CN114507683A

CN114507683A - SURE strain with Kan resistance gene knocked out and construction method and application thereof

Info

Publication number: CN114507683A
Application number: CN202111375759.4A
Authority: CN
Inventors: 陈书元; 李中万; 周智; 叶国杰; 吴振华; 王立军
Original assignee: Hangzhou Jiayin Biotechnology Co ltd
Current assignee: Hangzhou Jiayin Biotechnology Co ltd
Priority date: 2021-11-19
Filing date: 2021-11-19
Publication date: 2022-05-17

Abstract

The invention relates to the technical field of biology, and discloses a SURE strain with Kan resistance gene knocked out, a construction method and application thereof. According to the invention, Kanamycin resistance in the SURE genome is effectively knocked out by using a novel single base editing technology, and the SURE strain without Kanamycin resistance is constructed for subsequent competent preparation and AAV related plasmid construction, so that the ITR loss frequency is reduced, and the problem that the conventional AAV vector and SURE strain cannot be used due to the same Kan resistance tag is solved.

Description

SURE strain with Kan resistance gene knocked out and construction method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a SURE strain with Kan resistance gene knocked out and a construction method and application thereof.

Background

Adeno-associated virus (AAV) vectors are attracting much attention as an emerging star vector for gene therapy, and two Inverted Terminal Repeats (ITRs) at both ends of the genome are structures necessary for AAV packaging replication, but ITRs are easily lost to affect packaging and infectivity of viral particles. Studies have shown that deletion of different segments of the ITR sequence can affect rAAV production. In particular, in the industrial production process, partial or complete deletion of ITR sequences produced during large-scale fermentation results in a severe reduction in AAV production. In the process of constructing AAV vector plasmids, it is increasingly important to improve ITR stability.

The SURE strain is K-12 escherichia coli, and the whole pathway of a recombinase system in the strain is damaged, so that the cloning efficiency of exogenous methylated DNA is improved and the stability of the exogenous DNA is enhanced in a cloning experiment by using competent cells prepared from the SURE strain; solves the cloning problem caused by more cross-shaped, Z-shaped and other secondary or tertiary structures of eukaryotic DNA, and can be used for blue-white spot screening. The strain can inhibit useless DNA rearrangement, so that the strain is specially used for cloning DNA fragments which are unstable in conventional strains, such as repeated DNA fragments, Z-DNA, ultra-long plasmids and other unstable fragments, is constructed aiming at AAV related plasmids, and has a very good effect of preventing ITR loss.

The SURE strain carries Kanamycin resistance, and meanwhile, the AAV plasmid used clinically also needs to use the Kanamycin resistance, so that the plasmid used clinically cannot be constructed and propagated by utilizing the SURE competence, but an effective construction method is not available at present to construct the SURE strain capable of effectively knocking out the Kan resistance gene, and further the industrialization application of the AAV vector plasmid is limited.

Disclosure of Invention

In view of this, the invention aims to provide a SURE strain with a Kan resistance gene knocked out and a construction method thereof, wherein the construction method can effectively knock out the Kan resistance gene of the SURE strain for subsequent competence preparation and AAV-related plasmid construction, and reduce ITR loss frequency;

another purpose of the invention is to provide the application of the strain and the construction method thereof in AAV plasmid construction or vaccine preparation.

In order to achieve the above purpose, the invention provides the following technical scheme:

a SURE strain for knocking out Kan resistance genes comprises a single base editing system for knocking out the Kanamycin resistance genes in a SURE genome.

Single base gene editing technology, also known as DNA chain breakage independent gene editing technology; the dCas9-PmCDA1-UGI and Cas9n-PmCDA1-UGI single base editing systems are two single base editing systems developed based on lamprey cytosine deaminase PmCDA1, PmCDA1 can catalyze C deamination to U, U can be recognized as T in the process of DNA replication, and uracil glycosylase inhibitor UGI can prevent the U from being glycosylated by uracil glycosylase to cause base excision repair. The sgRNA is utilized to target a fusion protein formed by Cas 9-cytosine deaminase-uracil glycosylase inhibitor to a target site complementarily paired with the gRNA (a sequence in the sgRNA which is complementarily paired with a target DNA), and the amino group of cytosine (C) at the target site is removed, so that C is changed into uracil (U), and the U is replaced by thymine (T) along with the replication of the DNA, and finally, the precise and efficient mutation of single base C → T is realized.

In a specific embodiment of the invention, the single base editor system is a dCas9-PmCDA 1-UGI-based single gene editor system that can be used by loading each gene element onto a commercially available vector; dCas9, PmCDA1, UGI sequences from addge plasmid pScI _ dCas9-CDA-UL, plasmid number: 108551.

in a specific embodiment of the present invention, the gRNA sequence of the single base editor system is a nucleotide sequence shown in SEQ ID No.1 and/or SEQ ID No. 2: CGAGCGAGCACGUACUCGGA and/or GAACAAGAUGGAUUGCACGC.

The Kanamycin resistance gene targets aimed by the gRNA are 259-278bp targets (GAACAAGATGGATTGCACGC) and 675-694bp targets (CGAGCGAGCACGTACTCGGA) of the sequences of the gRNA, and the Kanamycin resistance gene is shown as SEQ ID NO. 3. The gRNA can also be transcribed by a vector, and more efficiently can be constructed on the same vector with dCas9-PmCDA1-UGI, the sequences of the transcribed gRNA on the vector are shown as SEQ ID NO.4(CGAGCGAGCACGTACTCGGA) and SEQ ID NO.5 (GAACAAGATGGATTGCACGC), meanwhile, the gRNA also needs a scaffold sequence (a scaffold sequence) necessary for binding Cas9, and a sequence which is conventional in the art can be selected and is shown as SEQ ID NO.6 in the invention. Through the guidance of gRNA, mutation of single base C → T is realized at the target site, so that stop codons are mutated at the target site, Kanamycin cannot be normally expressed, and the resistance of Kanamycin is lost.

In the invention, the scaffold sequence is as follows:

SEQ ID NO.6：

GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGC。

meanwhile, the invention also provides a construction method of the SURE strain with the Kan resistance gene knocked out, which comprises the following steps:

step 1, constructing a gene element capable of regulating plasmid loss and a vector containing a single base editing system aiming at a Kanamycin resistance gene in a SURE genome;

step 2, inserting the gene element in the step 1 into the vector to obtain a recombinant vector;

step 3, transforming the recombinant vector into a SURE strain for knockout to obtain a SURE strain with Kanamycin resistance knockout;

and 4, starting an adjustable means to control the gene element, so that a recombinant vector in the Sure strain subjected to Kanamycin resistance knockout is lost, and obtaining a pure Sure strain subjected to Kanamycin resistance knockout.

In order to obtain a pure Sure strain after knocking out the Kanamycin resistance gene, the construction method regulates and controls plasmid loss by constructing a temperature-sensitive replicon, and the transformed recombinant vector can be lost by controlling the temperature in the later stage. In the specific embodiment of the invention, the temperature-sensitive replicon is pSC101 ori & repA101, a pCas-DC133 plasmid (map shown in figure 1) is taken as a template to amplify a target replicon, and the temperature-sensitive replicon replaces the replicon of the vector in which the single base editing system is positioned.

A vector comprising a single base editing system for the resistance gene to Kanamycin in the SURE genome was constructed by adding a sequence for transcribing gRNA (shown in SEQ ID NO.4 and SEQ ID NO. 5) and an expression sequence for dCas9-PmCDA1-UGI to a commercially available vector pUC19 plasmid, such as the Sureko-pUC19 ori plasmid constructed by the reagent company used in the present invention (see FIG. 2).

The temperature-sensitive replicon can be inserted into the position of the replicon of the vector where the single-base editing system is located by means of double enzyme digestion, overlap PCR and the like to obtain a recombinant vector, the Kanamycin resistance gene can be knocked out after the recombinant vector is transferred into the SURE strain, and then the recombinant vector is lost through temperature regulation to obtain a pure strain.

The invention tries Red/ET recombination technology and gene editing knockout technology, and the result shows that Kanamycin resistance gene in SURE genome can not be knocked out effectively, and only the modification of SURE strain can be realized under the base editing technology of the invention.

Meanwhile, the ITR loss frequency of the obtained Sure strain subjected to Kanamycin resistance knockout is verified, and the result shows that the ITR loss proportion of each strain introduced into the AAV vector gradually increases along with the prolonging of the culture time; however, the ITR loss ratio of the strain is far lower than that of the EPI300 strain serving as a control, and even if the strain is cultured for 23.5 hours, the ITR loss ratio of the strain is still lower than 10 percent; the loss ratio of the strain of the invention can be kept at a very low level within 19.5h of culture, which can completely meet the requirement of industrialization. Based on the excellent technical effect, the invention provides the application of the SURE strain or the construction method in the preparation of AAV vectors or vaccines.

According to the technical scheme, the Kanamycin resistance in the SURE genome is effectively knocked out by using a novel single-base editing technology, the SURE strain without Kanamycin resistance is constructed for subsequent competent preparation and AAV related plasmid construction, the ITR loss frequency is reduced, and the problem that the conventional AAV vector and SURE strain cannot be used due to the fact that the AAV vector and SURE strain have the same Kan resistance label is solved.

Drawings

FIG. 1 shows a map of the pCas-DC133 plasmid;

FIG. 2 shows a Sureko-pUC19 ori plasmid map;

FIG. 3 is a schematic diagram showing the construction of a recombinant vector of the present invention;

FIG. 4 shows the results of electrophoretic detection of the TSori fusion fragment; lane1 Marker strip; lane2 Tsori fusion fragment (2488 bp);

FIG. 5 shows the results of double digestion of the Sureko-pUC19 ori plasmid; lane1 Marker strip; lane2, enzyme digestion of Sureko-pUC19 ori plasmid SmaI + PvuI (6765bp/1267 bp);

FIG. 6 shows the results of colony PCR for identification of the Sureko-Tsori plasmid; LaneM is Marker; lane 1-6-colony PCR of Sureko-pUCeori # 1 to # 6;

FIG. 7 shows the results of overnight culture of Kanamycin knockdown colonies (PCR tubes);

FIG. 8 shows results of overnight culture of Kanamycin knockout colonies (plates); the left side is an Ampicillin resistant plate, and the right side is a Kanamycin resistant plate;

FIG. 9 shows the results of the Kanamycin knockout PCR identification; LaneM is Marker; lane1-3, Kanamycin-KO 1# to 3# bacterial liquid PCR result; lane4-6, Kanamycin-KO 6# to 8# bacterial liquid PCR result;

FIG. 10 shows the results of the sequencing by identification of the Kanamycin-KO strain;

FIG. 11 shows electrophoresis results before and after enzyme digestion of 10 clones AhdI of SURE strain transformed into pEXG 102-030K; AhdI represents the result of enzyme digestion, and the left side of the result is the corresponding result of enzyme digestion;

FIG. 12 shows electrophoresis results before and after digestion of 10 clones AhdI of SURE strain transformed into pEXG 102-031K; AhdI represents the result of enzyme digestion, and the left side of the result represents the corresponding result of enzyme digestion;

FIG. 13 shows electrophoresis results before and after AhdI enzyme digestion of the SURE strain transformed with pEXG102-030K and pEXG102-031K and the control EPI300 strain after culture for 13.5h (Lane1-12) and 19.5h (Lane 13-24); AhdI represents the result of enzyme digestion, and the left side of the result is the corresponding result of enzyme digestion;

FIG. 14 shows electrophoresis results before and after AhdI enzyme digestion of the SURE strain transformed with pEXG102-030K and pEXG102-031K and the control EPI300 strain after 23.5h (Lane25-36) and 38.5h (Lane37-48) culture; AhdI represents the result of enzyme digestion, and the left side of the result is the corresponding result of enzyme digestion;

FIG. 15 shows ITR loss ratio results for different medium times and different inoculum solutions; each group of columns has the results of 030K-SureKo-2#, 030K-SureKo-3#, 031K-SureKo-26#, 031K-SureKo-27#, 030K-EPI300 and 031K-EPI300 from left to right;

FIG. 16 shows two technical routes for knocking out kanamycin resistance in Sure genome using Red/ET recombination technique in comparative example 1;

FIG. 17 shows the process of engineering plasmid pCas-DC133 expressing Red/ET recombinase into ampicillin resistance in comparative example 1;

FIG. 18 shows the results of the detection of Red/ET recombination efficiency under different arabinose-inducing concentrations;

FIG. 19 shows the results of overnight culture of the SURE strain transformed with pCas-A on IPTG + X-gal plates (plates); the left side is the result of plating by 1000 times of bacterial liquid dilution, and the right side is the result of 100 times of bacterial liquid dilution;

FIG. 20 shows the results of overnight incubation of the SURE strain transformed with pCas-A on 100. mu.g/ml Amp, 20. mu.g/ml Gent, 50. mu.g/ml Kan, 12.5. mu.g/ml Tetracyclin plates;

FIG. 21 shows the results of colony PCR identification of SURE strain transformed with pCas-A; marker in lane1 on the left; lanes 2-24, colony PCR results, pCas-K1, primers K1-F2 and K1-R2, pCas-K2, primers K2-F2 and K2-R2, and pCas-K3, primers K3-F2 and K3-R2;

FIG. 22 shows the PCR identification of pCas-K2-Sure colonies;

FIG. 23 shows the results of plate validation of pCas-K2-Sure Kan strain; a is pCas-K1 strain, B is pCas-K2 strain, and C is pCas-K3 strain.

