CN106244623B - It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene - Google Patents
It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene Download PDFInfo
- Publication number
- CN106244623B CN106244623B CN201610682213.6A CN201610682213A CN106244623B CN 106244623 B CN106244623 B CN 106244623B CN 201610682213 A CN201610682213 A CN 201610682213A CN 106244623 B CN106244623 B CN 106244623B
- Authority
- CN
- China
- Prior art keywords
- carrier
- pblck
- npt
- marker gene
- ubi
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of inducible pBLCK carriers and its construction method for rejecting selectable marker gene, are related to DNA recombinant technique.PBLCK carrier of the present invention is, by multiple digestion, connection, conversion operation, to introduce the component constructions such as ubiquitin promoter sequence, II resistant gene of loxP sequence, CRE-GR fusion and NPT on the basis of pBRACT806 carrier and form.Carrier constructed by the present invention, the expression efficiency of target gene and marker gene in monocotyledon can not only be greatly improved, it simultaneously can also be in the rejecting of space-time level control marker gene, ensure that genetically modified plants, the especially biological safety of transgenosis chief crop, has broad application prospects.
Description
Technical field
The present invention relates to DNA recombinant technique, it is specifically a kind of it is inducible reject selectable marker gene pBLCK carrier and its
Construction method.
Background technique
It is a kind of non-using the screening that selectable marker gene carries out positive transgenic plant after carrying out plant transgeneic procedure
Normal effective method.Researcher can select the cell of conversion from containing a large amount of unconverted cells, or from not turning largely
Change the plant that genetic transformation is obtained in plant.The albumen of selectable marker gene coding can assign trans genie individual to antibiotic or remove
The characters such as the resistance of careless agent, but since it can be incorporated into the genome of genetically modified plants, environmentally safe and food can be caused
The worry of safety etc..Therefore, after successful conversion target gene, the selectable marker gene in genetically modified plants is removed, is become urgently
It solves the problems, such as.
Domestic and international researcher develops a variety of available strategies to obtain the transgenic plant of marker-free gene, wherein leading
It will be including the use of selected marker in bio-safety marker gene, the conversion system of marker-free gene and removal transgenic plant
Three kinds of methods such as gene.But the shortcomings that there are time-consuming and inefficients due to first two method, therefore removing selectable marker gene technology becomes
Cultivate the important channel of cleaning transgenic plant.The method of use mainly includes co-transformation method, utilizes locus specificity recombinase
System, Transposon System or homologous recombination system etc..Currently, specific site recombination system is because showing higher controllability, In
There is preferable prospect in transgenic research.Wherein, Cre/loxP locus trait recombination system be recombination enzyme system in using compared with
It is the hot spot in research field for extensive and perfect method.
1991, Dale, E.C. etc. recombinated enzyme system using Cre/loxP specificity for the first time, by Cre group enzyme to lox sequence
Column are cut and are reconnected, and mediate lox sequence that specificity recombination occurs, by the selectable marker gene in transgene tobacco
HPT excision, excision efficiency reach 90.9%.But the same with other selectable marker-removal genetic methods, there are breedings for this method
The shortcomings that journey complexity and excessive cycle.Therefore, researcher develops the locus specificity recombination system of inducing expression on this basis
System utilizes the expression of the promoter control recombinase of environmental factor induction.By target gene, selectable marker gene and recombinase base
Because being transferred in recipient plant, then induction recombinates expression of enzymes in due course, rejects selectable marker gene and recombination enzyme gene
Itself.Used promoter includes heat-inducible and chemically inducible promoter.The some of this method are had also discovered in research to lack
Point is needed through hybridization or repeatedly for example, recombinase Expression element and selectable marker gene Expression element are located in different carriers
Transgenosis could reject selectable marker gene, and the promoter of target gene is unsuitable for the problems such as expressing in monocotyledon.Cause
This, researcher needs to construct more suitable carrier, using the promoter for being suitable for high efficient expression in monocotyledon.
Summary of the invention
The present invention is exactly to solve the existing method for rejecting selectable marker gene and need by hybridization or repeatedly to turn base
Because that could reject selectable marker gene, and the promoter of target gene is unsuitable for the problems such as expressing in monocotyledon, institute
A kind of inducible pBLCK carrier and its construction method for rejecting selectable marker gene of proposition.
The present invention is realized according to following technical scheme.
A kind of inducible pBLCK carrier for rejecting selectable marker gene, introduces ubiquitin on pBRACT806 carrier
Promoter sequence, II resistant gene of loxP sequence, CRE-GR fusion and NPT.
The pBLCK carrier contains Gateway component.
A kind of preparation method of the above-mentioned inducible pBLCK carrier for rejecting selectable marker gene, comprising the following steps:
The amplification of I, genetic fragment: respectively using pCRE-GR plasmid, 302 plasmid of pBRACT, pBin19 plasmid as template, lead to
Cross design primer and introduce corresponding restriction enzyme site, PCR obtain I-CRE-GR-NOS-Aat II of Not, II-ubi-Hind III of Aat,
III-NPT of Hind, II-NOS-loxP-Kpn, I genetic fragment；
II .pEASY-ubi-NPT, II vector construction: by the target fragment obtained in step I by multiple digestion, connection,
Conversion is connected respectively to Not I and Aat II, I digestion of Aat II and Hind III, Hind III and Kpn of pEASY-ubi-loxP carrier
Between site, constructing has loxP sequence, CRE-GR fusion, ubiquitin promoter sequence and NPT II resistant gene
Cloning vector pEASY-ubi-NPT II；
III .pBLCK vector construction: using restriction enzyme Hpa I, Kpn I respectively to pBract806 and pEASY-ubi-
NPT II carries out digestion, and the two is ligated and transformed into competent escherichia coli cell, and screening positive clone, as pBLCK carry
Body.
Present invention obtains following the utility model has the advantages that the effective solution of the present invention side of existing rejecting selectable marker gene
Method needs to reject selectable marker gene by hybridization or multiple transgenosis, and the promoter of target gene is unsuitable in list
The problems such as being expressed in cotyledon plant.Carrier constructed by the present invention contains Gateway component, can carry out the height of external source target gene
Imitate recombination and integration；With II gene of NPT, conducive to the screening of transgenic plant；With the inducible CRE-GR for rejecting foreign gene
Component, can be after target gene be successfully transferred to plant and applies glucocorticoids inducer, and GR receptor binding domain is made
For recombinase can be gone to nucleus after " molecular switch " allosteric, the sequence in genome among two loxP, i.e. resistance are rejected
Selectable marker gene (NPT II) and recombinase gene expression element sequence obtain cleaning transgenic plant.Constructed by the present invention
Another key property for having of carrier be that target gene, CRE-GR fusion and NPT II gene all exist
Under the control of ubiquitin strong promoter, thus in crops transgenic breeding, especially monocotyledon transgenic line
It has broad application prospects in initiative.
Detailed description of the invention
Fig. 1 is I-CRE-GR-NOS-Aat II of Not of the present invention, II-ubi-Hind III of Aat, III-NPT of Hind, II-NOS-
The agarose gel electrophoresis figure of I target fragment PCR amplification of loxP-Kpn；
Fig. 2 is the agarose gel electrophoresis figure of II carrier bacterium colony PCR of pEASY-ubi-NPT detection of the present invention；
Fig. 3 is II Vector map of pEASY-ubi-NPT of the present invention；
Fig. 4 is pBLCK Vector map of the present invention.
Specific embodiment
The present invention is described further with reference to the accompanying drawings and embodiments.
1 materials and methods
1.1 test material
Plasmid pBract806 and pBract 302 is purchased from Britain John Innes Centre, and plasmid pBin19 is by this experiment
(construction method is referring to Bevan M (1984) Binary Agrobacterium vectors for plant for room preservation
Transformation.Nucleic Acids Research 12 (22): 8711-8721), plasmid pCRE-GR comes from U.S.'s health
Nai Er university Silin doctor Zhong give that (construction method is referring to Brocard J, Feil R, Chambon P, Metzger D
(1998)A chimeric Cre recombinase inducible by synthetic,but not by natural
ligands of the glucocorticoid receptor.Nucleic Acids Research 26(17):4086-
4090), pEASY-ubi-loxP is that (Yang Wenli, Ding Bo, Wang Junbin, Li Ming, Lv Fang are completed in the beautiful building of this lab assistant Yang Wen
Virtue, new opplication [J] the TanJin Agricultural College of Xie Xiaodong .TA carrier pEASY-T1Simple in gene cloning, 2011,18 (2):
13-16.).Escherichia coli (E.coli) DH5 α is purchased from TIANGEN Biotech (Beijing) Co., Ltd., Escherichia coli (E.coli)
DB3.1 is purchased from Britain John Innes Centre.Method (Li Zhenyu, Xu of the competent cell preparation method referring to Li Zhenyu etc.
