each 5pmol.
5. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, is characterized in that the extraction concrete steps of the tobacco mosaic virus RNA described in steps A:
1) sample preparation: the susceptible tissue of tobacco mosaic virus (TMV) getting 0.1g adds 1mL extraction buffer and grinds, and obtains sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, repeatedly clean nanometer magnetic bead 3 times with ddH2O, under the effect of magnet, suck ddH2O;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH2O in PCR pipe, after liquid-transfering gun compressing mixing nanometer magnetic bead, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is the RNA of tobacco mosaic virus (TMV).
6. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, is characterized in that described LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
7. a kind of tobacco mosaic virus (TMV) LAMP detection method according to claim 2, is characterized in that the method that described fluorescence is estimated:
Use UV irradiation equipment upwards to irradiate bottom test tube, wear ultraviolet protection glasses and carry out sight from test tube side and look into; Send green glow if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363886.0A CN104946798B (en) | 2015-06-25 | 2015-06-25 | The primer and method of tobacco mosaic virus (TMV) LAMP detections |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510363886.0A CN104946798B (en) | 2015-06-25 | 2015-06-25 | The primer and method of tobacco mosaic virus (TMV) LAMP detections |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104946798A true CN104946798A (en) | 2015-09-30 |
| CN104946798B CN104946798B (en) | 2018-01-02 |
Family
ID=54161860
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510363886.0A Active CN104946798B (en) | 2015-06-25 | 2015-06-25 | The primer and method of tobacco mosaic virus (TMV) LAMP detections |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946798B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222303A (en) * | 2016-08-09 | 2016-12-14 | 陈定虎 | Bean pod mottle virus LAMP primer, test kit and detection method |
| CN106282406A (en) * | 2016-08-09 | 2017-01-04 | 陈定虎 | Cucumber green mottle mosaic LAMP primer, test kit and detection method |
| CN107177700A (en) * | 2017-07-19 | 2017-09-19 | 上海市农业科学院 | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus |
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286637A (en) * | 2011-07-21 | 2011-12-21 | 陕西省烟草研究所 | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology |
-
2015
- 2015-06-25 CN CN201510363886.0A patent/CN104946798B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286637A (en) * | 2011-07-21 | 2011-12-21 | 陕西省烟草研究所 | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology |
Non-Patent Citations (2)
| Title |
|---|
| SUGARCANEAMBER T. KEIZERWEERD等: "Development of a reverse transcription loop-mediated isothermalamplification (RT-LAMP) assay for the detection of Sugarcane mosaicvirus and Sorghum mosaic virus in sugarcane", 《JOURNAL OF VIROLOGICAL METHODS》 * |
| 陈定虎等: "运用纳米磁珠技术结合RT-PCR方法检测李痘病毒", 《运用纳米磁珠技术结合RT-PCR方法检测李痘病毒》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106222303A (en) * | 2016-08-09 | 2016-12-14 | 陈定虎 | Bean pod mottle virus LAMP primer, test kit and detection method |
| CN106282406A (en) * | 2016-08-09 | 2017-01-04 | 陈定虎 | Cucumber green mottle mosaic LAMP primer, test kit and detection method |
| CN107177700A (en) * | 2017-07-19 | 2017-09-19 | 上海市农业科学院 | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus |
| CN111118220A (en) * | 2020-02-24 | 2020-05-08 | 宁波检验检疫科学技术研究院 | Primer group for rapid detection of tobacco brittle fracture virus and rapid detection method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104946798B (en) | 2018-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101358246B (en) | LAMP kit for detecting hogcholera virus and preparation method thereof | |
| CN107299155A (en) | A kind of primer and probe of goose astrovirus real-time fluorescence quantitative PCR detection | |
| CN106811550B (en) | Grass carp reovirus type II vaccine strain and wild strain identification primer, kit containing grass carp reovirus type II vaccine strain and wild strain identification primer and diagnostic detection method | |
| CN107760795B (en) | LAMP primer for rapidly detecting anthracnose bacteria of tea trees and detection method | |
| CN104946798A (en) | Primer and method for detecting tobacco mosaic virus LAMP | |
| CN101921838A (en) | Method for detecting salmonella through PCR-DHPLC | |
| CN105671210A (en) | LAMP technology-based primer, kit and detection method for detecting Plum pox virus | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| Zeng et al. | A one‐step molecular biology method for simple and rapid detection of grass carp Ctenopharyngodon idella reovirus (GCRV) HZ08 strain | |
| CN105177178A (en) | Tobacco mosaic virus LAMP detection kit | |
| CN103215388B (en) | RT-PCR (reverse transcription-polymerase chain reaction) detection kit for viral haemorrhagic septicaemia virus and preparation method thereof | |
| Zhang et al. | Diagnostics and detection of African swine fever virus | |
| CN104372099A (en) | LAMP detection primer composition for phytophthotacactorum, as well as LAMP detection kit and LAMP detection method of LAMP detection primer composition | |
| CN103451316A (en) | Primer and kit as well as method for detecting cymbidium mosaic virus | |
| CN109337990A (en) | One seed shrimp liver sausage born of the same parents worm visualizes quick detection kit | |
| CN104195270B (en) | The visual quick detection kit of white spot syndrome virus (WSSV) and detection method | |
| CN103233005B (en) | Reverse transcription-polymerase chain reaction (RT-PCR) detection kit for infectious haematopoietic necrosis viruses (IHNV) and preparation method of kit | |
| CN102337356B (en) | Swine getah virus reverse transcription-polymerase chain reaction (RT-PCR) detection kit and application thereof | |
| CN101575651A (en) | LAMP detection kit of porcine parvovirus and detection method thereof | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN103215389B (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| CN108315484A (en) | The primer and detection method of tobacco mosaic virus (TMV) LAMP detections | |
| CN110791568A (en) | LAMP primer group for rapidly detecting chicken-derived components in beef and mutton, detection kit, detection method and application | |
| CN104195254A (en) | Method and primer composition for detecting fusarium equiseti based on loop-mediated isothermal amplification technology | |
| CN104388577A (en) | Loop-mediated isothermal amplification primer for detecting erwinia amylovory and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |