CN106086197A - A kind of test kit identifying Radix Berberidis Amurensis base and method - Google Patents
A kind of test kit identifying Radix Berberidis Amurensis base and method Download PDFInfo
- Publication number
- CN106086197A CN106086197A CN201610499262.6A CN201610499262A CN106086197A CN 106086197 A CN106086197 A CN 106086197A CN 201610499262 A CN201610499262 A CN 201610499262A CN 106086197 A CN106086197 A CN 106086197A
- Authority
- CN
- China
- Prior art keywords
- radix berberidis
- berberidis amurensis
- sequence
- kinds
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses a kind of detection kit identifying Radix Berberidis Amurensis base, it includes expanding and comprises nucleotide sequence such as SEQ ID NO:3～the reagent of 6 shown 4 kinds of genetic fragments.The invention also discloses a kind of method identifying Radix Berberidis Amurensis base.Test kit of the present invention and method can effectively, accurately distinguish the various bases of Radix Berberidis Amurensis, and authentication method is simple, stable, and the use for specification Radix Berberidis Amurensis is significant, and quality of medicinal material and clinical efficacy can be effectively ensured, and application prospect is good.
Description
Technical field
The present invention relates to the Molecular Identification technology of a kind of Tibetan medicine material base, particularly identify Radix Berberidis Amurensis base test kit and
Method.
Background technology
Radix Berberidis Amurensis is conventional Tibetan medicine material, begins to be loaded in the Four-Volume Medical Code, Tibetan language transliteration " gill ", " outstanding star ", " taming and dociling to you "
Deng." Jingzhubencao " is recorded: " Radix Berberidis Amurensis is cool in nature, rough, can hold back all poison, yellow fluid reducing ".Radix Berberidis Amurensis has heat clearing away, removing toxic substances, dampness, row
The effects such as yellow fluid, can be used for the treatment of the diseases such as dysentery, urinary tract infection, grasserie, oculopathy.Modern pharmacology research shows, little
Bark of a cork tree leatherware has obvious blood sugar reducing function, has preferable protective effect to diabetic retinal tissue in rat, has a extensive future.
But, Radix Berberidis Amurensis is typical many bases Tibetan medicine material, various in style, and Berberis (Berberis L.) is multiple medicinal
Plant is all used, and the multiformity of base and complexity have a strong impact on quality control and the market surpervision of Radix Berberidis Amurensis medical material.Radix Berberidis Amurensis
Skin is conventional Cortex Herb, and the outward appearance of each batch medical material is the most similar, color many one-tenth foresythia or yellow, its base kind without
Method uses tradition discrimination method intuitively accurately to differentiate.
Need to find a kind of method identifying each base kind of Radix Berberidis Amurensis objective, simple and effectively.
Summary of the invention
In order to solve the problems referred to above, the invention provides a kind of test kit identifying Radix Berberidis Amurensis base and method.
The invention provides four kinds of genetic fragments: its nucleotide sequence is respectively as shown in SEQ ID NO:3～6.
Primer pair of the present invention, it is the primer pair as shown in SEQ ID NO:1～2.
The reagent of amplification of nucleotide acid sequence such as SEQ ID NO:3～6 shown 4 kinds of genetic fragments identifies Radix Berberidis Amurensis scytoblastema in preparation
The former purposes in reagent.Preferably, described amplifing reagent include shown in SEQ ID NO:1～2 primer pair.
Present invention also offers the detection kit identifying Radix Berberidis Amurensis base, comprise amplification of nucleotide acid sequence such as SEQ ID
NO:3～the reagent of 6 shown 4 kinds of genetic fragments.
Preferably, described amplifing reagent include shown in SEQ ID NO:1～2 primer pair.
Preferably, described test kit also includes aforesaid four kinds of genetic fragments.
The method that present invention also offers the base identifying Radix Berberidis Amurensis, comprises the steps:
A, extracts sample DNA: extract the DNA in sample to be checked；
B, gene amplification: the DNA treated in sample basis is expanded with aforementioned primer；
C, result detects: detect DNA cloning result.
Preferably, in step c, the method detecting DNA cloning result is: comparison amplified fragments and aforesaid four kinds
Genetic fragment.
Test kit that the present invention provides and method can effectively, accurately distinguish the various bases of Radix Berberidis Amurensis, and authentication method
Simply, stablizing, the use for specification Radix Berberidis Amurensis is significant, quality of medicinal material and clinical efficacy can be effectively ensured, before application
Scape is good.
The detailed description of the invention of form by the following examples, makees the most specifically the foregoing of the present invention
Bright.But this should not being interpreted as, the scope of the above-mentioned theme of the present invention is only limitted to below example.All based on right of the present invention want
The technology that the content asking secretary to carry is realized belongs to the scope of the present invention.
Accompanying drawing explanation
4 kinds of main flow kind former plant figures of Fig. 1 Radix Berberidis Amurensis；
The variant sites of Fig. 24 kinds of Radix Berberidis Amurensis based on ITS sequence；
The variant sites of Fig. 34 kinds of Radix Berberidis Amurensis based on ITS2 sequence；
The variant sites of Fig. 44 kinds of Radix Berberidis Amurensis based on rbcL sequence；
Fig. 5 barcoding based on ITS, ITS2 and rbcL sequence gap schemes；
Fig. 6 different system based on rbcL sequence grow tree, A. phyletic evolution based on rbcL sequence NJ tree, B. based on
The phyletic evolution UPGMA tree of rbcL sequence；
Fig. 7 different system based on ITS sequence grows tree, and A. phyletic evolution based on ITS sequence NJ tree, B. is based on ITS
The phyletic evolution UPGMA tree of sequence；
Fig. 8 different system based on ITS2 sequence grow tree, A. phyletic evolution based on ITS2 sequence NJ tree, B. based on
The phyletic evolution UPGMA tree of ITS2 sequence.
Detailed description of the invention
The DNA bar code of the different base Radix Berberidis Amurensis of embodiment 1 is identified
One, experiment material and instrument
1 instrument
High speed refrigerated centrifuge (CF-RX II/CF-RX series, Hitachi's new and high technology (Shanghai) International Trading Company Ltd)；
Laboratory ultra-pure water instrument system (ELGA PURELAB Ultra, Shanghai Pu Song International Trading Company Ltd)；High pressure steam sterilization
Pot (MLS-3750, rich global (Beijing) bio tech ltd of wound)；Tissue grinder instrument (SCIENTZ-48, Ningbo Xin Zhisheng
Thing Science and Technology Co., Ltd.) WD-9413A gel image analyser, DYY-8C type electrophresis apparatus, DYC-33A type electrophoresis tank (Beijing
61 instrument plants)；Micropipettor (1-2,1-10,2-20,20-200,100-1000 μ l, eppenorf rearch plus)；
Electronic analytical balance (AR1530, prunus mume (sieb.) sieb.et zucc. Teller-torr benefit Instrument Ltd.)；Acidometer (PHS-25, Lida Instrument Factory, Shanghai)；
WH-2 type miniature vortex mixed instrument (WH-2, Shanghai Hu Xi analytical tool factory)；Medical refrigerator (HYC-360, Haier)；Medical
End temperature storage box (DW-25L262, Haier)；Electric heating constant temperature tank (DK-8D type, Shanghai is gloomy reliable tests Instrument Ltd.)；From
Heart pipe (2.0ml, 1.5ml Beijing Hong Yue new science and technology company limited).
2 materials
Primer, Tris, EDTA (Shanghai Sheng Gong bio-engineering corporation)；Plant genome DNA extracts box, and (sky, Beijing root is biochemical
Science and Technology Ltd.)；PCRmix, Taq enzyme (Beijing Tian Gen biochemical technology company limited)；(Beijing perseverance Austria is raw for Spain's agarose
Thing Science and Technology Ltd.)；GoodViewTM (succedaneum of ethidium bromide, Beijing SBS Genetech gene technology company limited).
19 kinds of Radix Berberidis Amurensis samples collected by this experiment come from the ground such as Qinghai, Sichuan, Gansu, through Chengdu University of Traditional Chinese Medicine
Fan Gang assistant researcher is accredited as the red pearl of thorn (Berberis dictyophylla Franch.), kansu barberry bark (Berberis
Kansuensis Schneid.), cadmium yellow Radix Berberidis Amurensis (Berberis diaphana Maxim.) and spoonleaf barbarry herb (Berberis
Vernae Schneid.), voucher specimen is stored in national medicine institute of Chengdu University of Traditional Chinese Medicine, and sample message is shown in Table 1, former plants
Fig. 1 is shown in by thing picture.
