CN108251347A - It is a kind of to stablize the structure and industrial applications of e. coli bl21 chassis bacterial strain to become larger - Google Patents
It is a kind of to stablize the structure and industrial applications of e. coli bl21 chassis bacterial strain to become larger Download PDFInfo
- Publication number
- CN108251347A CN108251347A CN201810208526.7A CN201810208526A CN108251347A CN 108251347 A CN108251347 A CN 108251347A CN 201810208526 A CN201810208526 A CN 201810208526A CN 108251347 A CN108251347 A CN 108251347A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- coli
- hns
- bacterial strain
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to genetic engineering fields, provide a kind of structure and industrial applications of e. coli bl21 chassis bacterial strain stablized and become larger.The regulation and control of constitutive expression are carried out to the endogenous gene hns of e. coli bl21 genome using Crispr/cas9 gene editings tool, the expression quantity of endogenous gene hns, the hns constitutive expression strain was nameds B after genetic engineering recombinates are improved with strong promoter and RBS.The bacterial strain is relative to the e. coli bl21 not being transformed, and first, form changes, cell volume increase, and production capacity improves in packet；Second, there is identical growth rate compared with the Bacillus coli cells not being transformed.The bacterial strain can improve the yield of destination protein as industrialized chassis cell within the unit interval.
Description
Technical field
The invention belongs to genetic engineering fields, provide a kind of structure of e. coli bl21 chassis bacterial strain stablized and become larger
It builds and industrial applications.
Background technology
H-NS is a kind of DNA binding protein being rich in Escherichia coli, is made of two identical subunits, function is similar
In the histone of eukaryocyte, it is related to the FOLD AND PACK of chromosome and the adjusting of gene expression.At present, for the H- of Escherichia coli
NS albumen most studies, as a kind of trans-acting factor of general transcription silencer, energy and escherichia coli promoter
The common curved DNA sequence selectivity in upstream is combined so as to which suppressor is transcribed.
In industrial production application, usually by the use of e. coli bl21 as chassis cell, by its powerful foreign protein
Ability to express carries out corresponding valuable foreign protein according to the demand of people and produces, and under the system, protein yield is high, by-product
Object is few.Such as prior art CN102618552A.Meanwhile people are to further improve the yield of protein expression, also constantly
Genetic modification is carried out to e. coli bl21 chassis cell, the optimization in terms of screening etc. of superior strain improves yield and technology
Transformation, such as prior art CN105255806A, but in the scheme of the prior art, as cell volume becomes larger and the speed of growth
Slow down, while yield is also impacted therewith.
The present invention seeks to which Escherichia coli chassis cell is transformed, under conditions of growth speed is not influenced, make its volume
Become larger, intracellular production capacity is improved, so that protein yield is further improved in the space for obtaining bigger.
Invention content
For presently, there are the problem of, the present invention provides a kind of e. coli bl21 chassis bacterial strains stablized and become larger
Structure and industrial applications.
The cell that the present invention is obtained increases 1.5-2 times than normal e. coli bl21 cell volume, unit cell
1.2-1.5 times of Quality advance, and the chassis cell can stablize heredity.
The present invention obtains aforementioned preferred cell mainly using Crispr/cas9 gene editing tools to e. coli bl21
The endogenous gene hns of genome carries out the regulation and control of constitutive expression, and the expression of endogenous gene hns is improved with strong promoter and RBS
Amount, the hns constitutive expression strain was nameds B after genetic engineering recombinates.In terms of advantageous effect, the bacterial strain is not relative to changing
The e. coli bl21 made, first, form changes, and production capacity improves in packet；Second, there is identical growth rate；Third, energy
It is enough to stablize heredity, favorable reproducibility.
The present invention is achieved through the following technical solutions：
The primary and foremost purpose of the present invention is the provision of a kind of e. coli bl21 chassis bacterial strain stablized and become larger, and feature exists
In the strain was named bacterial strain B, sequence is Seq NO.8.
Another object of the present invention is to provide aforementioned a kind of to stablize the system of e. coli bl21 chassis bacterial strain to become larger
Preparation Method includes the following steps：
1) 1 electricity of plasmid that, will express Cas9 albumen and RED recombination systems is transformed into e. coli bl21 initial cell；
Preferred method is：The BL21 initial cells being incubated overnight in LB culture mediums are transferred, until OD600 reaches 0.5-
When 1.0, competent cell is made into, and 1 electricity of DNA plasmid of 50-100ng is transformed into e. coli bl21 competent cell
In；With the Kan resistant panels of 50 μ g/ml working concentrations, 37 DEG C are screened.
2), design primer synthesis strong promoter and RBS, preferably Ptet promoters+RBS（BBa_0034）；
The design primer synthesis strong promoter and RBS can be carried out according to method known in the art.
3), each 300bp length of the upstream and downstream homology arm of PCR amplification e. coli bl21 endogenous gene hns, middle and upper reaches
Homology arm is the 300bp before hns own promoters, and downstream homology arm is the 300bp since hns initiation codons backward；
The PCR amplification can be carried out according to method known in the art.
4), above-mentioned segment is linked in sequence by overlap PCR, i.e. upstream homology arm+Ptet+RBS+ downstreams are homologous
Arm, and the long segment is building up in plasmid 2 as depicted；
5) the N20 sequences of the original promoters of e. coli bl21 endogenous gene hns, are designed and synthesized, N20 sequences hs ns is original to be opened
20bp segments inside mover, it is desirable that 3 bases are NGG, the as Format Series Lines of N20+NGG behind its sequence on genome,
And there is no the sequence repeated on genome, and the N20 sequences are connected on the plasmid 2 containing sgRNA sequences；
6), picking contains the positive clone molecule that the scribing line of 1 Escherichia coli of plasmid isolates and purifies, and prepares electricity and turns competent cell, induces
Express the expression of RED recombinases.
Preferred method is：Picking contains LB of 1 Escherichia coli of the plasmid positive clone molecule that isolates and purifies of scribing line in Kan resistances
It is cultivated in culture medium, when OD600 reaches 0.2-0.4, prepares electricity and turn competent cell, in the process for making competence
In, 1h adds in the arabinose of 10mM, the expression of induced expression RED recombinases in culture solution before being placed on ice-water bath.
7), 2 electricity of plasmid is gone in the e. coli bl21 containing plasmid 1, the guideRNA energy after the transcription of inducing plasmid 2
Enough navigating to needs the endogenous hns gene locis for doing genetic modification, while Cas9 albumen and RED weights on induction expression plasmid 1
The expression of system system can carry out the site of the N20 special shearing, while be sent out again by recombinating the effect of related enzyme systems
New Ptet promoters, are replaced endogenous promoter, and pass through sequencing and be detected whether recombinate success, tested by raw homologous recombination
Card obtains the bacterial strain of high efficient expression hns；
Preferred method is：37 DEG C of recovery 1h, with the kan resistances of 50 μ g/ml working concentrations and the spc of 100 μ g/ml working concentrations
Resistant panel is screened, 37 DEG C be incubated overnight after clone is verified, new promoter replaces endogenous opens after homologous recombination
Mover is detected whether recombinate success by sequencing, and verification obtains the bacterial strain of high efficient expression hns.
8) plasmid 1 and plasmid 2 in e. coli bl21 after being transformed, are eliminated.
Preferred method is：Positive clone molecule connects LB liquid（Kan resistances）, 10mM rhamnoses are added in, induction is oriented to plasmid 2
SgRNA is transcribed, overnight incubation, and scribing line divides single bacterium colony, tests the elimination of positive plasmid 2；37 DEG C of liquid LB（Glucose containing 5g/L）Training
It supports overnight, dilution 102-104Afterwards, the LB plates of 5g/L glucose and 10g/L sucrose are coated on, picking monoclonal carries out Kan resistances and tests
Card verifies the elimination of plasmid 1.The final chassis cell strain obtained without plasmid 1 and plasmid 2.
A kind of e. coli bl21 chassis bacterial strain to become larger of stablizing another object of the present invention is to provide described is made
Application for the chassis cell for preparing albumen.
The present invention includes relative to the advantageous effect of the prior art：
First, the present invention has found that the H-NS protein levels in Escherichia coli can influence Bacillus coli cells by many experiments
Size, the expression quantity of H-NS albumen is bigger, and cell volume also becomes bigger, and content yield is also higher, still, growth rate
It is unaffected, therefore unit interval inner cell production capacity significantly improves.