Detailed Description

The embodiment of the invention discloses a SURE strain for knocking out Kan resistance genes and a construction method and application thereof, and a person skilled in the art can appropriately improve process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to those skilled in the art are deemed to be included within the invention. While the system, application and method of the present invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the system, application and method as described herein may be made and used without departing from the spirit and scope of the invention.

In a specific embodiment, the invention takes pCas-DC133 plasmid as a template to design upstream and downstream amplification primers, and a target fragment F1 is amplified: part of Kan resistance 3 'end gene + pSC101 ori temperature-sensitive replicon + RepA101 temperature-sensitive gene (3' end has a first enzyme cutting site);

and (3) designing upstream and downstream amplification primers by using a Sureko-pUC19 ori plasmid as a template, and amplifying a target fragment F2: part of Kan resistance 3 ' end gene (5 ' end has second enzyme cutting site, and the length is longer than Kan resistance 3 ' end gene in F1).

The first enzyme cutting site and the second enzyme cutting site are selected according to enzyme cutting sites of upstream and downstream of a replicon (in the specific implementation process, a Sureko-pUCori plasmid) of a vector to be inserted, such as a SmaI enzyme cutting site and a PvuI enzyme cutting site;

the F1 and F2 fragments were ligated into the TSori fragment by overlap PCR: part of Kan resistance 3 ' end gene (5 ' end with PvuI restriction site) + pSC101 ori temperature sensitive replicon + repA101 temperature sensitive gene (3 ' end with SmaI restriction site);

the first enzyme cutting site and the second enzyme cutting site are respectively arranged at the upstream and the downstream of a replicon to be inserted into a vector, and cover the original replicon and part of Kan resistance 3' end genes, the temperature-sensitive replicon can be inserted into a set position through double enzyme cutting to replace the replicon without the temperature-sensitive replicon before, and the recombinant vector Sureko-Tsori pre-introduced into the SURE strain is obtained.

The reagents used in the present invention can be obtained from commercial sources unless otherwise specified.

The SURE strain for knocking out the Kan resistance gene, the construction method and the application thereof provided by the invention are further described below.

Example 1: construction of recombinant vector Sureko-Tsori

1. Primer information

TABLE 1

2. PCR amplification of F1

The amplification system and PCR amplification procedure are shown in tables 2 and 3;

TABLE 2

TABLE 3

3. PCR amplification of F2

The amplification system and PCR amplification procedure are shown in tables 4 and 5;

TABLE 4

TABLE 5

4. Overlapping PCR amplification of TSori

The amplification system and PCR amplification procedure are shown in tables 6 and 7;

TABLE 6

TABLE 7

Carrying out electrophoresis detection after PCR amplification is finished, wherein the detection result is shown in figure 4, carrying out gel recovery on a 2488bp fragment, carrying out PvuI + SmaI enzyme digestion, carrying out gel recovery by using a Promega gel recovery kit to obtain a Tsori fragment, and naming the fragment as an F fragment;

5. double digestion of the Sureko-pUC19 ori plasmid

Table 8 enzyme system:

carrying out enzyme digestion reaction at 37 ℃ for 3h, recovering the electrophoresis gel to obtain a carrier V1, wherein the electrophoresis result of gel recovery is shown in figure 5;

6. construction of Sureko-Tsori recombinant plasmid

The enzyme digestion vector V1 is connected with the enzyme digestion recovery fragment F, and the connecting system is shown in the following table 9;

TABLE 9

Connecting for 2h at room temperature, according to the transformation process of an EPI300 competent cell use instruction, taking 3ul of the connecting product to transform the EPI300 competent cell, coating an Ampicillinicillin resistant plate, and culturing at 30 ℃ overnight;

picking overnight cultured monoclonal bacterial plaque to 30ul of sterile water, mixing uniformly, taking 8ul of the uniformly mixed monoclonal bacterial plaque diluent as a template to perform PCR identification (the target fragment to be amplified is sections RepA101 to dCas 9), wherein the amplification system and the PCR program are shown in the following tables 10 and 11;

watch 10

TABLE 11

And (3) after the PCR is finished, taking 8ul of products for electrophoresis detection, wherein the detection result is shown in figure 6, taking the positive colonies 2#, 3# and 6# for bacterial liquid culture, culturing overnight at 30 ℃, extracting plasmids, and carrying out sequencing verification.