Table 1 Radix Berberidis Amurensis sample source
| Sequence number | Numbering | Original plant | Latin name | Locality | Acquisition time | Remarks |
| 1 | B.dictyophylla-1 | Sting red pearl | B.dictyophylla | Condor road, Xianggelila country, Yunnan Province | 2014.05.23 | Leaf |
| 2 | B.dictyophylla-2 | Sting red pearl | B.dictyophylla | Little Zhong Dian town, Xianggelila country, Yunnan Province | 2014.05.24 | Leaf |
| 3 | B.dictyophylla-3 | Sting red pearl | B.dictyophylla | Roadside, airport, Shangri-La, Yunnan Province county | 2014.05.23 | Peel of stem |
| 4 | B.dictyophylla-4 | Sting red pearl | B.dictyophylla | Mozhugongka County, Tibet Zha Xi Gang Xiang | 2014.08.25 | Leaf |
| 5 | B.dictyophylla-5 | Sting red pearl | B.dictyophylla | Si Cun township, Xianggelila country, Yunnan Province | 2014.05.23 | Peel of stem |
| 6 | B.kansuensis-1 | Kansu barberry bark | B.kansuensis | Area just outside a city gate town, Lintan County, Gansu Province | 2015.07.22 | Peel of stem |
| 7 | B.kansuensis-2 | Kansu barberry bark | B.kansuensis | Shu Bu township, Lintan County, Gansu Province | 2015.07.22 | Peel of stem |
| 8 | B.kansuensis-3 | Kansu barberry bark | B.kansuensis | Big Tong County, Qinghai Province | 2014.08.16 | Leaf |
| 9 | B.kansuensis-4 | Kansu barberry bark | B.kansuensis | Master mountain, big Tong County, Qinghai Province | 2014.08.16 | Peel of stem |
| 10 | B.kansuensis-5 | Kansu barberry bark | B.kansuensis | Qu Ku township, Tongren County, Qinghai Province, China | 2014.08.17 | Leaf |
| 11 | B.kansuensis-6 | Kansu barberry bark | B.kansuensis | Mai Xiu township, Zeku County, Qinghai Province | 2014.08.18 | Leaf |
| 12 | B.kansuensis-7 | Kansu barberry bark | B.kansuensis | Daofu County, state, Szechwan Ganzi | 2014.07.26 | Leaf |
| 13 | B.diaphana-1 | Cadmium yellow Radix Berberidis Amurensis | B.diaphana | Hezuo City, Gansu Province | 2015.07.20 | Peel of stem |
| 14 | B.diaphana-2 | Cadmium yellow Radix Berberidis Amurensis | B.diaphana | Qi Che village, Zhuoni County, Gansu Province | 2015.07.23 | Peel of stem |
| 15 | B.diaphana-3 | Cadmium yellow Radix Berberidis Amurensis | B.diaphana | Mai Xiu township, Zeku County, Qinghai Province | 2014.08.18 | Peel of stem |
| 16 | B.diaphana-4 | Cadmium yellow Radix Berberidis Amurensis | B.diaphana | Qinghai Province Men Yuanxian flower ditch | 2014.08.20 | Peel of stem |
| 17 | B.vernae-1 | Spoonleaf barbarry herb | B.vernae | Treasure-house township, big Tong County, Qinghai Province | 2014.08.13 | Peel of stem |
| 18 | B.vernae-2 | Spoonleaf barbarry herb | B.vernae | Wang Geertang town, Xiahe County, Gansu Province | 2015.07.21 | Peel of stem |
| 19 | B.vernae-3 | Spoonleaf barbarry herb | B.vernae | Dao Gao township, Zhuoni County, Gansu Province | 2015.07.22 | Peel of stem |
Two, experimental technique
1, PCR primer design and synthesis
Separately designing primer sequence according to core ITS fragment and chloroplast rbcl gene as shown in table 2, sequence is biological by giving birth to work
Engineering (Shanghai) limited company synthesizes.
Table 2 primer sequence and amplification program
2, prepared by template
Take dry Radix Berberidis Amurensis plant sample about 50mg, with high-flux tissue ball milling instrument (Xinzhi Biotech Co.,
Ningbo, China) grind 120s with 50Hz frequency, use core separation liquid to wash 3 times, each 800 μ L, remove supernatant, stay precipitation.
Use plant tissue DNA to extract test kit (Beijing Tian Gen biochemical technology company limited) again and extract medical material STb gene.
3, PCR amplification
PCR reaction system is 25 μ L, including 2 × Tag PCR Mix (Beijing Ai De comes Bioisystech Co., Ltd) 12.5 μ
L, each 1 μ L of forward and reverse primer (10 μMs), DNA profiling (200-300ng) 2-3 μ L, remaining volume is with dd H2O supplements.PCR expands
Condition sees table 2.
4, result detection
Amplification end measures PCR primer and takes 4 μ L, with 0.5 × TBE be electrophoretic buffer carry out gel electrophoresis (120V,
20min), expand successful product ABI 3730XL sequenator (Applied Biosystems Co., Foster,
California, USA) carry out two-way order-checking.
Use CodonCode Aligner v 3.7.1 (CodonCode Co., Centreville, Maryland, USA)
Order-checking peak figure is carried out quality check and correction and splicing, and removes low quality sequence and guiding region, comparison simultaneously desk checking sequence.
For ITS2 sequence, splicing uses HMMer based on hidden Markov model annotation method to remove two ends after obtaining concensus sequence
5.8S and 28S section obtains ITS2 spacer sequence.RbcL sequence is according to the annotation process on GenBank.By all acquisitions
ITS, ITS2, rbcL sequence MEGA v 6.0 (Center for Evolutionary Medicine and
Informatics, Tempe, Arizona, USA) carry out sequence analysis comparison, then based on Kimura 2parameter (K2P) mould
Type, to kind is interior and Genetic distance is analyzed (Align by Muslce), uses the distribution frequency of inbred genetic distance to comment
Valency Barcoding Gap, with adjacent neighbor-joining (NJ) method and non-weighting packeting average unweighted pair-
Group method with arithmetic (UPGMA) method constructing system clustering tree, the supporting rate of each branch uses
Bootstrap repeats to test for 1000 times.
Three, experimental result
Spacing analysis is planted in 1 sequence signature and kind
The length of each sequence, quantity, G/C content, the genetic distance and PCR identify that the information such as success rate refer to table 1-3, by
Data are it can be seen that the length of each sequence is in the range of 200-750bp, and wherein ITS2 is the shortest, for 253bp, find altogether after comparison
There are 7 variant sites, 7 kinds of haplotypes；ITS and rbcL is relatively long, respectively 616bp and 651bp, finds altogether after ITS comparison
Having 9 variant sites, 7 kinds of haplotypes, rbcL has 4 variant sites, 4 kinds of haplotypes.From sequence quantity, three kinds of sequences
Columns is consistent, and the average G/C content of ITS and ITS2 is all high than rbcL.ITS, ITS2 and rbcL sequence average plant in planting between based on
The genetic distance under K2P model is respectively 0.0063 (0-0.0131)/0.0222 (0-0.0148), and 0.0122 (0-0.0241)/
0.0078 (0-0.0282), 0 (0)/0.0030 (0-0.0062).
The sequence signature of table 3-1 Tibetan medicine based on ITS sequence Radix Berberidis Amurensis
The sequence signature of table 3-2 Tibetan medicine based on ITS2 sequence Radix Berberidis Amurensis
The sequence signature of table 3-3 Tibetan medicine based on rbcL sequence Radix Berberidis Amurensis
Table 3 result shows:
The average G/C content of kansu barberry bark based on ITS sequence relative to cadmium yellow Radix Berberidis Amurensis, sting the content of red pearl and spoonleaf barbarry herb relatively
Low, it is 51.95%, in the kind of 4 kinds of species, ultimate range is all higher than or equal to microspecies spacing.
The cadmium yellow average G/C content of Radix Berberidis Amurensis based on ITS2 sequence is the highest, is 56.13%, and the average G/C content of kansu barberry bark is relative
Relatively low, it is 55.73%；Stinging in the macrospecies of red pearl and spoonleaf barbarry herb distance more than microspecies spacing, remaining two species is
In macrospecies, distance is equal to microspecies spacing.
Thorn based on the rbcL sequence average G/C content of red pearl is the highest, is 44.33%, and kansu barberry bark is average with spoonleaf barbarry herb
G/C content is identical, is 43.93%, and in the macrospecies of 4 kinds of species, distance is respectively less than microspecies spacing.
2 variant sites analyses
Relatively ITS sequence haplotype can be seen that (Fig. 2), using kansu barberry bark as reference sequences, sting red pearl 6,206,
506,515,541,542,590, there is the change of T → C, T → C, G → T, G → A, A → C, T → C, C → G, C → G at 605bp respectively
Different, cadmium yellow Radix Berberidis Amurensis has identical variation with the red pearl of thorn at 6,206,506,541 and 542bp respectively, and spoonleaf barbarry herb is at 523bp
There is the variation of T → C.Although the haplotype of cadmium yellow Radix Berberidis Amurensis and kansu barberry bark is a kind of, but other two species all have with as it
Haplotype.As can be seen here, ITS sequence can not realize the discriminating of 4 kinds of Radix Berberidis Amurensis kinds.
Compare the haplotype (Fig. 3) of ITS2 sequence using kansu barberry bark as reference sequences, find to sting red pearl 143,152,
178,179,227, have the variation of G → T, G → A, A → C, A → C, C → G, C → G at 242bp respectively, cadmium yellow Radix Berberidis Amurensis 143,
Having the variation of G → T, A → C, A → C at 178 and 179bp respectively, spoonleaf barbarry herb has the variation of T → C at 159bp.Result table
Bright, 4 kinds of variant sites that Radix Berberidis Amurensis is the most stable based on ITS2 sequence, each species can not well be distinguished.
Relatively rbcL sequence haplotype can be seen that (Fig. 4), all has stable or changeable variation position in different plant species sequence
Point, can be that the qualification of species provides reference information: using cadmium yellow Radix Berberidis Amurensis as reference sequences, compare all lists of rbcL sequence times
Type, finds that stinging red pearl has the variation of T → C at 393bp, for stinging the stable variant sites of red pearl；Kansu barberry bark 253,398,
The variation of G → T, T → G, G → T is had respectively at 609bp, wherein, 398, be the stable variant sites of kansu barberry bark at 609bp；Spoon
Leaf Radix Berberidis Amurensis only has the variation of G → T at 253bp.As can be seen here, rbcL sequence can realize the discriminating of 4 kinds of Radix Berberidis Amurensis kinds.
3Barcoding Gap checks
Preferably between DNA bar code kind, hereditary variation should be significantly greater than genetic variation, and exists between
Difference, forms an obvious spacer, i.e. barcoding gap.In macrospecies, distance is as abscissa, microspecies spacing
Doing figure for vertical coordinate, each point represents different base species, is distributed in the region of more than 1:1 line explanation and there is barcoding
Gap, is distributed on 1:1 line and in area below, explanation does not has barcoding gap.From fig. 5, it can be seen that based on ITS
With ITS2 sequence sting red pearl and spoonleaf barbarry herb respectively in the region of no barcoding gap, kansu barberry bark and cadmium yellow Radix Berberidis Amurensis are equal
On 1:1 line, result shows, between kind based on ITS and ITS2 sequence, hereditary variation is the poorest with genetic variation
Different；And 4 kinds of Radix Berberidis Amurensis main flow kinds of based on rbcL sequence are all on 1:1 line.Therefore, compared with ITS, ITS2 sequence, rbcL
Sequence has of a relatively high identification rate.
4 phylogenetic tree analyses
Use different clustering methods neighbour's combined techniques (NJ) and non-weighting average method in groups herein
(UPGMA) phylogenetic tree construction, finds systematic evolution tree (the UPGMA side that different sequence builds based on K2P distance
Method), the discriminating situation of the most homotactic species can be represented more intuitively.Find that rbcL sequence shows by 3 kinds of sequences of contrast
Go out the highest determination rates: 4 kinds of Radix Berberidis Amurensis main flow kinds (stinging red pearl, kansu barberry bark, spoonleaf barbarry herb and cadmium yellow Radix Berberidis Amurensis) all can be each
Autohemagglutination is one, can identify it completely, and result is shown in Fig. 6-8.And the determination rates of ITS, ITS2 sequence is relatively low,
The species identification to 4 kinds of Radix Berberidis Amurensis can not be realized.As can be seen here, sequence rbcL can be used for above-mentioned 4 kinds of Radix Berberidis Amurensis main flow kinds
Origin identification.
To sum up, experimental result illustrates, rbcL sequence may be used for distinguishing the Radix Berberidis Amurensis of different base, and conserved sequence ITS
Then cannot distinguish between with ITS2 sequence.
Wherein, the rbcL bar code sequence (SEQ ID NO:3) of cadmium yellow Radix Berberidis Amurensis is:
AACCATGTCTTGATTACTGTTTAGCCTGTGCTTTATAAAGTGCTTCGGCACAAAATAGGAAACGGTCGC
GCCAACGCATAAATGGTTGGGAGTTCACGTTCTCATCATCCTTGGTAAAATCAAGTCCACCACGGAGACATTCATAA
ACCGCTCTACCATAGTTCTTAGCGGATAATCCCAATTTTGGTTTAATAGTACATCCTAATAGGGGACGACCATACTT
GTTCAATTTATCTCTCTCAACTTGGATGCCATGAGGCGGGCCTTGGAAAGTTTTAACATAAGCAGGAGGAATTCGCA
GATCCTCCAGACGTAGAGCGCGCAGCGCTTTGAACCCAAAAACATTACCCACAATAGAGGTAAACATGTTAGTAACA
GAACCTTCTTCAAAAAGGTCTAAAGGATAGGCTACATAACAAATATATTGATTGTCTTCTCCAGCAACGGGCTCAAT
GTGGTAGCATCGTCCTTTGTAACGATCAAGATTGGTAAGTCCATCGGTCCACACAGTTGTCCATGTACCCGTAGAAG
ATTCGGCAGCTACAGCGGCCCCTGCTTCTTCCGGTGGAACTCCGGGTTGAGGAGTTACTCGGAATGCTGCCAAGATA
TCAGTATCTTTGGTTACATAGTCAGGAGTATAATAAGTCAATTTGTAATCTTTAACACCCGCTTTGAATCCAACACT
TGCTTTAGTCTCTGTTTGGGGGGGGAAAAAAAATAA
The rbcL bar code sequence (SEQ ID NO:4) stinging red pearl is:
GGTCTTTGATTACCTGTTTCGCCTGTGCTTTAAAAAGTGCTTCGGCACAAAATAGGAAACGGTCGCGCC
AACGCATAAATGGTTGGGAGTTCACGTTCTCATCATCCTTGGTAAAATCAAGTCCACCACGGAGACATTCATAAACC
GCTCTACCATAGTTCTTAGCGGATAATCCCAATTTTGGTTTAATAGTACATCCTAATAGGGGACGACCATACTTGTT
CAATTTATCTCTCTCAACTTGGATGCCATGAGGCGGGCCTTGGAAAGTTTTAACATAAGCAGGAGGAATTCGCAGAT
CCTCCAGACGTAGAGCGCGCAGCGCTTTGAACCCAAAAACATTACCCACAATAGAGGTAAACATGTTAGTAACAGAA
CCTTCTTCAAAAAGGTCTAAAGGATAGGCTACATAACAAATATATTGACTGTCTTCTCCAGCAACGGGCTCAATGTG
GTAGCATCGTCCTTTGTAACGATCAAGATTGGTAAGTCCATCGGTCCACACAGTTGTCCATGTACCCGTAGAAGATT
CGGCAGCTACAGCGGCCCCTGCTTCTTCCGGTGGAACTCCGGGTTGAGGAGTTACTCGGAATGCTGCCAAGATATCA
GTATCTTTGGTTACATAGTCAGGAGTATAATAAGTCAATTTGTAATCTTTAACACCCGCTTTGAATCCAACACTTGC
TTTAGTCTCTGTGTGGGGGGGGGACCTATAAA
The rbcL bar code sequence (SEQ ID NO:5) of kansu barberry bark is:
TTCTGGTAAAAGTCTTGATACCTGTTTAGCCTGTGCTTTAAAAGTGCTTCGGCACAAAATAGGAAACGG
TCGCGCCAACGCATAAATGGTTGGGAGTTCACGTTCTCATCATCCTTGGTAAAATCAAGTCCACCACGGAGACATTC
ATAAACCGCTCTACCATAGTTCTTAGCGGATAATCCCAATTTTGGTTTAATAGTACATCCTAATAGGGGACGACCAT
ACTTGTTCAATTTATCTCTCTCAACTTGGATGCCATGAGGCGGGCCTTGGAAAGTTTTAACATAAGCAGTAGGAATT
CGCAGATCCTCCAGACGTAGAGCGCGCAGCGCTTTGAACCCAAAAACATTACCCACAATAGAGGTAAACATGTTAGT
AACAGAACCTTCTTCAAAAAGGTCTAAAGGATAGGCTACATAACAAATATATTGATTGTCGTCTCCAGCAACGGGCT
CAATGTGGTAGCATCGTCCTTTGTAACGATCAAGATTGGTAAGTCCATCGGTCCACACAGTTGTCCATGTACCCGTA
GAAGATTCGGCAGCTACAGCGGCCCCTGCTTCTTCCGGTGGAACTCCGGGTTGAGGAGTTACTCGGAATGCTGCCAA
GATATCAGTATCTTTGGTTACATAGTCAGGAGTATAATAATTCAATTTGTAATCTTTAACACCCGCTTTGAATCCAA
CACTTGCTTTAGTCTCTGTGTGGGGGGGGAAAAAAAA
The rbcL bar code sequence (SEQ ID NO:6) of spoonleaf barbarry herb is:
GTCATTGATACCTGTTTAGCCTGTGCTTTAAAAGTGCTTCGGCACAAAATAGGAAACGGTCGCGCCAAC
GCATAAATGGTTGGGAGTTCACGTTCTCATCATCCTTGGTAAAATCAAGTCCACCACGGAGACATTCATAAACCGCT
CTACCATAGTTCTTAGCGGATAATCCCAATTTTGGTTTAATAGTACATCCTAATAGGGGACGACCATACTTGTTCAA
TTTATCTCTCTCAACTTGGATGCCATGAGGCGGGCCTTGGAAAGTTTTAACATAAGCAGTAGGAATTCGCAGATCCT
CCAGACGTAGAGCGCGCAGCGCTTTGAACCCAAAAACATTACCCACAATAGAGGTAAACATGTTAGTAACAGAACCT
TCTTCAAAAAGGTCTAAAGGATAGGCTACATAACAAATATATTGATTGTCTTCTCCAGCAACGGGCTCAATGTGGTA
GCATCGTCCTTTGTAACGATCAAGATTGGTAAGTCCATCGGTCCACACAGTTGTCCATGTACCCGTAGAAGATTCGG
CAGCTACAGCGGCCCCTGCTTCTTCCGGTGGAACTCCGGGTTGAGGAGTTACTCGGAATGCTGCCAAGATATCAGTA
TCTTTGGTTACATAGTCAGGAGTATAATAAGTCAATTTGTAATCTTTAACACCCGCTTTGAATCCAACACTTGCTTT
AGTCTCTGTTGGGGGGGGAATAAAAGG
Embodiment 2 detection kit of the present invention and detection method
Whole components, content and using method in test kit of the present invention are as follows:
One, the composition of test kit
PCR amplifing reagent (50 sample part):
Including 2 × Tag PCR Mix (Aidlab Biotechnologies Co., Ltd, Beijing, China) 12.5 μ
L, each 1 μ L of forward and reverse primer, DNA profiling 2-3 μ L, remaining volume is with dd H2O supplements.PCR amplification condition sees table 2.
| Component | Concentration | Volume |
| Tag PCR Mix | 2× | 625μl |
| Forward primer | 10μM | 50μl |
| Reverse primer | 10μM | 50μl |
| dd H<sub>2</sub>O | 500μl |
Standard DNA sample (50 sample part)
Two, test kit using method
1) DNA extraction
Take dry Radix Berberidis Amurensis plant sample about 50mg, with high-flux tissue ball milling instrument (Xinzhi Biotech Co.,
Ningbo, China) grind 120s with 50Hz frequency, use core separation liquid to wash 3 times, each 800 μ L, remove supernatant, stay precipitation.
Use plant tissue DNA to extract test kit (Tiangen Biotech Co., Beijing, China) again and extract medical material STb gene.
2) PCR amplification
PCR reaction system is 25 μ L, including 2 × Tag PCR Mix (Aidlab Biotechnologies Co., Ltd,
Beijing, China) 12.5 μ L, each 1 μ L of forward and reverse primer (10 μMs), DNA profiling (200-300ng) 2-3 μ L, remaining volume with
dd H2O supplements.
Reaction condition: 95 DEG C of degeneration 4min；94 DEG C of 30s, 55 DEG C of annealing 1min, 72 DEG C of extension 1min, 35 circulations；72℃
Extend 10 minutes.
PCR primer detects: the agarose gel electrophoresis with 2% detects PCR primer, observes the effect of PCR reaction, and determines
Its amount added in subsequent reactions as template.
3) detection
Amplification end measure PCR primer 4 μ L, with 0.5 × TBE be electrophoretic buffer carry out gel electrophoresis (120V,
20min), expand successful product ABI 3730XL sequenator (Applied Biosystems Co., Foster,
California, USA) carry out two-way order-checking.
4) authentication method:
Sequencing result is carried out manual check and correction, sequence assembly, and compare with the sequence of aforesaid four kinds of DNA standard sample
Right, if homology is more than 99%, i.e. can determine whether that testing sample is the kind consistent with standard sample.
To sum up, the test kit of present invention offer and method can effectively expand the rbcL sequence of different base Radix Berberidis Amurensis, and
The nucleotide sequence of the amplified fragments that different base Radix Berberidis Amurensis obtain is different, it is possible to effectively identify the Radix Berberidis Amurensis of different base, consumption
Time short, detection quickly, has a good application prospect.
Claims (9)
1. four kinds of genetic fragments: it is characterized in that: its nucleotide sequence is respectively as shown in SEQ ID NO:3～6.
2. pair of primers pair, it is characterised in that: it is the primer pair as shown in SEQ ID NO:1～2.
3. the reagent that amplification comprises nucleotide sequence such as SEQ ID NO:3～6 shown 4 kinds of genetic fragments identifies Radix Berberidis Amurensis in preparation
Purposes in the reagent of base.
Purposes the most according to claim 3, it is characterised in that: described amplifing reagent includes shown in SEQ ID NO:1～2
Primer pair.
5. the detection kit identifying Radix Berberidis Amurensis base, it is characterised in that: it includes that amplification comprises nucleotide sequence such as SEQ
ID NO:3～the reagent of 6 shown 4 kinds of genetic fragments.
Test kit the most according to claim 5, it is characterised in that: described amplifing reagent includes shown in SEQ ID NO:1～2
Primer pair.
7. according to the test kit described in claim 5 or 6, it is characterised in that: it also includes four kinds of genes described in claim 1
Fragment.
8. the method identifying Radix Berberidis Amurensis base, it is characterised in that: comprise the steps:
A, extracts sample DNA: extract the DNA in sample to be checked；
B, gene amplification: the DNA treated in sample basis is expanded with the primer described in claim 2；
C, result detects: detect DNA cloning result.
Method the most according to claim 8, is characterised by: in step c, and the method detecting DNA cloning result is:
Comparison amplified fragments and four kinds of genetic fragments described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610499262.6A CN106086197A (en) | 2016-06-29 | 2016-06-29 | A kind of test kit identifying Radix Berberidis Amurensis base and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610499262.6A CN106086197A (en) | 2016-06-29 | 2016-06-29 | A kind of test kit identifying Radix Berberidis Amurensis base and method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086197A true CN106086197A (en) | 2016-11-09 |
Family
ID=57213928
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610499262.6A Pending CN106086197A (en) | 2016-06-29 | 2016-06-29 | A kind of test kit identifying Radix Berberidis Amurensis base and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086197A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355300A (en) * | 2018-11-26 | 2019-02-19 | 成都中医药大学 | Coptis SDIR transcription factor is improving the application in plant drought |
-
2016
- 2016-06-29 CN CN201610499262.6A patent/CN106086197A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| YANG HE等: "Identification of two chemotypes of pogostemon cablin(Blanco) benth.through DNA barcodes", 《Z NATURFORSCH C》 * |
| 付涛等: "高等植物DNA条形码最新研究进展及其应用", 《核农学报》 * |
| 程希婷等: "DNA条形码研究进展", 《基因组学与应用生物学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355300A (en) * | 2018-11-26 | 2019-02-19 | 成都中医药大学 | Coptis SDIR transcription factor is improving the application in plant drought |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN104404129B (en) | DNA bar code differentiates rabdosia lophanthide and its method closely belonged to | |
| CN107287300B (en) | A kind of DNA for differentiating 9 kinds of Dalbergia timber combines bar code and its discrimination method and application | |
| CN103484558B (en) | Molecular identification method of Yunnan manyleaf Paris rhizome | |
| CN104017899A (en) | Verification method of sea horses | |
| Zhu et al. | Genetic and chemical diversity of Eleutherococcus senticosus and molecular identification of Siberian ginseng by PCR-RFLP analysis based on chloroplast trnK intron sequence | |
| Zheng et al. | Development, identification, and application of a germplasm specific SCAR Marker for Dendrobium officinale Kimura et Migo | |
| CN103667525A (en) | Fast detection kit and method of strawberry mottle virus | |
| CN104830969B (en) | A kind of pseudo-ginseng molecular identity card and authentication method | |
| CN104404629B (en) | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara | |
| CN105002272A (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN105543373B (en) | Glycyrrhiza Uralensis, glycyrrhiza glabra, swollen fruit Radix and its Hybrid rapid molecular identification method | |
| Wang et al. | Identification and poisoning diagnosis of Aconitum materials using a genus-specific nucleotide signature | |
| CN104611424B (en) | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product | |
| CN107630102B (en) | PCR identification kit and identification method for radix paeoniae alba | |
| CN106086197A (en) | A kind of test kit identifying Radix Berberidis Amurensis base and method | |
| CN103710463A (en) | Rapid detection kit and method of strawberry mild yellow edge virus | |
| CN103436523A (en) | Method for establishing analysis immune library spectra based on random primer barcode technology | |
| CN112980988B (en) | Asarum molecular identity card and application thereof | |
| CN105483223B (en) | Molecular identification method of purple kidney tea | |
| CN104673881A (en) | High flux sequencing technology-based traditional Chinese medicine preparation biological component analysis method | |
| CN106755431A (en) | A kind of method for identifying cynomorium songaricum | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| Alasmari | DNA-barcoding of some medicinal plant species in Saudi Arabia using rbcL and matK genes. | |
| CN105296483A (en) | Primer, kit and method for identifying walnut bark beetles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |
|
| RJ01 | Rejection of invention patent application after publication |