In addition, e. coli bl21 is suitble to great expression to produce heterologous protein, through being commonly used for work frequently as type strain
In the production of industry metaplasia, therefore, the expression of the H-NS by improving e. coli bl21, structure biosynthesis chassis bacterial strain,
Bacterial strain is stablized heritable, all has the characteristics that the biosynthesis of downstream different demands blanket, can greatly improve production capacity.
Description of the drawings
Fig. 1 present invention can stablize the structure schematic diagram of e. coli bl21 chassis bacterial strain to become larger；
1 step of Fig. 2 embodiment of the present invention（2）In step by step 1）Structure schematic diagram；
1 step of Fig. 3 embodiment of the present invention（2）In step by step 5）Structure schematic diagram；
1 step of Fig. 4 embodiment of the present invention（2）In step by step 6）Structure schematic diagram；
Before the transformation of Fig. 5 e. coli bl21s（2A）After being transformed with e. coli bl21 of the present invention（2B）Microscope detects schematic diagram；
Fig. 6 embodiment of the present invention intracellulars production capacity increases testing result schematic diagram；
Fig. 7 embodiment of the present invention vitro growth rates schematic diagrames.
Specific embodiment
Below in conjunction with specific embodiments and the drawings, the present invention is further described, but the present invention is not limited to this.
Embodiment 1
（1）, chassis microorganism selection：E. coli bl21
Strong promoter selects：Ptet promoters（Sequence Seq NO.1）：
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATATGCAGCAGGACGCACT
GACC。
RBS is selected：BBa_0034（Sequence Seq NO.2）：AAAGAGGAGAAA.
（2）Preparation flow
With reference to shown in the flow of Fig. 1, preparation process is as follows：
1) 1 electricity of plasmid that, will express Cas9 albumen and RED recombination systems is transformed into e. coli bl21 initial cell：It will
The BL21 initial cells being incubated overnight in LB culture mediums are transferred, until when OD600 reaches 0.5-1.0, are made into impression
State cell, and 1 electricity of DNA plasmid of 50-100ng is transformed into e. coli bl21 competent cell.It is worked with 50 μ g/ml
The Kan resistant panels of concentration, 37 DEG C are screened.The preparation process of the step is with reference to shown in Fig. 2.
2) sequence Ptet promoters+RBS, is designed and synthesized（BBa_0034）
（Sequence Seq NO.3）：
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATATGCAGCAGGACGCACT
GACCTCTAGAGAAAGAGGAGAAATACTAG
3), using e. coli bl21 genome as template, by the upstream and downstream homology arm of PCR amplification endogenous gene hns, respectively
300bp length.
（Upstream sequence Seq NO.4）：
TTGCGCAAGTAATAGCCCTCTGTTGACCTCCAGGAGATAGTGCAATACTAAGTCCCTGCTCTTATTGCGACTG
TTCTACTTTTCATCATTCGCTTAATAGGGAATTCTCGTAAACACGACTAATACAGAAGACTGAAAGGTCGTCAGCCT
ACGATAATCTCCCCATAAAATGTGACATGAATCAGGAAGTTTTAACCTCACGAGCTGCGAAATCATCGGTACAAATA
GGGCTATATGCCGCGTCTTTTCTGGCTAATTTTATGAAAAGATATTTATTGGCGGCACAAAATAAAGAACAAT；
（Downstream sequence Seq NO.5）：
ATGAGCGAAGCACTTAAAATTCTGAACAACATCCGTACTCTTCGTGCGCAGGCAAGAGAATGTACACTTGAAA
CGCTGGAAGAAATGCTGGAAAAATTAGAAGTTGTTGTTAACGAACGTCGCGAAGAAGAAAGCGCGGCTGCTGCTGAA
GTTGAAGAGCGCACTCGTAAACTGCAGCAATATCGCGAAATGCTGATCGCTGACGGTATTGACCCGAACGAACTGCT
GAATAGCCTTGCTGCCGTTAAATCTGGCACCAAAGCTAAACGTGCTCAGCGTCCGGCAAAATATAGCTACGTT。
4), above-mentioned segment is linked in sequence using overlap PCR kits, i.e. upstream homology arm+Ptet+RBS+
Downstream homology arm（Sequence Seq NO.6）：
TTGCGCAAGTAATAGCCCTCTGTTGACCTCCAGGAGATAGTGCAATACTAAGTCCCTGCTCTTATTGCGACTG
TTCTACTTTTCATCATTCGCTTAATAGGGAATTCTCGTAAACACGACTAATACAGAAGACTGAAAGGTCGTCAGCCT
ACGATAATCTCCCCATAAAATGTGACATGAATCAGGAAGTTTTAACCTCACGAGCTGCGAAATCATCGGTACAAATA
GGGCTATATGCCGCGTCTTTTCTGGCTAATTTTATGAAAAGATATTTATTGGCGGCACAAAATAAAGAACAATTCCC
TATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATATGCAGCAGGACGCACTGACCTCTA
GAGAAAGAGGAGAAATACTAGATGAGCGAAGCACTTAAAATTCTGAACAACATCCGTACTCTTCGTGCGCAGGCAAG
AGAATGTACACTTGAAACGCTGGAAGAAATGCTGGAAAAATTAGAAGTTGTTGTTAACGAACGTCGCGAAGAAGAAA
GCGCGGCTGCTGCTGAAGTTGAAGAGCGCACTCGTAAACTGCAGCAATATCGCGAAATGCTGATCGCTGACGGTATT
GACCCGAACGAACTGCTGAATAGCCTTGCTGCCGTTAAATCTGGCACCAAAGCTAAACGTGCTCAGCGTCCGGCAAA
ATATAGCTACGTT,
And the long segment is building up to the downstream of sgRNA in plasmid 2.
5) the N20 sequences of the original promoters of e. coli bl21 endogenous gene hns, are designed and synthesized（Sequence Seq
NO.7）：AATTCAGTTGTGCAATAGCC, including：20bp segments inside the original promoters of N20 sequences hs ns, it is desirable that genome
3 bases are NGG, the as Format Series Lines of N20+NGG behind its upper sequence, and do not have the sequence repeated on genome, and
The N20 sequences are connected on the plasmid 2 containing sgRNA sequences.With reference to shown in Fig. 3, which is connected to plasmid 2 in figure
In the middle plasmid is obtained behind pJ23119.
6), picking contains LB culture medium of 1 Escherichia coli of the plasmid positive clone molecule that isolates and purifies of scribing line in Kan resistances
In cultivated, when OD600 reaches 0.2-0.4, prepare electricity and turn competent cell, during competence is made, ice water
1h adds in the arabinose of 10mM, the expression of induced expression RED recombinases in culture solution before being placed in bath；The system of the step
Standby process is with reference to shown in Fig. 4.
7), by the plasmid 2 after recombination（100-200 ng）Electricity goes in the 6th step the Escherichia coli of induced expression RED
In BL21：37 DEG C of recovery 1h, with the kan resistances of 50 μ g/ml working concentrations and the spc resistant panels of 100 μ g/ml working concentrations
Screening, 37 DEG C be incubated overnight after clone is verified, new promoter replaces endogenous promoter after homologous recombination, passes through
Sequencing is detected whether recombinate success, and verification obtains the bacterial strain of high efficient expression hns.
8) plasmid 1 and plasmid 2 in e. coli bl21 after being transformed, are eliminated：Positive clone molecule connects LB liquid（Kan resists
Property）, 10mM rhamnoses are added in, induction is oriented to the sgRNA transcriptions of plasmid 2, overnight incubation, and scribing line divides single bacterium colony, tests positive plasmid 2
It eliminates；37 DEG C of liquid LB（Glucose containing 5g/L）Overnight incubation after diluting 102-104, is coated on 5g/L glucose and 10g/L
The LB plates of sucrose, picking monoclonal carry out Kan resistance verifications, verify the elimination of plasmid 1；It is final to obtain without plasmid 1 and plasmid 2
Chassis cell strain, the following Seq NO.8 of sequence：
TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACATATGCAGCAGGACGCACT
GACCTCTAGAGAAAGAGGAGAAATACTAGATGAGCGAAGCACTTAAAATTCTGAACAACATCCGTACTCTTCGTGCG
CAGGCAAGAGAATGTACACTTGAAACGCTGGAAGAAATGCTGGAAAAATTAGAAGTTGTTGTTAACGAACGTCGCGA
AGAAGAAAGCGCGGCTGCTGCTGAAGTTGAAGAGCGCACTCGTAAACTGCAGCAATATCGCGAAATGCTGATCGCTG
ACGGTATTGACCCGAACGAACTGCTGAATAGCCTTGCTGCCGTTAAATCTGGCACCAAAGCTAAACGTGCTCAGCGT
CCGGCAAAATATAGCTACGTTGACGAAAACGGCGAAACTAAAACCTGGACTGGCCAGGGCCGTACTCCAGCTGTAAT
CAAAAAAGCAATGGATGAGCAAGGTAAATCCCTCGACGATTTCCTGATCAAGCAATAA。
2 measure of merit of embodiment
Bacterial strain B is obtained as chassis cell in LB culture mediums using embodiment 1,37 DEG C are cultivated, and when OD600 ≈ 0.2 takes
Sample is observed under the microscope, and form changes as shown in figure 5, cell volume has apparent increase；Intracellular production capacity increases
As shown in fig. 6, intracellular production capacity improves；However, the growth rate testing result from 1h to 2h finds that growth rate is constant, reference
Shown in Fig. 7.
Absolutely prove that strain culturing cell of the present invention has the advantage that：Cell volume also becomes bigger, content yield
Also higher, still, growth rate is unaffected, and unit interval inner cell production capacity significantly improves.
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
<110>Qi Wei bio tech ltd of Shenzhen
<120>It is a kind of to stablize the structure and industrial applications of e. coli bl21 chassis bacterial strain to become larger
<130>
<160>8
<170>PatentIn version 3.5
<210> 1
<211>77
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>Ptet promoter gene sequences
<400> 1
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatatgc 60
agcaggacgcactgacc 77
<210> 2
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>RBS（BBa_0034）Gene order
<400> 2
aaagaggaga aa 12
<210>3
<211>102
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>Ptet promoters+RBS（BBa_0034）Gene order
<400>3
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatatgc 60
agcaggacgcactgacctctagagaaagaggagaaatact ag 102
<210>4
<211>300
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>The upstream homology arm gene order of e. coli bl21 endogenous gene hns after PCR amplification
<400>4
ttgcgcaagtaatagccctctgttgacctccaggagatagtgcaatactaagtccctgct 60
cttattgcgactgttctacttttcatcattcgcttaatagggaattctcgtaaacacgac 120
taatacagaagactgaaaggtcgtcagcctacgataatctccccataaaatgtgacatga 180
atcaggaagttttaacctcacgagctgcgaaatcatcggtacaaatagggctatatgccg 240
cgtcttttctggctaattttatgaaaagatatttattggcggcacaaaataaagaacaat 300
<210>5
<211>300
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>The downstream homology arm gene order of e. coli bl21 endogenous gene hns after PCR amplification
<400>5
atgagcgaagcacttaaaattctgaacaacatccgtactcttcgtgcgcaggcaagagaa 60
tgtacacttgaaacgctggaagaaatgctggaaaaattagaagttgttgttaacgaacgt 120
cgcgaagaagaaagcgcggctgctgctgaagttgaagagcgcactcgtaaactgcagcaa 180
tatcgcgaaatgctgatcgctgacggtattgacccgaacgaactgctgaatagccttgct 240
gccgttaaatctggcaccaaagctaaacgtgctcagcgtccggcaaaatatagctacgtt 300
<210>6
<211>702
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>Upstream homology arm+Ptet+RBS+ downstreams homology arm gene order
<400>6
ttgcgcaagtaatagccctctgttgacctccaggagatagtgcaatactaagtccctgct 60
cttattgcgactgttctacttttcatcattcgcttaatagggaattctcgtaaacacgac 120
taatacagaagactgaaaggtcgtcagcctacgataatctccccataaaatgtgacatga 180
atcaggaagttttaacctcacgagctgcgaaatcatcggtacaaatagggctatatgccg 240
cgtcttttctggctaattttatgaaaagatatttattggcggcacaaaataaagaacaat 300
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatatgc 360
agcaggacgcactgacctctagagaaagaggagaaatactagatgagcgaagcacttaaa 420
attctgaacaacatccgtactcttcgtgcgcaggcaagagaatgtacacttgaaacgctg 480
gaagaaatgctggaaaaattagaagttgttgttaacgaacgtcgcgaagaagaaagcgcg 540
gctgctgctgaagttgaagagcgcactcgtaaactgcagcaatatcgcgaaatgctgatc 600
gctgacggtattgacccgaacgaactgctgaatagccttgctgccgttaaatctggcacc 660
aaagctaaacgtgctcagcgtccggcaaaatatagctacgtt 702
<210>7
<211>20
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223> BL21-pETduet-4cl::The plasmid gene sequence of sts
<400>7
aattcagttgtgcaatagcc 20
<210>8
<211>516
<212> DNA
<213> Artificial Sequence
<220>
<221> gene
<223>The gene order of bacterial strain B
<400>8
tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatatgc 60
agcaggacgcactgacctctagagaaagaggagaaatactagatgagcgaagcacttaaa 120
attctgaacaacatccgtactcttcgtgcgcaggcaagagaatgtacacttgaaacgctg 180
gaagaaatgctggaaaaattagaagttgttgttaacgaacgtcgcgaagaagaaagcgcg 240
gctgctgctgaagttgaagagcgcactcgtaaactgcagcaatatcgcgaaatgctgatc 300
gctgacggtattgacccgaacgaactgctgaatagccttgctgccgttaaatctggcacc 360
aaagctaaacgtgctcagcgtccggcaaaatatagctacgttgacgaaaacggcgaaact 420
aaaacctggactggccagggccgtactccagctgtaatcaaaaaagcaatggatgagcaa 480
ggtaaatccc tcgacgattt cctgatcaag caataa 516
Claims (9)
1. a kind of stablize the e. coli bl21 chassis bacterial strain to become larger, which is characterized in that the strain was named bacterial strain B, sequence
It is classified as Seq NO.8.
2. it is a kind of prepare it is described in claim 1 it is a kind of stablize the method for e. coli bl21 chassis bacterial strain to become larger, it is special
Sign is, composing type is carried out to the endogenous gene hns of e. coli bl21 genome using Crispr/cas9 gene editings tool
The regulation and control of expression improve the expression quantity of endogenous gene hns, the hns composing types after genetic engineering recombinates with strong promoter and RBS
Bacterial strain is expressed, obtains bacterial strain B.
3. according to the method described in claim 2, it is characterised in that it includes following preparation process：
1) 1 electricity of plasmid that, will express Cas9 albumen and RED recombination systems is transformed into e. coli bl21 initial cell；
2), design primer synthesis strong promoter and RBS；
3), each 300bp length of the upstream and downstream homology arm of PCR amplification e. coli bl21 endogenous gene hns, middle and upper reaches are homologous
Arm is the 300bp before hns own promoters, and downstream homology arm is the 300bp since hns initiation codons backward；
4), above-mentioned segment is linked in sequence by overlap PCR, i.e. upstream homology arm+Ptet+RBS+ downstreams homology arm,
And the long segment is building up in plasmid 2 as depicted；
5) the N20 sequences of the original promoters of e. coli bl21 endogenous gene hns, are designed and synthesized, N20 sequences hs ns is original to be opened
20bp segments inside mover, it is desirable that 3 bases are NGG, the as Format Series Lines of N20+NGG behind its sequence on genome,
And there is no the sequence repeated on genome, and the N20 sequences are connected on the plasmid 2 containing sgRNA sequences；
6), picking contains the positive clone molecule that the scribing line of 1 Escherichia coli of plasmid isolates and purifies, and prepares electricity and turns competent cell, induces
Express the expression of RED recombinases；
7), 2 electricity of plasmid is gone in the e. coli bl21 containing plasmid 1, the guideRNA after inducing plasmid 2 is transcribed can determine
Position is to the endogenous hns gene locis for needing to do genetic modification, while Cas9 albumen and RED recombination systems on induction expression plasmid 1
The expression of system can carry out the site of the N20 special shearing, while be occurred together by recombinating the effect of related enzyme systems again
Source recombinates, and new Ptet promoters is replaced to endogenous promoter, and pass through sequencing and be detected whether recombinate success, verified
To the bacterial strain of high efficient expression hns；
8) plasmid 1 and plasmid 2 in e. coli bl21 after being transformed, are eliminated.
4. according to the method described in claim 3, it is characterized in that, the step 1) is：It will be incubated overnight in LB culture mediums
BL21 initial cells transfer, until when OD600 reaches 0.5-1.0, be made into competent cell, and by 50-100ng's
1 electricity of DNA plasmid is transformed into e. coli bl21 competent cell；With the Kan resistant panels of 50 μ g/ml working concentrations, 37 DEG C
It is screened.
5. according to the method described in claim 3, it is characterized in that, strong promoter and RBS are respectively Ptet in the step 2)
Promoter+RBS（BBa_0034）.
6. according to the method described in claim 3, it is characterized in that, the step 6) is：Preferred method is：Picking contains plasmid
The positive clone molecule that the scribing line of 1 Escherichia coli isolates and purifies is cultivated in the LB culture mediums of Kan resistances, treats that OD600 reaches
It during 0.2-0.4, prepares electricity and turns competent cell, during competence is made, 1h is in culture solution before being placed on ice-water bath
Add in the arabinose of 10mM, the expression of induced expression RED recombinases.
7. according to the method described in claim 3, it is characterized in that, the step 7) is：37 DEG C of recovery 1h, with 50 μ g/ml works
Make concentration kan resistances and 100 μ g/ml working concentrations spc resistant panels screening, 37 DEG C be incubated overnight after to clone carry out
It verifies, new promoter replaces endogenous promoter after homologous recombination, is detected whether recombinate success by sequencing, verifies
To the bacterial strain of high efficient expression hns.
8. according to the method described in claim 3, it is characterized in that, the step 8) is：Positive clone molecule connects LB liquid（Kan
Resistance）, 10mM rhamnoses are added in, induction is oriented to the sgRNA transcriptions of plasmid 2, overnight incubation, and scribing line divides single bacterium colony, tests positive plasmid 2
Elimination；37 DEG C of liquid LB（Glucose containing 5g/L）Overnight incubation, dilution 102-104Afterwards, 5g/L glucose and 10g/ are coated on
The LB plates of L sucrose, picking monoclonal carry out Kan resistance verifications, verify the elimination of plasmid 1；It is final to obtain without plasmid 1 and plasmid
2 chassis cell strain.
9. described in claim 1, a kind of to stablize the e. coli bl21 chassis bacterial strain to become larger thin as the chassis for preparing albumen
The application of born of the same parents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810208526.7A CN108251347B (en) | 2018-03-14 | 2018-03-14 | Construction and industrial application of escherichia coli BL21 chassis strain capable of being stably enlarged |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810208526.7A CN108251347B (en) | 2018-03-14 | 2018-03-14 | Construction and industrial application of escherichia coli BL21 chassis strain capable of being stably enlarged |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108251347A true CN108251347A (en) | 2018-07-06 |
| CN108251347B CN108251347B (en) | 2021-06-08 |
Family
ID=62746766
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810208526.7A Active CN108251347B (en) | 2018-03-14 | 2018-03-14 | Construction and industrial application of escherichia coli BL21 chassis strain capable of being stably enlarged |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108251347B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109777863A (en) * | 2019-02-14 | 2019-05-21 | 湖北大学 | Identify the method and detection system of the interactively of sRNA and said target mrna coding region |
| CN111778201A (en) * | 2020-07-10 | 2020-10-16 | 中国科学院天津工业生物技术研究所 | Escherichia coli chassis cell with improved biological robustness and construction method and application thereof |
| WO2022082362A1 (en) * | 2020-10-19 | 2022-04-28 | 陈振暐 | Non-pathogenic bacterial gene expression system and transformant for metabolizing tyrosine, use thereof for preparing composition for reducing urinary toxins, and method for metabolizing tyrosine using same |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182532A (en) * | 2007-11-13 | 2008-05-21 | 重庆医科大学 | Bifidobacteria-bacillus coli shuttle expression carrier pBES, bifidobacteria-ETEC CFA/I recombinant vector and uses thereof |
| CN105255806A (en) * | 2015-11-17 | 2016-01-20 | 黑龙江省科学院微生物研究所 | Engineering strain producing anti-fungal protein genes and application |
| WO2016011021A1 (en) * | 2014-07-15 | 2016-01-21 | The Regents Of The University Of California | Performance enhancing genetic variants of e. coli |
-
2018
- 2018-03-14 CN CN201810208526.7A patent/CN108251347B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101182532A (en) * | 2007-11-13 | 2008-05-21 | 重庆医科大学 | Bifidobacteria-bacillus coli shuttle expression carrier pBES, bifidobacteria-ETEC CFA/I recombinant vector and uses thereof |
| WO2016011021A1 (en) * | 2014-07-15 | 2016-01-21 | The Regents Of The University Of California | Performance enhancing genetic variants of e. coli |
| CN105255806A (en) * | 2015-11-17 | 2016-01-20 | 黑龙江省科学院微生物研究所 | Engineering strain producing anti-fungal protein genes and application |
Non-Patent Citations (3)
| Title |
|---|
| CRISTIN CBRESCIA等: "The DNA Binding Protein H-NS Binds to and Alters the Stability of RNA in vitro and in vivo", 《JOURNAL OF MOLECULAR BIOLOGY》 * |
| EDZE R. WESTRA等: "The rise and fall of CRISPRs – dynamics of spaceracquisition and loss", 《MOLECULAR MICROBIOLOGY》 * |
| 鲁曦等: "缺氧条件下肠毒性大肠杆菌hns 和stpA 基因敲除以及对LT 毒素表达调控的研究", 《基因组学与应用生物学》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109777863A (en) * | 2019-02-14 | 2019-05-21 | 湖北大学 | Identify the method and detection system of the interactively of sRNA and said target mrna coding region |
| CN111778201A (en) * | 2020-07-10 | 2020-10-16 | 中国科学院天津工业生物技术研究所 | Escherichia coli chassis cell with improved biological robustness and construction method and application thereof |
| CN111778201B (en) * | 2020-07-10 | 2022-07-12 | 中国科学院天津工业生物技术研究所 | Escherichia coli chassis cell with improved biological robustness and construction method and application thereof |
| WO2022082362A1 (en) * | 2020-10-19 | 2022-04-28 | 陈振暐 | Non-pathogenic bacterial gene expression system and transformant for metabolizing tyrosine, use thereof for preparing composition for reducing urinary toxins, and method for metabolizing tyrosine using same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108251347B (en) | 2021-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108251347A (en) | It is a kind of to stablize the structure and industrial applications of e. coli bl21 chassis bacterial strain to become larger | |
| CN104087610B (en) | Shuttle vector and construction process thereof and application | |
| WO2020182221A1 (en) | Rice bacterial leaf streak-resistant protein, and encoding gene and application thereof | |
| CN108977890B (en) | Promoter library and method for constructing expression systems with different intensities in bacteria by using same | |
| CN105779444B (en) | A kind of Gene expression improving bacillus protein expression quantity | |
| CN106191090B (en) | The algae engineering bacteria system of antibiotic-free expression alien gene and its preparation and application | |
| CN107267528A (en) | A kind of tobacco axillary bud adjusting and controlling growth gene NtMOC1 and its cloning process and application | |
| CN112920984A (en) | Construction is based on formic acid and CO2Method and application of growing recombinant strain | |
| CN103966249B (en) | A kind of carrier and application thereof for building without screening label cyanobacteria | |
| CN106676125A (en) | Maltose promoter-containing carrier and maltose promoter mutant | |
| CN108823208B (en) | Tetracycline-induced promoter, and preparation method and application thereof | |
| Pfeifer et al. | Regulation of gas vesicle formation in halophilic archaea | |
| CN113186217B (en) | Neu5Ac-NanR induction system suitable for synechococcus UTEX 2973, construction method and application | |
| CN110408645A (en) | Target gene repeatedly seamless integration system and method in a kind of Yarrowia lipolytica | |
| Müller et al. | Coordinate positive regulation of genes encoding [NiFe] hydrogenases in Methanococcus voltae | |
| CN107475257B (en) | Promoter-like gene for efficiently promoting expression of foreign protein and application thereof | |
| CN116751792B (en) | Transcription factor downstream gene screening method | |
| CN103865946B (en) | Method based on metabolic regulation high yield oxytetracycline | |
| CN107384923B (en) | Promoter pYLG and application thereof in construction of candida tropicalis with high yield of long-chain dicarboxylic acid | |
| EP2109671B1 (en) | Expression cassette, use of the expression cassette, vector, host cell, a method for producing a polypeptide | |
| CN109825516B (en) | Saccharomyces cerevisiae site-directed saturation mutant gene spt15-N for improving ethanol yield and application thereof | |
| CN104513830A (en) | Gene expression vector applicable to gluconobacter oxydans and application of gene expression vector | |
| CN106244623B (en) | It can induce the pBLCK carrier and its construction method for rejecting selectable marker gene | |
| CN110157725A (en) | Make not produce the production poison microalgae that malicious microalgae generates the method for Microcystin and obtains | |
| CN108929882A (en) | A kind of the gene editing method and application of bacillus licheniformis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |