CN103898140B - Simple efficient gene editing method - Google Patents
Simple efficient gene editing method Download PDFInfo
- Publication number
- CN103898140B CN103898140B CN201410148355.5A CN201410148355A CN103898140B CN 103898140 B CN103898140 B CN 103898140B CN 201410148355 A CN201410148355 A CN 201410148355A CN 103898140 B CN103898140 B CN 103898140B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- gene
- sequence
- upstream
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a simple efficient gene editing method. By utilizing the principles of genome high-frequency spontaneous splitting and chi site promotion of homologous recombination in the duplication process, the method synthesizes or constructs a homologous recombinant nucleic acid segment with concurrent repetitive sequences and two-way screening labeled genes; and the introduced exogenous labeled genes are eliminated from the segment by intramolecular homologous recombination after introducing the genome. Compared with the traditional gene editing method in need of transformation twice, the method disclosed by the invention only needs transformation once, and can effectively enhance the negative selection efficiency (50% at the maximum). The method can implement gene deletion, substitution, insertion and other gene editing operations.
Description
Technical field
The invention belongs to genetic engineering field, more particularly to a kind of gene editing method.
Background technology
In recent years, with the development of the second filial generation and third generation high throughput sequencing technologies, functional genomicses and synthesising biological
That what is learned develops gene editing instrument quick, seamless, efficient in the urgent need to one kind rapidly, realizes changing the orientation editor of genome
Make.The seamless editing technique of pattern microorganism such as yeast, escherichia coli etc. be taken seriously in recent years (Bird et al.,
High-efficiency counterselection recombineering for site-directed mutagenesis
in bacterial artificial chromosomes.Nature methods,2012.9(1):P.103-109), opened
The seamless edit tool sent out is rich and varied.For example restriction enzyme site is introduced in the upstream of saccharomycetic bi-directional selection markers gene URA3
Improve efficiency (Noskov, et al., the Tandem repeat coupled with endonuclease of seamless editor
cleavage(TREC):a seamless modification tool for genome engineering in
yeast.Nucleic acids research,2010.38(8):P.2570-2576), various two-way sieves are developed in escherichia coli
Select marker gene galK, thyA, tolC, tetA-sacB (Warming et al., Simple and highly efficient
BAC recombineering using galK selection.Nucleic acids research,2005.33(4):
p.e36；Wong et al.,Efficient and seamless DNA recombineering using a
thymidylate synthase A selection system in Escherichia coli.Nucleic acids
research,2005.33(6):p.e59；Gregg et al.,Rational optimization oftolC as a
powerful dual selectable marker for genome engineering.Nucleic acids
research,2014.DOI:10.1093/nar/gkt1374；Liet al.,Positive and negative
selection using the tetA-sacB cassette:recombineering and P1transduction in
Escherichia coli.Nucleic acids research,2013.41(22):p.e204).But, up to the present base
Because of the efficient deletion of the difficult point of editing technique, i.e. bidirectional screening system marker gene, effectively solving not yet.
Safety and seamless editor for transgenic etc. are required, it usually needs deleted after the gene editing needed for completing
Marker gene.The deletion of traditional bi-directional selection markers gene is first by by containing the single-stranded of insertion point upstream and downstream homology region
Or double stranded nucleic acid fragment conversion enters cell, then by the resistant maker gene in homologous recombination replacement gene group, finally leads to
Cross the negative sieve substrate of addition in the medium and complete the enrichment to reconstitution cell, to pick out removal riddled basins, obtain nothing
The cell of trace editor.Therefore, traditional gene editing technology needs to convert twice, is converted for will be with genes of interest for the first time
Cell is proceeded to the nucleic acid fragment of marker gene carries out homologous recombination, and after homologous recombination, genes of interest and marker gene enter target base
Because of group；Converted for deleting marker gene for the second time, will be proceeded to carefully containing the nucleic acid fragment of insertion point upstream and downstream homology region
Born of the same parents, by the resistant maker gene in homologous recombination replacement gene group.Additionally, the efficiency for deleting marker gene in this way is past
It is past very low.
It is used for screening in gene editing technology the bidirectional screening system of recon comprising just screening and bearing screening, is just screening one
As give recon to the resistance of antibiotic by antibiotic-resistance marker's gene or given in phase by auxotroph gene
The characteristic of deficiency culture basal growth should be selected to realize, negative screening typically gives recons to Cucumber using some genes
Sensitivity realizing, such as positive/negative screening is carried out using sacB-neo fusion genes, and neo (kanamycin) resistance is used for
Just screen, and the sucrose toxicity produced due to the expression of sacB genes is used for negative screening (Warming et al., Simple
and highly efficient BAC recombineering using galK selection.Nucleic acids
research,2005.33(4):p.e36).Bidirectional screening also can be realized by a bi-directional selection markers gene, for example
TolC genes can be not only used for just screening and can be used for negative screening (Gregg et al., Rational optimization
oftolC as a powerful dual selectable marker for genome engineering.Nucleic
acids research,2014.DOI:10.1093/nar/gkt1374).The success rate of negative sieve is often extremely low frequently even to be lost
Lose.This needs the production of noxious substance and accumulates mainly due to the lethal processes of negative screening, and in cumulative process, cell is easy
There is spontaneous mutation and produce the resistance to noxious substance so that cell can be survived in the case where negative sieve gene is possessed.Not only
Thus, the conversion process before negative sieve is also usually introduced to bearing the insensitive foreign cell of sieve material and causes the mistake of negative sieved journey
Lose.
Therefore, this area needs a kind of method that can fast and efficiently carry out gene editing.
The content of the invention
For the above-mentioned and other defect of traditional gene editing method, the present invention provides a kind of gene editing method, including
Following steps：
A. target cell is provided, the target cell includes the target nucleic acid with site to be finished；
B. with the upstream and downstream homologous sequence comprising the site to be finished, genes of interest, parallel repetitive sequence and two-way sieve
The nucleic acid fragment of marker gene is selected to convert the target cell, so that there is homologous recombination in the nucleic acid fragment and target nucleic acid, so as to
Gene editing required for the site to be finished produces；
C. just screened to filter out the restructuring that genes of interest and bi-directional selection markers gene are incorporated on target nucleic acid
Daughter cell；
D. allow parallel repetitive sequence on the nucleic acid fragment and site to be finished upstream or downstream it is corresponding parallel
There is homologous recombination in repetitive sequence, to delete marker gene；
E. negative screening is carried out to be enriched with the restructuring daughter cell for deleting bi-directional selection markers gene.
In a kind of preferred implementation, the parallel repetitive sequence on above-mentioned steps b center acid fragment is to be repaired on target nucleic acid
Decorations site upstream or the original series in downstream.Parallel repetition in another preferred embodiment, on step b center acid fragment
On sequence and target nucleic acid close to decorating site upstream or downstream sequence homology, to realize seamless editor.
In another embodiment, in step d, in the culture medium without positive-negative selection material, incubation step c is filtered out
Restructuring daughter cell allowing the corresponding of the upstream or downstream of parallel repetitive sequence on the nucleic acid fragment and site to be finished
There is homologous recombination in parallel repetitive sequence, so as to delete marker gene.
In another embodiment, the bi-directional selection markers gene in step b includes one or more Chi sites to carry
The efficiency of high bi-directional selection markers gene elmination.In preferred implementation, bi-directional selection markers gene function can not affected
On the premise of, Chi sites are incorporated into into any one or more sites of bi-directional selection markers gene.The Chi sites can be with
It is positive or reverse, can is continuous or discontinuous between multiple Chi sites.Can in different types of genome
Using different Chi sites, and the Chi site sequences of varying strength can be used in same type of genome.
In a kind of embodiment, the inventive method is used for the volume of prokaryotic cell or gene of eucaryote cell group optional position gene
Volume, i.e., target nucleic acid is the genome of prokaryotic cell or eukaryotic cell.In another embodiment, the inventive method is in matter
Gene editing, i.e. target nucleic acid are carried out on grain or artificial chromosome (BAC) for plasmid or artificial chromosome.
Description of the drawings
Accompanying drawing 1：Three kinds of major ways of gene editing.
Accompanying drawing 2：The principle schematic of parallel repetitive sequence auxiliary gene editor.
Accompanying drawing 3：Bi-directional selection markers gene schematic diagram containing Chi sites.
Accompanying drawing 4：Parallel repetitive sequence and the principle schematic of Chi sites auxiliary gene editor.
Accompanying drawing 5：The schematic diagram of gene editing is carried out with the inventive method in escherichia coli.
Accompanying drawing 6：Plasmid pMD18-T collection of illustrative plates (is purchased from TaKaRa companies).
Accompanying drawing 7：Plasmid pEASY-cat-sacB collection of illustrative plates.
Accompanying drawing 8：Plasmid pKD46 collection of illustrative plates.
Accompanying drawing 9：The sequence of FADE I, respectively illustrate FADE upstreams homology region, cat-sacB, FADE upstream homology region,
With FADE downstreams homology region.
Accompanying drawing 10：The sequence of FAA-URA3, respectively illustrates faa1 upstream from start codon homology region, faa1 initiation codons
Sub- upstream homology region, faa1 termination codoies downstream homology region.
Accompanying drawing 11：The sequence of pMD-ldhAI-cat-sacB-FAR, respectively illustrates insertion point upstream sequence, cat-
SacB, insertion point upstream homology region, FAR, insertion point downstream homology region.
Accompanying drawing 12：The sequence of pMD-tesC-cat-sacB-FAR, respectively illustrate tesC upstreams homology region, cat-sacB,
TesC upstreams homology region, FAR, tesC downstream homology region.
Specific embodiment
The present invention restarts the principle of replication fork using homologous recombination after genome high frequency spontaneous disruption, by marker gene
The method of two ends series parallel repetitive sequence, realizes a step and converts the process that the restructuring of two steps completes gene editing.Relative to biography
The gene editing method (needing to convert twice) of system, due to the present invention provide method only need to once convert can just realize it is pre-
The transformation of phase and the deletion of bi-directional selection markers gene, therefore considerably simplify the operating procedure of gene editing.Separately
Outward, the method that the present invention is provided improves the deletion efficiency of bi-directional selection markers gene.It is without wishing to be bound by any theory, two-way sieve
Selecting the raising of marker gene deletion efficiency, to be likely due to traditionally delete the method for bi-directional selection markers gene be by molecule
Between homologous recombination, this restructuring affected by transformation efficiency (being usually no more than 1/1000) to a great extent, and this
Bright method is completed by intramolecular restructuring, and each cell is containing the fragment that homologous recombination occurs.Additionally, the inventive method
Improve the efficiency of negative screening by way of Chi sites being introduced in bi-directional selection markers gene, can reach 50%.By
The seamless editor of gene can be carried out in the method for the present invention, therefore can continuously realize the behaviour such as the deletion of gene, replacement, insertion
Make.
In the context of the present invention, term " target cell " refers to cell to be transformed, contains target nucleic acid, use root in target cell
The cell is converted according to present invention design and the nucleic acid fragment for building, makes nucleic acid fragment that homologous recombination occur with target nucleic acid, so as to reality
Existing required gene editing.
Term " target nucleic acid " refers to the nucleic acid for needing to carry out gene editing, and target nucleic acid can be prokaryotic cell or eukaryotic cell
Genome, or plasmid or artificial chromosome (BAC) etc..
In the context of the invention, term " nucleic acid " is including DNA, cDNA and RNA.
Term " gene editing " to be referred to and change gene order, including gene elmination, insertion and replacement in site to be finished.This
Gene editing in invention context includes entering edlin to gene or any base, i.e., deleted, inserted with gene or any base
Enter or replace gene original on target nucleic acid or base.
Term " seamless editor " or " seamless gene editing " are referred to
Base.
Term " site to be finished " or " decorating site " refer to the particular location for needing to carry out gene editing on target nucleic acid.
" homologous " in term " homologous ", such as " homologous sequence ", refers to that the nucleotide sequence between two nucleic acid is similar
Property or concordance.Those skilled in the art know, can pass through DNA-DNA or DNA-RNA hybridization carries out the assessment of homology (such as
Haines's and Higgins (chief editor)《Nucleic acid hybridization》(Nucleic Acid Hybridization) (IRL publishing houses, Oxford,
Britain) described in), or by comparing the sequence identity between two nucleic acid carrying out the assessment of homology.To mesh of the present invention
For, " homologous " is referred between two nucleic acid at least with 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%,
96%th, 97%, 98%, 99% or 100% sequence similarity or concordance, preferably with 60%, 70%, 80%, 90%,
95%th, 96%, 97%, 98%, 99% or 100% sequence similarity or concordance, more preferably with 80%, 90%, 95%,
96%th, 97%, 98%, 99% or 100% sequence similarity or concordance, most preferably with 90%, 95%, 96%, 97%,
98%th, 99% or 100% sequence similarity or concordance.Can be used to carrying out sequence alignment software such as BLAST and
ClustalW programs, two kinds of programs can be found from network.
Term " nucleic acid fragment that the present invention builds " or " according to present invention design and the nucleic acid fragment for building " are referred to and are included
The upstream and downstream homologous sequence in site to be finished, genes of interest (when for gene elmination, there is no genes of interest), parallel repetition
The nucleic acid fragment of sequence and bi-directional selection markers gene.Wherein being located at the sequence of the upstream and downstream sequence homology in site to be finished should
The two ends of nucleic acid fragment, for target nucleic acid homologous recombination.
Term " genes of interest " is referred to for the gene of gene editing is carried out in site to be finished, such as in site to be finished
Replace and original gene or be inserted on target nucleic acid on target nucleic acid, when for gene or base being deleted on target nucleic acid, be not required to
Genes of interest is wanted, i.e., genes of interest is do not exist on the nucleic acid fragment that the present invention builds.
Treat on one section of sequence and the target nucleic acid that term " parallel repetitive sequence " refers on the nucleic acid fragment built in the present invention
The upstream of decorating site or downstream sequence are homologous, for example the present invention build nucleic acid fragment 5 ' end containing with site to be finished under
The homologous parallel repetitive sequence (the corresponding parallel repetitive sequence in the downstream in site i.e. to be finished) of trip (i.e. 3 ' end), or structure of the present invention
The end of nucleic acid fragment 3 ' built is containing parallel repetitive sequence (the i.e. to be finished site homologous with the upstream in site to be finished (i.e. 5 ' end)
Upstream corresponding parallel repetitive sequence).It is homologous with which in this section of sequence and target nucleic acid on the nucleic acid fragment of present invention structure
Sequence be referred to as " parallel repetitive sequence " in the present invention.The length of parallel repetitive sequence is variable, for example in 30 bases extremely
In the range of 1000 bases, those skilled in the art can determine the length of parallel repetitive sequence according to specific needs.Term is " two-way
Riddled basins " or " marker gene " refer to the gene that not only can be just screened but also can be carried out negative screening, can be one
Individual or multiple genes, for example, tolC, galK, thyA, neo-sacB, tetA-sacB, cat-sacB etc..
The implication that " just screening " is generally understood that with those skilled in the art, i.e., typically pass through antibiotic-resistance marker's gene
Recon is given to the resistance of antibiotic or is given in corresponding selection deficiency culture basal growth by auxotroph gene
Characteristic realizing, such as using just screening thing kanamycin or chloromycetin, uracil-deficient type culture medium etc..
The implication that " negative screening " is generally understood that with those skilled in the art, i.e., its be generally characterized by limiting bar specific
Under part, the presence of negative screening thing is adversely affected to cell, for example, make cell death or obstruction/cell growth inhibiting.It is the most frequently used
Negative selection markers be bacillus subtilises (Bacillus subtilis) sacB.When sacB is introduced into heterologous host for example
During escherichia coli, which can cause cell death in the presence of Exogenous Sucrose.
" Chi sites " or " Chi sequences " is one section of short DNA fragmentation in genome, is occurred in the location proximate homologous heavy
The probability of group increases.In the organic genome of different type, the sequence in Chi sites is probably different.
Below with reference to the accompanying drawings the present invention is described further.
Fig. 1 shows the deletion of three kinds of major ways of gene editing, i.e. gene or base, replaces or insert.
Fig. 2 is the principle schematic of parallel repetitive sequence auxiliary gene editor.As shown in FIG., according to the present invention design and
The nucleic acid fragment of structure contains the sequence homologous with the upstream and downstream in site to be finished at its two ends, therefore the fragment is turning
Homologous recombination can occur with target nucleic acid (genome or plasmid) after changing in cell, the nucleic acid fragment is incorporated into target nucleic acid
On, the gene in site to be finished or base are deleted, the gene or base in site to be finished is replaced or is inserted into position to be finished
Point.After the homologous recombination that the above-mentioned first step occurs, by just screening enrichment recon, if on for example described nucleic acid fragment
One of bi-directional selection markers gene be cat, i.e. chloramphenicol resistance gene then can be with the Screening of Media Jing containing chloromycetin
The cell of conversion is crossed, and homologous recombination is there occurs so as to the restructuring daughter cell with chlorampenicol resistant to be enriched with.
After just screening, need to remove marker gene.The inventive method is using same between two parallel repetitive sequences
Source recombination excision marker gene.The parallel repetitive sequence one is located at the upstream or downstream in site to be screened, and one in basis
On the nucleic acid fragment that the present invention builds, it is bi-directional selection markers gene between two parallel repetitive sequences.If the present invention builds
Nucleic acid fragment at 5 ' ends containing parallel repetitive sequence, then the sequence is homologous with the 3 ' of site to be finished end upstream sequences, if
The nucleic acid fragment that the present invention builds contains parallel repetitive sequence at 3 ' ends, then the sequence holds upstream sequences with the 5 ' of site to be finished
It is homologous, so that homologous recombination occur when the two parallel repetitive sequences are located at same intramolecular and by the mark between them
Note gene elmination.Between described two parallel repetitive sequences at least with 30%, 40%, 50%, 60%, 70%, 80%,
90%th, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity or concordance, preferably with 60%, 70%,
80%th, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity or concordance, more preferably with 80%,
90%th, 95%, 96%, 97%, 98%, 99% or 100% sequence similarity or concordance, most preferably with 90%, 95%,
96%th, 97%, 98%, 99% or 100% sequence similarity or concordance.In a kind of particularly preferred embodiment, nucleic acid
Parallel repetitive sequence in fragment is the original series in site upstream to be finished or downstream on target nucleic acid.The length of parallel repetitive sequence
Degree can be varied as desired in, such as, in the range of 30 to 1000 bases, those skilled in the art can determine according to specific needs
The length of parallel repetitive sequence.As shown in Fig. 2 after it there is first step homologous recombination, it is parallel containing the two on target nucleic acid
Repetitive sequence, across marker gene between two parallel repetitive sequences, then allows the two parallel repetitive sequences that molecule occurs
Interior homologous recombination, such as by the culture restructuring daughter cell in the culture medium without positive-negative selection material for a period of time, so as to remove
Go marker gene.
The inventive method can carry out the seamless editor of gene.Referring still to Fig. 2, if the nucleic acid fragment that the present invention builds
On parallel repetitive sequence and target nucleic acid on close to decorating site upstream or downstream sequence homology, then can realize seamless volume
Volume." close to the sequence of the upstream or downstream of decorating site " refers between the upstream or downstream sequence and decorating site it is continuous
, no base intervals.
In the inventive method, introduce in bi-directional selection markers gene one or more Chi sites further increase it is double
To the efficiency (referring to Fig. 3 and Fig. 4) that riddled basins are deleted, the efficiency of final negative screening is made to can reach 50%.Can be with
On the premise of bi-directional selection markers gene function is not affected, Chi sites are incorporated into into any one of bi-directional selection markers gene
Individual or multiple sites.The Chi sites can be positive or reverse, can be continuous or not between multiple Chi sites
Continuously.According to different target cell types, may be selected using different Chi sites, it is in same type target cell, also optional
Select the Chi site sequences using varying strength.
Fig. 5 is the schematic diagram for carrying out gene editing with the inventive method in escherichia coli.With target DNA fragments it is first
The nucleic acid fragment conversion competent escherichia coli cell that the present invention builds, then screens on the flat board containing chloromycetin and contains
The escherichia coli restructuring daughter cell of cat-sacB bi-directional selection markers genes, the restructuring daughter cell for filtering out is first without positive and negative sieve
Select, then with the LB culture medium culturings containing negative screening thing sucrose, then with containing sucrose
LB plate screenings are enriched with positive colony, the positive colony that finally can use PCR checkings to obtain.
Fig. 6, Fig. 7 and Fig. 8 are the collection of illustrative plates of the plasmid used in the embodiment of the present invention.
The inventive method can be used on the genome of prokaryotic cell such as escherichia coli or eukaryotic cell such as yeast arbitrarily
The editor of position gene, it can also be used to gene editing is carried out on plasmid or artificial chromosome.
Detailed description has been done to the present invention above in association with accompanying drawing.It will be appreciated by those skilled in the art that these descriptions are simply
The present invention is preferably explained and understood, is not intended to do the scope of the present invention any restriction.Below in conjunction with being embodied as
The present invention is further illustrated for example.Equally, these embodiments are intended merely to enable those skilled in the art more preferably geographical
The solution present invention, does not constitute any limitation on the scope of the present invention.The scope of the present invention is limited only by the accompanying claims.
Those skilled in the art approve, various changes can be carried out to the form of the present invention and is changed without deviating from the present invention's
Spirit and scope, these changes and change fall into the model of the claims in the present invention protection due to belonging to the equivalents of the present invention
In enclosing.
In addition to this otherwise noted, term use herein has and understood by one of ordinary skill in the art typically contains
Justice.The experimental implementation of molecular biology and genetic engineering field, such as plasmid construction, conversion and the general technology for screening are abilities
Known to field technique personnel, the handbook of this area is also can be found in for example《Molecular Cloning:A Laboratory guide》, the 3rd edition, J. Pehanorm cloth
Lu Ke.The genome sequence of escherichia coli (Escherichiacoli) can beHTTP://WWW.NCBI.NLM.NIH.GOV/ GENOME/167PROJECT_ID=57779Obtain.The genome of ocean bacillus (Marinobacter aquaeolei VT8)
Sequence can beHTTP://WWW.NCBI.NLM.NIH.GOV/GENOME/TERM=MARINOBACTER+AQ UAEOLEIObtain
.
Embodiment
Embodiment 1 seamless deletion escherichia coli (Escherichia coli) fadE
(1) DNA of the synthesis containing fadE two ends homology region, the parallel repetitive sequence in 5 ' ends and cat-sacB, is named as fadE
I(SEQ ID NO.:1, referring also to Fig. 9).
(2) E.coli MG1655 competent cell of the fragment fadE I conversions containing pKD46, coats after incubation chloride mould
The LB solid mediums of element.After growing, Jing PCR and sequence verification obtain recombinant bacterium MG1655 Δ fadE::cat-sacB.
(3) purification MG1655 Δs fadE::Cat-sacB, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in
100mL LB fluid mediums, cultivate 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h；
Take 300 μ L culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(4) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
FadEp1 (TTGAAACCGAAATCATTACCGACGC, SEQ ID NO.:2) with fadEp2 (CGTGTTATCGCCAGGCTTTAGG
AGG, SEQ ID NO.:3) enter performing PCR detection for primer PCR, PCR response procedures are：94 DEG C of 4min 94 DEG C of 30s, 62 DEG C of 30s,
72 DEG C of 2min 35cycles, 72 DEG C of 5min (the PCR programs used by all examples below with where like) sequence verification is obtained
Obtain seamless deletion bacterial strain.
2 seamless deletion escherichia coli tesC of embodiment
(1) reacted with E.coli MG1655 genomes as template using PCR, using upstream and downstream primer tesCp1
(GCACTGCTCATTACCCTGTCCCTG, SEQ ID NO.:4) with tesCp2 (TGGATGTCACCCTGCTCAACGAG, SEQ
ID NO.:5) escherichia coli tesC genes are expanded and upstream and downstream partial sequence obtains tesC I fragments, by the fragment and pMD18-T
Obtain pMD18-tesC.
(2) reacted with pMD18-tesC as template using PCR, using upstream and downstream primer tesCp3 (AAAATTGCCACTATG
CAAATTAATTACAGGG, SEQ ID NO.:6) with tesCp4 (ACGTTTTGTGGTGCCGGATGCTC, SEQ ID NO.:7)
Reversely amplification obtains tesC II fragments.
(3) reacted with pEASY-cat-sacB as template using PCR, using phosphorylation upstream and downstream primer P5
(GTGACGGAAGATCACTTCGCAGA, SEQ ID NO.:8) and tesCp6 (AAAATTGCCACTATGCAAATTAATTACAGG GTTAATACCGCCAGATTACGATCAAAGGGAAAACTGTCCATATGC, SEQ ID NO.:9, underscore part is tesC bases
Because of upstream homologous sequence) amplification acquisition tesC III fragments.
(4) junction fragment tesC II and tesC III, Transformed E .coli DH5 α bacterial strains obtain pMD-tesC-cat-
SacB plasmids.
(5) reacted with pMD-tesC-cat-sacB as template using PCR, using upstream and downstream primer tesCp1 and tesCp2
Amplification obtains tesC IV fragments.
(6) fragment tesC IV electricity conversion containing pKD46 E.coli MG1655 competent cells, be coated with after incubation with it is chloride
The LB solid mediums of mycin.The PCR detections after growing, sequence verification obtain recombinant bacterium MG Δ tesC::cat-sacB.
(7) purification MG Δs tesC::Cat-sacB, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in 100mL
LB fluid mediums, cultivate 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：Take 300 μ
L culture fluid is inoculated in the LB fluid mediums containing 10% sucrose, cultivates 12h.
(8) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
TesCp1 and tesCp2 detects that for primer PCR sequence verification obtains seamless deletion bacterial strain.
3 ocean bacillus of embodiment (Marinobacter aquaeolei VT8) the seamless replacement escherichia coli of FAR genes
tesC
(1) using primers F ARF (ATGGCAATACAGCAGGTACATCACG, SEQ ID NO.:And FARR 10)
(TCAGGCAGCTTTTTTGCGCTG, SEQ ID NO.:11) FARS I fragments are obtained by template of ocean bacillus gene group,.
(2) with pMD-tesC-cat-sacB as template, FARS II pieces are obtained by primer amplification of tesCp4 and tesCp6
Section.
(3) junction fragment FARS I and FARS II, Transformed E .coli DH5 α bacterial strains obtain pMD-tesC-cat-sacB-
FAR plasmids (SEQ ID NO.:27, referring also to accompanying drawing 12).
(4) reacted with pMD-tesC-cat-sacB-FAR as template using PCR, using upstream and downstream primer tesCp1 and
TesCp2 amplifications obtain FARS III fragments.
(5) E.coli MG1655 competent cell of the fragment FARS III electricity conversion containing pKD46, is coated with after incubation and contains
The LB solid mediums of chloromycetin.The PCR detections after growing, sequence verification obtain recombinant bacterium MG Δ tesC::cat-sacB-
FAR。
(6) purification MG Δs tesC::Cat-sacB-FAR, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in
100mL LB fluid mediums, cultivate 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：
Take 300 μ L culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(7) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
TesCp1 and tesCp2 detects that for primer PCR sequence verification obtains seamless replacement bacterial strain.
The seamless insertion escherichia coli ldhA promoteres downstream of 4 ocean bacillus FAR genes of embodiment
(1) reacted with E.coli MG1655 genomes as template using PCR, using upstream and downstream primer FARIp1
(GCCGAATATCATGGTGGAAAATGG, SEQ ID NO.:12) with FARIp2 (CTGGCGATTGCTCCGTCTGC, SEQ ID
NO.:13) expand escherichia coli ldhA promoter upstream and downstream partial sequence and obtain KldhAI fragments, the fragment is obtained with pMD18-T
Obtain pMD18-KldhAI.
(2) reacted with pMD18-KldhAI as template using PCR, using using upstream and downstream primer FARIp3
(CATATGAATATCCTCCTTAGTTCCTATTCC, SEQ ID NO.:14) with FARIp4 (AAGACTTTCTCCAGTGATGTTG
AATCACAT, SEQ ID NO.:15) reversely amplification obtains FARI II fragments.
(3) reacted with pMD-cat-sacB as template using PCR, using phosphorylation upstream and downstream primer P5 and FARIp6
(CATATGAATATCCTCCTTAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAATCAAAGGGAAAACTGTCCATATGC,
SEQ ID NO.:16, underscore part is insertion point upstream homologous sequence) amplification acquisition FARI III fragments.
(4) junction fragment FARI II and FARI III, Transformed E .coli DH5 α bacterial strains obtain pMD-ldhAI-cat-
SacB plasmids.
(5) reacted with pMD-ldhAI-cat-sacB as template using PCR, expanded using upstream and downstream primer FARIp3 and p5
Obtain FARI IV fragments.
(6) using phosphorylated primers FARF and FARR, FARIV fragments are obtained by template of ocean bacillus gene group.
(7) junction fragment FARI IV and FARI V, Transformed E .coli DH5 α bacterial strains obtain pMD-ldhAI-cat-
sacB-FAR(SEQ ID NO.:28, referring also to accompanying drawing 11) plasmid.
(8) reacted with pMD-ldhAI-cat-chi-sacB-FAR as template using PCR, FARIp1 and FARIp2 amplifications are obtained
Obtain FARI VI fragments.
(9) fragment FARS VI electricity conversion containing pKD46 E.coli MG1655 competent cells, be coated with after incubation with it is chloride
The LB solid mediums of mycin.The PCR detections after growing, sequence verification obtain FAR insertion bacterial strain MGKLFARI.
(10) purification MGKLFARI, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in 100mL LB liquid cultures
Base, cultivates 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：Take 300 μ L culture fluid to connect
Plant in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(11) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
FARIp1 and FARIp2 detects that for primer PCR sequence verification obtains seamless insertion bacterial strain.
The structure of embodiment 5pMD-cat-chi-sacB
(1) reacted by template of pEASY-cat-sacB using PCR and use upstream and downstream primer pccs-p1
(GTGACGGAAGATCACTTCGCAGA, SEQ ID NO.:17) and pccs-p2 (CCACCAGCCAGTAACAAACCCGCGCGAT
TT, SEQ ID NO.:18, underscore is chi site sequences) catchi fragments are obtained, the fragment is obtained with pMD18-T
pMD18-cat-chi。
(2) using PCR react with pMD18-cat-chi as template using upstream and downstream primer pccs-P3 (CCACCAGCCAGT
AACAAACCCG, SEQ ID NO.:19, underscore is chi site sequences) and pccs-P4 (ATCTCTAGAGGATCCCCGGGTA
CC, SEQ ID NO.:20) pMD18-catchiF fragments are obtained.
(3) upstream and downstream primer P5 that as template use phosphorylation is reacted with pEASY-cat-sacB using PCR
And pccs-p6 (ATCAAAGGGAAAACTGTCCATATGC, SEQ ID NO. (GTGACGGAAGATCACTTCGCAGA):21) obtain
Obtain chisacB fragments.
(4) chisacB fragments and pMD18-catchiF fragments are connected, Transformed E .coli DH5 α bacterial strains obtain pMD-
Cat-chi-sacB plasmids.
6 height of embodiment follows seamless deletion escherichia coli fadE
(1) single stranded DNA of the synthesis containing fadE two ends homology region, the parallel repetitive sequence in 5 ' ends and cat-chi-sacB, life
Entitled fadE II (SEQ ID NO.:22).
(2) fragment fadE II electricity conversion containing pKD46 E.coli MG1655 competent cells, be coated with after incubation with it is chloride
The LB solid mediums of mycin.The PCR detections after growing, sequence verification obtain recombinant bacterium MG Δ fadE::cat-chi-sacB.
(3) purification MG Δs fadE::Cat-chi-sacB, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in
100mL LB fluid mediums, cultivate 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：
Take 300 μ L culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(4) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
FadEp1 and fadEp2 detects that for primer PCR sequence verification obtains seamless deletion bacterial strain.
7 height of embodiment follows seamless deletion escherichia coli tesC
(1) reacted with E.coli MG1655 genomes as template using PCR, using upstream and downstream primer tesCp1 and
TesCp2 expands escherichia coli tesC genes and upstream and downstream partial sequence obtains tesC I fragments, and the fragment is obtained with pMD18-T
Obtain pMD18-tesC.
(2) reacted with pMD18-tesC as template using PCR, using reverse using upstream and downstream primer tesCp3 and tesCp4
Amplification obtains tesC II fragments.
(3) reacted with pMD-cat-chi-sacB as template using PCR, using phosphorylation upstream and downstream primer P5 and tesCp6
Amplification obtains tesC III fragments.
(4) junction fragment tesC II and tesC III, Transformed E .coli DH5 α bacterial strains obtain pMD-tesC-cat-
Chi-sacB plasmids.
(5) reacted with pMD-tesC-cat-chi-sacB as template using PCR, using upstream and downstream primer tesCp1 and
TesCp2 amplifications obtain tesC IV fragments.
(6) fragment tesC IV electricity conversion containing pKD46 E.coli MG1655 competent cells, be coated with after incubation with it is chloride
The LB solid mediums of mycin.The PCR detections after growing, sequence verification obtain recombinant bacterium MG Δ tesC::cat-chi-sacB.
(7) purification MG Δs tesC::Cat-chi-sacB, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in
100mL LB fluid mediums, cultivate 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：
Take 300 μ L culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(8) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
TesCp1 and tesCp2 detects that for primer PCR sequence verification obtains seamless deletion bacterial strain.
8 height of embodiment follows the seamless replacement escherichia coli tesC of ocean bacillus FAR genes
(1) using primers F ARF and FARR, FARS I fragments are obtained by template of ocean bacillus gene group.
(2) with pMD-tesC-cat-chi-sacB as template, with primer tesCp4 and sacBR (ATCAAAGGGAAAACTG
TCCATATGCAC, SEQ ID NO.:23) amplification obtains FARS II fragments.
(3) junction fragment FARS I and FARSII, Transformed E .coli DH5 α bacterial strains obtain pMD-tesC-cat-chi-
SacB-FAR plasmids.
(4) reacted with pMD tesC-cat-chi-sacB-FAR as template using PCR, using upstream and downstream primer tesCp1
FARS III fragments are obtained with tesCp2 amplifications.
(5) E.coli MG1655 competent cell of the fragment FARS III electricity conversion containing pKD46, is coated with after incubation and contains
The LB solid mediums of chloromycetin.The PCR detections after growing, sequence verification obtain recombinant bacterium MG Δ tesC::cat-chi-
sacB-FAR。
(6) purification MG Δs tesC::Cat-chi-sacB-FAR, bears screening process as shown in Figure 5, takes single bacterium colony inoculation
In 100mL LB fluid mediums, 12h is cultivated；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate
12h：Take 300 μ L culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(7) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
TesCp1 and tesCp2 detects that for primer PCR sequence verification obtains seamless replacement bacterial strain.
9 height of embodiment follows the seamless insertion escherichia coli ldhA promoteres downstream of ocean bacillus FAR genes
(1) reacted with E.coli MG1655 genomes as template using PCR, using upstream and downstream primer FARIp1 and
FARIp2 amplification escherichia coli ldhA promoter upstream and downstream partial sequences obtain KldhAI I fragments, by the fragment and pMD18-T
Obtain pMD18-KldhAI.
(2) reacted with pMD18-KldhAI as template using PCR, using anti-using upstream and downstream primer FARIp3 and FARIp4
FARI II fragments are obtained to amplification.
(3) reacted with pMD-cat-chi-sacB as template using PCR, using phosphorylation upstream and downstream primer P5 and FARIp6
Amplification obtains FARI III fragments.
(4) junction fragment FARI II and FARI III, Transformed E .coli DH5 α bacterial strains obtain pMD-ldhAI-cat-
Chi-sacB plasmids.
(5) reacted with pMD-ldhAI-cat-chi-sacB as template using PCR, using upstream and downstream primer FARIp3 and p5
Amplification obtains FARI IV fragments.
(6) using phosphorylated primers FARF and FARR, V fragments of FARI are obtained by template of ocean bacillus gene group.
(7) junction fragment FARI IV and FARI V, Transformed E .coli DH5 α bacterial strains obtain pMD-ldhAI-cat-chi-
SacB-FAR plasmids.
(8) reacted with pMD-ldhAI-cat-chi-sacB-FAR as template using PCR, FARIp1 and FARIp2 amplifications are obtained
Obtain FARI VI fragments.
(9) fragment FARS VI electricity conversion containing pKD46 E.coli MG1655 competent cells, be coated with after incubation with it is chloride
The LB solid mediums of mycin.The PCR detections after growing, sequence verification obtain FAR insertion bacterial strain MGKLFARI.
(10) purification MGKLFARI, bears screening process as shown in Figure 5, takes single bacterium colony and be inoculated in 100mL LB liquid cultures
Base, cultivates 12h；Take 1mL culture fluid and be inoculated in the LB fluid mediums containing 10% sucrose, cultivate 12h：Take 300 μ L culture fluid to connect
Plant in the LB fluid mediums containing 10% sucrose, cultivate 12h.
(11) the LB solid mediums of appropriate 10% sucrose of dilution spread of above-mentioned culture fluid are taken, single bacterium colony to be grown, with
TFARIp1 and FARIp2 detects that for primer PCR sequence verification obtains seamless insertion bacterial strain.
10 traceless knockout yeast FAA1 of embodiment
(1) single stranded DNA of the synthesis containing FAA1 two ends homology region, the parallel repetitive sequence in 5 ' ends and URA3, is named as FAA-
URA3(SEQ ID NO.:24, referring also to accompanying drawing 10).
(2) fragment FAA-URA3 electricity transformed saccharomyces cerevisiae competent cell, coats SD culture medium after incubation.After growing
PCR detects that sequence verification obtains FAA1 and knocks out bacterium TAMkf.
(3) purification TAMkf, takes single bacterium colony and is inoculated in SD+ uracil fluid mediums, cultivate 24h；Take 1mL culture fluid to connect
Plant in SD+ uracil+5-FOA (i.e. 5- fluororotic acids) fluid medium, cultivate 24h：Take 300 μ L culture fluid and be inoculated in SD+ urine
Pyrimidine+5-FOA fluid mediums, cultivate 24h.
(4) take above-mentioned culture fluid and line SD+ uracil+5-FOA solid mediums, cultivate 50h, point after picking single bacterium colony
SD+ uracil and SD solid mediums are incubated to point.
(5) it is chosen at SD solid mediums not grow, in the bacterium colony of SD+ uracil culture basal growths, with FAAp1
(TTAGGATACAATAAAAACTAGAACAAACAC,SEQ ID NO.:25) and FAAp2 (CTATCATGGAAATGTTGATCC,
SEQ ID NO.:26) it is primer PCR, sequence verification obtains seamless deletion bacterial strain.
Claims (8)
1. a kind of gene editing method, comprises the following steps：
A. target cell is provided, the target cell includes the target nucleic acid with site to be finished；
B. with the upstream and downstream homologous sequence comprising the site to be finished, genes of interest, parallel repetitive sequence and bidirectional screening mark
The nucleic acid fragment of note gene converts the target cell, so that the nucleic acid fragment and target nucleic acid occur homologous recombination, the nucleic acid
Fragment is incorporated on target nucleic acid；
C. just screened careful to filter out restructuring that genes of interest and bi-directional selection markers gene are incorporated on target nucleic acid
Born of the same parents；
D. allow the corresponding parallel repetition of the upstream or downstream in parallel repetitive sequence on the nucleic acid fragment and site to be finished
There is homologous recombination in sequence, to delete marker gene；
E. negative screening is carried out to be enriched with the restructuring daughter cell for deleting bi-directional selection markers gene；
Parallel repetitive sequence on step b center acid fragment is the original series in site upstream to be finished or downstream on target nucleic acid,
Or,
On parallel repetitive sequence on step b center acid fragment and target nucleic acid close to site to be finished upstream or downstream sequence
It is homologous, to realize seamless editor；
On step b center acid fragment, bi-directional selection markers gene is the base that not only can have just been screened but also can have been carried out negative screening
Cause；
Wherein the two ends of the nucleic acid fragment are located at the sequence of the upstream and downstream sequence homology in site to be finished, for same with target nucleic acid
Recombinate in source；
The parallel repetitive sequence one is located at the upstream or downstream in site to be finished, and one, on nucleic acid fragment, is occurring institute
After stating the homologous recombination in step b, contain two parallel repetitive sequences on target nucleic acid, between described two parallel repetitive sequences
Across marker gene, then described two parallel repetitive sequences generation intramolecular homologous restructuring, so as to remove marker gene.
2. the method for claim 1, it is characterised in that in step d in the culture medium without positive-negative selection material incubation step c
The restructuring daughter cell for filtering out is allowing the upstream or downstream of parallel repetitive sequence on the nucleic acid fragment and site to be finished
Corresponding parallel repetitive sequence there is homologous recombination, so as to delete marker gene.
3. the method for any one of claim 1-2, it is characterised in that the bi-directional selection markers gene in step b include one or
Multiple Chi sites are improving the efficiency of bi-directional selection markers gene elmination.
4. the method for claim 3, it is characterised in that on the premise of bi-directional selection markers gene function is not affected, by Chi positions
Point is incorporated into any one or more sites of bi-directional selection markers gene.
5. the method for claim 3, it is characterised in that the Chi sites can be it is positive or reverse, multiple Chi sites it
Between can be continuous or discontinuous.
6. the method for claim 3, it is characterised in that different Chi sites can be used in different types of genome, same
The Chi site sequences of varying strength can be used in the genome of one type.
7. the method for claim 1, it is characterised in that methods described is used for prokaryotic cell or gene of eucaryote cell group optional position
The editor of gene.
8. the method for claim 1, it is characterised in that methods described is for carrying out gene editing on plasmid or artificial chromosome.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410148355.5A CN103898140B (en) | 2014-04-14 | 2014-04-14 | Simple efficient gene editing method |
| PCT/CN2014/087814 WO2015158115A1 (en) | 2014-04-14 | 2014-09-29 | Simple and efficient gene editing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410148355.5A CN103898140B (en) | 2014-04-14 | 2014-04-14 | Simple efficient gene editing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898140A CN103898140A (en) | 2014-07-02 |
| CN103898140B true CN103898140B (en) | 2017-03-22 |
Family
ID=50989708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410148355.5A Active CN103898140B (en) | 2014-04-14 | 2014-04-14 | Simple efficient gene editing method |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103898140B (en) |
| WO (1) | WO2015158115A1 (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106191088B (en) * | 2016-07-28 | 2019-06-28 | 北京大学 | A set of method that escherichia coli chromosome is arrived into the optimized recombination of plasmid expression system |
| CN111434772A (en) * | 2019-01-11 | 2020-07-21 | 广州中科蓝华生物科技有限公司 | Gene editing system based on CRISPR-Cas9 technology and application |
| CN112921038B (en) * | 2021-02-23 | 2022-08-02 | 安徽农业大学 | Homologous recombination mechanism mediated accurate sequence replacement gene editing method and element structure thereof |
| CN113046379B (en) * | 2021-02-26 | 2023-03-31 | 通用生物(安徽)股份有限公司 | CRISPRCAS 9-based continuous gene editing method |
| CN114032248B (en) * | 2021-11-02 | 2023-11-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Large-fragment knockout plasmid for myxococcus xanthus and knockout method thereof |
| CN114107253B (en) * | 2021-12-17 | 2024-03-15 | 复旦大学附属华山医院 | System and method for gene editing by using engineering cells |
| CN114480467B (en) * | 2022-02-24 | 2023-08-25 | 江南大学 | CRISPR-cpf1 screening tool for assisting sacB gene editing system in coryneform bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103232947A (en) * | 2013-04-12 | 2013-08-07 | 天津科技大学 | Freezing resistant Saccharomyces cerevisiae bacterial strain and construction method thereof |
| CN103232994A (en) * | 2013-01-25 | 2013-08-07 | 山东大学 | Method for screening unmarked gene knockout bacterial strain of acidithiobacillus thiooxidans |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040045043A1 (en) * | 2002-05-20 | 2004-03-04 | Finney Robert E. | Compositions and methods for generating conditional knockouts |
| CN1793376A (en) * | 2005-11-28 | 2006-06-28 | 北京北方杰士生物科技有限责任公司 | Process for removing selecting mark in transferring gene plant and special carrier |
| WO2011019717A1 (en) * | 2009-08-10 | 2011-02-17 | Mascoma Corporation | Positive and negative selectable markers for use in thermophilic organisms |
| CN102226199A (en) * | 2011-04-29 | 2011-10-26 | 西北农林科技大学 | Construction process of goat Beta-lactoglobulin locus targeting vector for producing foreign protein |
-
2014
- 2014-04-14 CN CN201410148355.5A patent/CN103898140B/en active Active
- 2014-09-29 WO PCT/CN2014/087814 patent/WO2015158115A1/en active Application Filing
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103232994A (en) * | 2013-01-25 | 2013-08-07 | 山东大学 | Method for screening unmarked gene knockout bacterial strain of acidithiobacillus thiooxidans |
| CN103232947A (en) * | 2013-04-12 | 2013-08-07 | 天津科技大学 | Freezing resistant Saccharomyces cerevisiae bacterial strain and construction method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2015158115A1 (en) | 2015-10-22 |
| CN103898140A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898140B (en) | Simple efficient gene editing method | |
| US11345933B2 (en) | CRISPR enabled multiplexed genome engineering | |
| CN107083392B (en) | CRISPR/Cpf1 gene editing system and application thereof in mycobacteria | |
| Wang et al. | Genome editing of model oleaginous microalgae Nannochloropsis spp. by CRISPR/Cas9 | |
| CN105154566B (en) | A kind of method for screening rice target gene editor plant | |
| JP6994730B2 (en) | Genome editing method for filamentous fungus genome editing by direct introduction of protein | |
| Jiang et al. | Highly efficient genome editing in Xanthomonas oryzae pv. oryzae through repurposing the endogenous type I‐C CRISPR‐Cas system | |
| Yin et al. | CRISPR/Cas9-mediated genome editing via homologous recombination in a centric diatom Chaetoceros muelleri | |
| CN103131718B (en) | The clone of the new hypertonicity-resistant functional gene CgHog1 of source Candida glycerolgenesis and its application | |
| CN108251347A (en) | It is a kind of to stablize the structure and industrial applications of e. coli bl21 chassis bacterial strain to become larger | |
| WO2020134427A1 (en) | Use of sll0528 gene in improving ethanol tolerance of synechocystis sp. pcc 6803 | |
| CN105002129B (en) | The Shewanella WP3 bacterial strain and its construction method of the height engagement rate of transform and application | |
| CN103789337A (en) | Suicide vector pGMB152 for blue-white selection and application thereof | |
| CN103232994A (en) | Method for screening unmarked gene knockout bacterial strain of acidithiobacillus thiooxidans | |
| CN103849640B (en) | A kind of oligonucleotide and the method for plasmid cotransformation for the point mutation of intestinal bacteria indispensable gene can be eliminated | |
| Aravinthkumar et al. | Genome Editing Technology: A Practical Overview for the Management of Plant Diseases | |
| CN106244623B (en) | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene | |
| CN104140976A (en) | Construction method of linear SUMO vector for homologous recombination | |
| CN117327742A (en) | Technical method for promoting efficient replacement and homogenization of chlamydomonas chloroplast genome | |
| CN104830895B (en) | The method that mosaic disease resisting sugar cane breed is cultivated using artificial synthesized MV2 sequences | |
| JP2022023042A (en) | Methods for genome editing of filamentous fungi by direct introduction of genome-editing protein | |
| CN115927381A (en) | Rape RNA processing factor NCBP gene and application thereof | |
| JP2010148359A (en) | Method for introducing protein in nucleus, and utilization of the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211206 Address after: 300308 1-201-a218, building 8, Huiying Industrial Park, No. 86, Zhonghuan West Road, pilot free trade zone (Airport Economic Zone), Binhai New Area, Tianjin Patentee after: Tiangong Biotechnology (Tianjin) Co.,Ltd. Address before: No.32, Xiqi Road, Airport Economic Zone, Binhai New Area, Tianjin 300308 Patentee before: TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY, CHINESE ACADEMY OF SCIENCES |