Example 2: construction of SureKo Strain (Kan resistance Gene knockout SURE Strain)

1. Kanamycin knockout Sure strain screening

Selecting a Sureko-Tsori recombinant plasmid with correct sequencing verification, taking 2ul of the recombinant plasmid, carrying out heat shock transformation by using a transformation system recommended by Sure competence instructions, incubating for 4h at 30 ℃, taking 50ul of the incubated thallus, carrying out Ampicillin plate coating, and carrying out overnight culture at 30 ℃.

The monoclonals cultured overnight at 30 ℃ are picked up and mixed evenly in a sterile PCR tube containing 50ul of non-resistant SOB culture medium, 8ul of the mixed bacterial liquid is inoculated into the sterile PCR tube containing 50ul of Kan-resistant and Ampicillin-resistant SOB culture medium respectively, and the experimental results are shown in figure 7.

5ul of the bacterial liquid which grows in the Ampicillin resistance PCR tube but does not grow in the corresponding Kanamycin resistance PCR tube is selected, inoculated to an Ampicillin resistance plate and a Kanamycin resistance plate respectively and cultured overnight.

Taking Ampicillin plates to grow and simultaneously corresponding to bacterial plaques on which Kanamycin does not grow, and culturing overnight at 30 ℃ to obtain strains screened out of Kanamycin resistance, wherein the growth results of the bacterial plates are shown in figure 8.

2. Identification of Kanamycin knockout Sure strain

(1) Primer information

TABLE 12

(2) PCR identification

ChkSureKO-PF1+ ChkSureKO-PR1 designed aiming at the Kan sequence on the genome of the Sure strain takes Kanamycin knockout liquid as a template to carry out PCR amplification, and takes a PCR product for sequencing verification.

The amplification system and PCR procedure are shown in tables 13 and 14.

Watch 13

TABLE 14

And (3) carrying out electrophoresis detection on a product obtained by PCR amplification, wherein the positive band of the electrophoresis detection is sent to Kanamycin knockout verification by Kanamycin sequencing, and the electrophoresis detection result is shown in figure 9.

1#, 2#, 3#, 6#, 7#, and 8# strains are taken for PCR amplification Kanamycin positive products for sequencing, a predicted mutation site sequence on a gRNA target point is analyzed, whether a Kanamycin expression frame mutates a stop codon or not is detected, so that a Kanamycin resistance gene cannot be correctly expressed, Kanamycin resistance is lost, a Kanamycin resistance knockout Sure strain is obtained, and the sequencing result analysis of the PCR products is shown in figure 10.

(3) Obtaining pure Sureko strain

The Kanamycin-resistant SureKo strain is knocked out, and the SureKO-Tori recombinant plasmid is lost through the culture at 37 ℃ by utilizing the function of a temperature-sensitive replicon, so that a pure strain is obtained.

Example 3: functional comparison of Sureko strains

The preparation of SureKo strain competence transformation two Kanamycin resistant AAV plasmids pEXG102-030K and pEXG102-031K, and screening statistics on ITR loss conditions.

pEXG102-030K and pEXG102-031K are transformed, monoclonal bacterial plaque cultured overnight is selected to be put into 30ul of sterile water and mixed evenly, 8ul of the mixed monoclonal bacterial plaque diluent is taken as a template to carry out PCR identification, and the amplification system is shown in the following table 15.

Watch 15

The upstream and downstream primers are as follows:

chkck_030k_F:AAACAATTAGTAAGGCCAAAG；

chkck_030k_R:AGTGTAGTGGTTATGGAGGGC；

chkck_031k_F:TCCGGATCTGAGATGAAGAAA；

chkck_031k_R:AGTAGGGTCTAGCGTCGGTGC；

the PCR positive clone of the colony, 10 clones are selected from 030K and 031K respectively for enzyme digestion, ITR integrity is identified, and competent cells are preliminarily identified. The cleavage system is shown in Table 16 below.

TABLE 16

The enzyme cutting result is shown in a figure 11 and a figure 12, and a strain with complete ITR is selected according to the AhdI enzyme cutting result for further culture and further identification; wherein 030K selects 2# and 3 #; 031K selects 26#, 27 #.

030K-SureKo-2#/3#, 031K-SureKo-26#/27#, 030K-EPI300 and 031K-EPI300 (Escherichia coli EPI300 transforms AAV plasmids pEXG102-030K and pEXG102-031K) are inoculated into a shake flask, the shake flask is cultured at 37 ℃ for 13.5h, 19.5h, 23.5h and 38.5h for sampling, OD600 data is determined, 5ml of thalli is taken to extract plasmids, and the AhdI enzyme digestion plasmids are simultaneously used for ITR identification, the enzyme digestion system is the same as that in the previous step, and the results are shown in FIGS. 13-15 and Table 17.

TABLE 17

The results in FIG. 15 and Table 17 show that the ITR loss ratio gradually increased as the culture time was prolonged; the ITR loss ratio of the SureKo strain is far lower than that of the EPI300 strain, and even if the SureKo strain is cultured for 23.5h, the ITR loss ratio is still lower than 10%; the loss rate of the SureKo strain of the invention can be kept at a very low level within 19.5h of culture.

Comparative example 1: experiments on other Gene editing techniques to knock-out Kanamycin resistance

(I) knocking out kanamycin resistance in Sure genome based on Red/ET recombination technology

Reagents and consumables:

watch 18

1. Principle of experiment

The experimental principle for knocking out kanamycin resistance in Sure genome by using Red/ET recombination technology is shown in FIG. 16.

2. Amplification of the Carna sequence in Sure

(1) A pair of primers was designed based on the canary sequence in the literature:

watch 19

(2) PCR acquisition of the Carna sequence in Sure

PCR amplification was performed using KanF1+ KanR1 with Sure solution as a template, and the PCR product was sequenced.

3. Transformation of plasmid pCas-DC133 expressing Red/ET recombinase into ampicillin resistance

3.1 Experimental design:

the experimental design is shown in FIG. 17.

3.2 design of a pair of primers

Watch 20

Note: underlined points represent homology arms

3.3 PCR obtaining Carna sequence with homology arms

PCR amplification was performed using pUC as a template using RETAMPR + RETAMPF, and ampicillin-resistant PCR products having homologous arms were obtained and recombined. 50. mu.l of PCR product was recovered using a gel recovery kit.

3.4 mu.l of pCas-DC133 (stored in this laboratory) was electroporated into DH 5. alpha. cells, 500. mu. lLB medium was added thereto, cultured at 32 ℃ for 0.5 hour, 10. mu.l of the resulting suspension was spread on Carna-resistant LB plate, and cultured overnight at 32 ℃.

3.5A single clone was picked and added to 5ml of LB medium containing 50ug/ml kanamycin, and cultured overnight at 32 ℃.

3.6 mu.l of the PCR-recovered product of 3.3 was transferred to 4 dry groups of competent cells prepared from L-arabinose at different concentrations by electroporation, and cultured in ice bath for 2min at 30 ℃ for 2h, 5000rpm, 2min by centrifugation in a SOB liquid medium containing 20mM, 40mM,100mM,200mM of 500. mu. L L-arabinose, respectively, and the supernatant was discarded, and the cells were plated on LB solid medium containing 20mM, 40mM,100mM,200mM of L-arabinose, respectively, and cultured overnight at 30 ℃.

3.74 groups of overnight culture liquid respectively pick up 10 single clones and add to 20ml LB medium containing 100ug/ml Amp, 32 ℃ culture overnight.

3.8 extracting plasmid according to the plasmid miniextraction kit (Tiangen DP103), and respectively taking 10 mul of plasmid to perform enzyme digestion at 37 ℃ for 30 min.

3.9 Add 5 loadingbuffer 5. mu.l to the digestion system and electrophore for 30min, the results are shown in FIG. 18.

3.10

colonies

33,35,36,37,38,39,40 were expected, 20mM L-arabinose induction success rate was highest, Red/ET System work

4. Knocking out Carna resistance in Sure genome based on Red/ET recombination technology

4.1 transfer of pCas-A expressing Red/ET homologous recombinase into Sure

Mu.l of plasmid No. 33 extracted from 3.9 was transferred to Sure by electrophoresis for 2min, 0.5ml of LB was added thereto, and cultured at 32 ℃ for 1h, and 100. mu.l of the bacterial solution was spread on an LB plate containing 100ug/ml of ampicillin and 50ug/ml of kanamycin and cultured overnight at 32 ℃.

4.2 selecting a single clone, adding it to 5ml LB medium containing 100ug/ml ampicillin and 50ug/ml kanamycin, culturing overnight at 32 deg.C

4.3 making competent cells:

4.3.1 transfer of 0.1ml of overnight culture to 100ml LB (50 ug/ml kanamycin resistance) shake flask, add 20mM L-arabinose, 30 degrees C under vigorous shaking culture for 2-6 hours.

4.4 PCR obtaining of LacZ and Gentamicin Gene PCR products with homology arms

TABLE 21

And performing PCR amplification by using SureLacZ-F + SureLacZ-R and using Puc19 as a template to obtain a LacZPCR product with a homology arm for recombination. 50. mu.l of PCR product was recovered using a gel recovery kit.

And performing PCR amplification by using SureGent-F + SureGent-R and pFB-v275 (stored in the laboratory) as a template to obtain a GentPCR product with a homologous arm for recombination. 50. mu.l of PCR product was recovered using a gel recovery kit.

4.5 mu.l of each of LacZ and Gent PCR products were electroporated into 4.3 competent cells, incubated for 2min in ice bath, and then separately added 500. mu.l of SOB broth containing 20mM L-arabinose and cultured at 30 ℃ for 2h

4.6 the LacZ gene-transferred bacterial solution was diluted 100-fold and 1000-fold, 10. mu.l each was applied to LB plates containing 1mM IPTG +40ug/ml X-gal +20mM L-arabinose, and cultured overnight at 30 ℃. 10. mu.l of the competent cells transferred to the Gent gene were plated on a Kan LB plate containing 20ug/ml Gent +20mM L-arabinose, and cultured overnight at 30 ℃.

4.7 No blue colonies were seen on IPTG + X-gal plates presumably in the absence of screening pressure and the results of the plate photographs are shown in FIG. 19.

4.8 separately, 46 LB plates of 20ug/ml Gent were loaded with bacteria in 20. mu.l of sterile water, and 3. mu.l were spotted onto 100. mu.g/ml Amp, 20. mu.g/ml Gent, 50. mu.g/ml Kan, 12.5. mu.g/ml. Tetracycline, incubated overnight at 30 ℃. The positive control 47 carries kanamycin and tetracycline resistance, and 48 carries ampicillin and gentamicin resistance, and the results of the plate culture are shown in FIG. 20.

4.9Kan and Tet plate colony No. 41-46 strain did not grow, Gent plate No. 41-46 strain did not grow, Gent resistance gene did not replace kana gene as expected, the plate culture results are shown in figure 20.

(II) knocking out kanamycin resistance in Sure genome based on CRISPR-Cas9 technology

1. Three targeting kana sequences were constructed based on pCasA, replacing the ori-targeting guide in pCas-a with Kan-targeting pCasA-K1, pCasA-K2, pCasA-K3.

1.1 construction of pCasA-K1, pCasA-K2, pCasA-K3 by substitution of ori sequence by overlap PCR

Primer design

TABLE 22

PCR to obtain two fragments of K1-1 and K1-2, two fragments of K2-1 and K2-2, and two fragments of K3-1 and K3-2

1.2 construction of fragments pCasA-K1, pCasA-K2, K1, K2, K3 of pCasA-K3 by overlap PCR replacing ori sequences.

Recovering PCR products of K1, K2 and K3

1.2.1 enzyme digestion pCasA and K1, K2, K3 through Apa I and Bgl II, recovery large fragment after electrophoresis of pCasA enzyme digestion product, direct recovery of K1-K3 enzyme digestion product.

1.2.2 the enzyme digestion vector V1 is connected with the enzyme digestion recovery fragment F1,

1.2.3 the same ligation conditions were used for ligation of pCasA-K2, pCasA-K3 and 2h at room temperature.

1.2.4 according to the Sure competent cell transformation protocol, 10. mu.l of the ligation product was used to transform Sure competent cells, plated with Amp resistant plates, and incubated overnight at 30 ℃.

1.2.6 Single clone PCR verification of 4 selected strains each

pCas-K1 used primers K1-F2 and K1-R2, pCas-K2 used primers K2-F2 and K2-R2,

pCas-K3 used primers K3-F2 and K3-R2.

10. mu.l of each PCR product was collected and electrophoresed as shown in FIG. 21.

1.2.7 No bands were found in the last two strains except pCasA-K3, and all the bands were found, and the 1, 5, 10 monoclonal antibodies were sent for sequencing, and the sequencing results were successful. The sequencing results are shown in the file.

Knock-out of Kan sequence

2.1 the correctly sequenced bacterial solution was diluted 1000-fold and spread on LB of 1mM IPTG +50ug/ml Amp, and cultured overnight in a 32 ℃ incubator.

2.2 No single clone was grown from the corresponding plates of pCas-K1 and pCas-K3, 96 single clones were picked from the corresponding plate of pCas-K2 and added to 20. mu.l of sterile water, 2. mu.l of each single clone was subjected to PCR, and 2. mu.l of Sure cells were used as a template to perform 6X 50. mu.l PCR reactions.

2.2.1 primer design

TABLE 23

2.2.2 purification of PCR products, 100ng colonies of PCR products from each colony were added to 100ng Sure PCR products from each colony, and reactions were performed according to the instructions of T7E1 enzyme, and 20. mu.l of each product was electrophoretically detected after the reactions, as shown in FIG. 22.

2.2.3 pCasA-K2 was transformed into Sure and applied to IPTG + Amp plates, and after colony PCR, the two bands after T7E1 digestion did not appear after T7E1 digestion and electrophoresis.

2.1 spotting 3ul of each bacterial liquid in 2.2 on a Kan plate of 50ug/ml, culturing at 37 ℃ overnight, and then growing bacterial spots on all clones, which indicates that Kan is not knocked out, but presumably the shearing efficiency of pCasa-K2 is not good, so that the bacteria can grow, while that of pCas-K1 and K3 is high, and Sure cannot grow because of the complete knock-out deficiency repair mechanism of homologous recombinase, and the knocking-out fails.

The foregoing is only for the purpose of understanding the method of the present invention and the core concept thereof, and it will be understood by those skilled in the art that various changes and modifications may be made without departing from the principle of the invention, and the invention also falls within the scope of the appended claims.

Sequence listing

<110> Hangzhou Jiayin Biotechnology Ltd

<120> SURE strain for knocking out Kan resistance gene and construction method and application thereof

<130> MP21018058

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgagcgagca cguacucgga 20

<210> 2

<211> 20

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaacaagaug gauugcacgc 20

<210> 3

<211> 1047

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

agctactggg ctatctggac aagggaaaac gcaagcgcaa agagaaagca ggtagcttgc 60

agtgggctta catggcgata gctagactgg gcggttttat ggacagcaag cgaaccggaa 120

ttgccagctg gggcgccctc tggtaaggtt gggaagccct gcaaagtaaa ctggatggct 180

ttcttgccgc caaggatctg atggcgcagg ggatcaagat ctgatcaaga gacaggatga 240

ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg 300

gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg 360

ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc 420

ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct 480

tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa 540

gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg 600

gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa 660

gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat 720

gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg 780

cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc 840

atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac 900

cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg 960

gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc 1020

tatcgccttc ttgacgagtt cttctga 1047

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgagcgagca cgtactcgga 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaacaagatg gattgcacgc 20

<210> 6

<211> 76

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 60

ggcaccgagt cggtgc 76

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

taacactgcg gccaacttac ttctgacaac gatcgg 36

<210> 8

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cacaaccaat taaccaattc tgagcgctta ccaatgctta atcagtgagg cac 53

<210> 9

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttaagcattg gtaagcgctc agaattggtt aattggttgt ggaaac 46

<210> 10

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgagccggaa gcataaagtg taaacccggg aacgtaaatg catgccgctt cg 52

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atccgacgct atttgtgccg atagc 25

<210> 12

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gtcttttgaa aacaaatact ctatgaggat ttatgagtgg 40

Claims

1. A SURE strain with a Kan resistance gene knocked out is characterized in that the Kanamycin resistance gene in a SURE genome is knocked out by a single base editing system.

2. The SURE strain according to claim 1, wherein the gRNA sequence of the single base editor system is a nucleotide sequence as shown in SEQ ID No.1 and/or SEQ ID No. 2.

3. The SURE strain according to claim 1 or 2, wherein the single base editing system is a single gene editing system based on dCas9-PmCDA 1-UGI.

4. The method of constructing the SURE strain of claim 1, comprising:

5. The method according to claim 4, wherein the genetic element lost by the controllable plasmid in step 1 is a temperature-sensitive replicon, and the controllable means in step 4 is temperature control.

6. The method according to claim 5, wherein the temperature-sensitive replicon is pSC101 ori & repA 101.

7. The method according to claim 4, wherein the gRNA sequence of the single base editing system is a nucleotide sequence shown in SEQ ID No.1 and/or SEQ ID No. 2.

8. Use of the SURE strain of any one of claims 1-3 or the construction method of any one of claims 4-7 for the construction of AAV vectors or vaccine preparations.