Kairine, Pan Xiuying wait rubidium chloride method to prepare competent cell [J] Xuzhou Medical College journal, 2004,24 (4): 315-316.).
1.2 main agents and biological software
Restriction enzyme Hpa I, Not I, Aat II, Hind III and Kpn I are purchased from Fermentas Technology Co., Ltd.,
Ago-Gel DNA QIAquick Gel Extraction Kit (TaKaRa Agrose Gel DNA Purification Kit) is purchased from precious bioengineering
(Dalian) Co., Ltd, plasmid extraction kit are purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, and Phusion is super to be protected
True archaeal dna polymerase and T4 ligase are purchased from NEB company, and 2 × Es Taq Master Mix (containing dyestuff) is century purchased from Beijing health
Bioisystech Co., Ltd.Software used in bioinformatic analysis is the Vector NT in Invitrogen company (U.S.)
ADVANCED 11.The sequencing of this test and primer synthesis are completed by Huada gene company.
1.3 test method
1.3.1PCR amplification
Pcr amplification reaction volume is 50 μ L, the Buffer containing 1 × Phusion HF, 200 μm of ol/L in reaction system
DNTPs, 0.5 μm of ol/L primer, 1U Phusion archaeal dna polymerase, 100ngDNA template.
Response procedures are as follows: 98 DEG C of 40s, 38 circulation programs be 98 DEG C of 20s, 63 DEG C of 30s, 72 DEG C of 2min, last 72 DEG C
Extend 10min.Product recycles PCR product through 1.0% agarose gel electrophoresis, with gel reclaims kit.
Amplimer are as follows: CRE-GR F:AAGGAAAAAAGCGGCCGCATGTCCAATTTACT GACC, CRE-GR R:T
ATTATTATAGACGTCCTAGTAACATAGTGACACCG；II F:TATTATT of ubi+Aat
II R:AAGAAGGAAGAAGCTTGTCCGCCTCGGTGGCACG of ATAGACGTCCAGTGCAGCGTGACCCGG, ubi+Aat；NPT
II II-NOS R:TATTATTATAGGTACCATA of-NOS F:AAGA AGGAAGAAGCTTATGGCAATTACCTTATCC, NPT
ACTTCGTATAATGTATGCTATACGAAGTTAT。
1.3.2 digestion connects, conversion
PEASY-ubi-loxP endonuclease reaction volume is 20 μ L, reaction system are as follows: 10 × Fast Digest Buffer, 2 μ
Mixture is kept the temperature at 37 DEG C 1h after product recycling and passed through by III/Kpn of L, Not I/Aat, II/Hind I 1 μ L, 2 μ L of DNA profiling
T4 ligase connects.
Connection reaction volume is 10 μ L, reaction system are as follows: 2 × T4ligase buffer, 5 μ L, T4DNA Ligase, 1 μ
0.4 μ L of L, carrier pBract806DNA, 3 μ L of Insert Fragment.
1.3.3 the positive colony PCR identification of recombinant plasmid
The MasterMix containing 1 × Es Taq in bacterium colony PCR identification system, 0.4 μm of ol/L primer, 1 μ gDNA template of <.
Response procedures are as follows: 94 DEG C of 2min, 35 circulation programs be 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, last 72 DEG C
Extend 2min.Product is detected through 1.2% agarose gel electrophoresis.
2 results and analysis
2.1 target fragment PCR amplifications
According to raw work plasmid extraction kit, plasmid pCRE-GR, pBRACT 302, pBin19 are extracted respectively, is then expanded
Three segments below.
1, I-CRE-GR-NOS-Aat II of Not: using pCRE-GR plasmid as template, CRE-GRF, CRE-GR R are primer, benefit
With I-CRE-GR-NOS-Aat II of PCR method amplified fragments Not, when design primer, Not I and II digestion of Aat are added at segment both ends
Site, electrophoretic band are (3,4 swimming lane, clip size 2364bp in Fig. 1) identical as purpose band size.
2, II-ubi-Hind III of Aat: using 302 plasmid of pBRACT as template, II+ubi F of Aat, Aat II+ubi R are to draw
Object when design primer, adds Aat II and Hind III at segment both ends end using II-ubi-Hind III of PCR method amplified fragments Aat
Restriction enzyme site, electrophoretic band are identical as purpose band size (5,6 swimming lane, clip size 2078bp in Fig. 1).
3, III-NPT of Hind, II-NOS-loxP-Kpn I: using pBin19 plasmid as template, II-NOS F of NPT, NPT II-NOS
R is primer, using III-NPT of PCR method amplified fragments Hind, II-NOS-loxP-Kpn I, when design primer, is added at segment both ends
I restriction enzyme site of Hind III and Kpn, electrophoretic band is identical as purpose band size, and (1,2 swimming lane, clip size are in Fig. 1
1701bp)。
II vector construction of 2.2pEASY-ubi-NPT
Devise multiple single restriction enzyme sites suitable for this experiment on carrier pEASY-ubi-loxP: Hpa I, Not I,
Aat II, Hind III and Kpn I, then using the method for multiple digestion, connection, conversion, by above-mentioned purpose segment Not after the recovery
I-CRE-GR-NOS-Aat II, II-ubi-Hind III of Aat, III-NPT of Hind, II-NOS-loxP-Kpn I are connected respectively to digestion
Between site Not I and Aat II, Aat II and Hind III, Hind III and Kpn I, finally obtaining one has loxP sequence, CRE-
The cloning vector pEASY-ubi-NPT II of II resistant gene of GR fusion, ubiquitin promoter sequence and NPT.
According to kalamycin resistance Screening of Media and bacterium colony PCR identification (Fig. 2), identification correctly positive bacterium colony is chosen,
Huada gene company is sent to be sequenced and save.Sequencing result is shown, surveys II carrier of pEASY-ubi-NPT of clone with desired design
Graphic sequence is completely the same (Fig. 3).
2.3pBLCK vector construction
Digestion is carried out to pBract806 and pEASY-ubi-NPT II respectively using restriction enzyme Hpa I, Kpn I, it will
Product utilization T4 ligase after the recovery is attached, and is then converted by heat shock method to competent escherichia coli cell DB3.1
In, resistance screening is carried out on the LB plate containing 50 μ g/mL kanamycins, the single colonie after picking screening carries out PCR identification,
To identification, correctly positive single colonie expands culture, takes 800 μ L that 50% glycerol liquid nitrogen flash freezer is added to save in -80 DEG C, remaining
Bacterium solution send Huada gene company to be sequenced.Sequencing result is shown, surveys the pBLCK carrier graphic sequence complete one of clone with desired design
It causes (Fig. 4).
3 conclusions and discussion
The genetically modified plants for cultivating marker-free gene, need after target gene successful conversion, reject selected marker
Gene, to reduce to the Environmental security of genetically modified plants and the worry of food safety.The site-specific recombination systems such as Cre/lox
It is the system of cultivation non selecting sign transgene plant more commonly used at present.But the initial practice be by secondary conversion or
Sexual hybridization introduces recombinase, and then by selfing separation, further removal recombination enzyme gene and conversion recombination enzyme gene are brought into
Another selectable marker gene.This makes Breeding Process complicated, excessive cycle, and is unsuitable for asexually propagated crop.Hereafter it lures
The use of conductivity type promoter and tissue-specific promoter, so that the rejecting program simplification of selectable marker gene, but still cannot
Accomplish only once to convert (target gene, selectable marker gene and recombination enzyme gene while converting), primary induction i.e. realization purpose
Genetic transformation, selectable marker gene and recombinase gene knockout.Meanwhile current existing relevant carriers, target gene and resistance
Expression regulation of the promoter of screening-gene in monocotyledon is inefficient, needs replacing into and is suitable for monocotyledonous height
Imitate constitutive promoter.
Carrier pBLCK constructed by the present invention is based on Cre/lox recombination system and by the GR system of chemical induction, by GR
LBD structural domain and Cre recombinase are built into fusion protein, while being opened respectively using monocotyledon strong promoter ubiquitin
The expression in the cell by adjusting recombinase is combined in the expression of dynamic recombination enzyme gene and target gene with " molecular switch ", with
The selectable marker gene Expression element between the site lox is being rejected under specific space-time condition.Study and apply institute's structure of the present invention
The carrier built, can not only greatly improve the expression efficiency of target gene and marker gene in monocotyledon, while can be with
In the rejecting of space-time level control marker gene, genetically modified plants, the especially biology of transgenosis chief crop are ensured that
Safety has broad application prospects.
Claims (3)
1. a kind of inducible pBLCK carrier for rejecting selectable marker gene, it is characterised in that: introduced on pBRACT806 carrier
Ubiquitin promoter sequence, II resistant gene of loxP sequence, CRE-GR fusion and NPT, the structure of pBLCK carrier is such as
Shown in Fig. 4.
2. a kind of inducible pBLCK carrier for rejecting selectable marker gene according to claim 1, it is characterised in that: the pBLCK
Carrier contains Gateway component.
3. can induce the construction method for rejecting the pBLCK carrier of selectable marker gene described in a kind of claim 1, feature exists
In: the following steps are included:
The amplification of I, genetic fragment: respectively using pCRE-GR plasmid, 302 plasmid of pBRACT, pBin19 plasmid as template, by setting
It counts primer and introduces corresponding restriction enzyme site, PCR obtains I-CRE-GR-NOS-Aat II of Not, II-ubi-Hind III of Aat, Hind
III-NPT, II-NOS-loxP-Kpn, I genetic fragment；
II .pEASY-ubi-NPT, II vector construction: the target fragment obtained in step I is passed through into multiple digestion, connection, conversion
It is connected respectively to Not I and Aat II, I restriction enzyme site of Aat II and Hind III, Hind III and Kpn of pEASY-ubi-loxP carrier
Between, construct the clone with loxP sequence, II resistant gene of CRE-GR fusion, ubiquitin promoter sequence and NPT
The structure of II carrier of carrier pEASY-ubi-NPT II, pEASY-ubi-NPT is as shown in Figure 3；
III .pBLCK vector construction: using restriction enzyme Hpa I, Kpn I respectively to pBract806 and pEASY-ubi-NPT
II carries out digestion, and the two is ligated and transformed into competent escherichia coli cell, screening positive clone, as pBLCK carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610682213.6A CN106244623B (en) | 2016-08-16 | 2016-08-16 | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610682213.6A CN106244623B (en) | 2016-08-16 | 2016-08-16 | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244623A CN106244623A (en) | 2016-12-21 |
| CN106244623B true CN106244623B (en) | 2019-12-03 |
Family
ID=57591711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610682213.6A Active CN106244623B (en) | 2016-08-16 | 2016-08-16 | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244623B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101544989A (en) * | 2009-03-11 | 2009-09-30 | 湖南大学 | Novel Ti plasmid pElrLCG for saving plant embryos from lethal mutation and its preparation method |
-
2016
- 2016-08-16 CN CN201610682213.6A patent/CN106244623B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244623A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| CN107012164A (en) | CRISPR/Cpf1 Plant Genome directed modifications functional unit, the carrier comprising the functional unit and its application | |
| CN107893080A (en) | A kind of sgRNA for targetting rat Inhba genes and its application | |
| CN110358767B (en) | Zymomonas mobilis genome editing method based on CRISPR-Cas12a system and application thereof | |
| CN108118059B (en) | Improved promoter, vector composed of improved promoter and application of improved promoter | |
| CN110331158B (en) | Simultaneous editing method of polygene loci based on zymomonas mobilis endogenous CRISPR-Cas system and application thereof | |
| CN110607320B (en) | Plant genome directional base editing framework vector and application thereof | |
| CN110331146A (en) | It is a kind of regulation sgRNA transcription promoter, expression vector and its genome editing system and application | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| CN103898140B (en) | Simple efficient gene editing method | |
| CN108034671B (en) | Plasmid vector and method for establishing plant population by using same | |
| CN106244623B (en) | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene | |
| US10280428B2 (en) | Molecular biology tools for algal engineering | |
| CN104630228B (en) | The promoter of cotton thermal excited transcryption factor gene GhHsf39 and its application | |
| CN114540356B (en) | Rhodosporidium toruloides promoter and application thereof | |
| CA3112164C (en) | Virus-based replicon for plant genome editing without inserting replicon into plant genome and use thereof | |
| CN108384790A (en) | The method of the identification regulation and control active controlling element of FATP1 gene promoter transcriptions | |
| CN114507683A (en) | SURE strain with Kan resistance gene knocked out and construction method and application thereof | |
| CN109689693A (en) | Improve the method and system of gene editing efficiency | |
| CN110144364B (en) | Cre-LoxP recombination system for infectious clone of pepper mild mottle virus and application thereof | |
| CN109628445A (en) | Using CRISPR/Cas9 technology to the gene site-directed edit methods of grape ZEP | |
| CN108330137A (en) | A kind of pGADT7-In carriers and its structure and application method suitable for In-Fusion clones | |
| CN112501171B (en) | sgRNA targeting sequences of two specific targeting pig Pax7 genes and application | |
| Yuan et al. | Split selectable marker mediated gene stacking in plants | |
| WO2022166572A1 (en) | Method and system for continuous cloning of long dna fragment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |