CN106755431A - A kind of method for identifying cynomorium songaricum - Google Patents
A kind of method for identifying cynomorium songaricum Download PDFInfo
- Publication number
- CN106755431A CN106755431A CN201611233472.7A CN201611233472A CN106755431A CN 106755431 A CN106755431 A CN 106755431A CN 201611233472 A CN201611233472 A CN 201611233472A CN 106755431 A CN106755431 A CN 106755431A
- Authority
- CN
- China
- Prior art keywords
- sequence
- cynomorium songaricum
- seq
- dna
- songaricum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method for identifying cynomorium songaricum, methods described includes extracting genome DNA from sample；It is template with the DNA for extracting, is expanded to entering performing PCR using for expanding the specific primer of ITS sequence；PCR primer is sequenced；And sequence alignment and cluster analysis, drawing system development tree are carried out to sequencing result；According to sequence alignment and/or cluster analysis result identification cynomorium songaricum kind.The present invention provide utilization ITS sequence differentiate cynomorium songaricum method, operation is simple, can reach easily and fast, purpose that is objective, accurately distinguishing cynomorium songaricum and other pseudo- kinds.Compared with traditional Morphological Identification method, the gene order that the present invention is obtained is conducive to the identification of cynomorium songaricum kind.
Description
Technical field
It is more particularly to a kind of to identify cynomorium songaricum kind using ITS sequence the present invention relates to a kind of method for identifying cynomorium songaricum kind
Method, belong to plant species identification technology field.
Technical background
Cynomorium songaricum (Cynomorium songaricum Rupr) is Cynomoriaceae holoparasite seed plant, and multiparasitization is in zygophyllaceae
Nitraria plant root[1], cynomorium songaricum be distributed mainly on China Qinghai, Gansu, Xinjiang, the Inner Mongol, Ningxia etc. area half-desert or
Desert belt[2], medicinal part is the fleshy stem that it removes inflorescence, and the important medicinal material commonly used in being, in anaesthetic as kidney tonifying, is helped
Sun, strengthening the essence, ease constipation medicine, cure mainly impotence and seminal emission, soreness and weakness of waist and knees, dry constipation of intestines[3].In recent years, due to cynomorium songaricum price it is continuous on
Rise, occur in medicinal material market glutinous rehmannia (Rehmannine Radix), Rehmannia henryi N. E. Brown (Rehmannia henryi N.E.Brown),
The mixed adulterants such as decomposite leaf glutinous rehmannia (R.piasezkii Maxim)[4], in addition, cynomorium songaricum is often used as saline cistanche (Cistanches again
Herba adulterant) is used[5], had a strong impact on Chinese medicine uses safety.
DNA bar code is the technology that using the genetic fragment of standard species are carried out with Rapid identification, has been used successfully to life
Thing species taxonomy and identification, ecological, Molecular Phylogeny and evolve and the research field such as biodiversity assessment, be modern life
Thing research provides the data platform of abundant molecular information and standard, for Genetic Diversity detection provide it is more straight
Connect, more accurate method, i.e. direct detection sequence change in itself becomes maximally effective genetic analysis method at present[7-8]。
ITS sequence is located at ribosomal rRNA genes (rDNA) in higher plant, is the tandem sequence unit that height is repeated, by
18SrDNA, 5.8SrDNA, 26SrDNA and the gene the Internal Transcribed Spacer (ITS) between three constitute, and 18S, 5.8S,
The sequence of 26SrDNA is guarded very much, can enter performing PCR amplification, sequencing to ITS areas with the universal primer complementary with their sequences.
And the ITS section lengths of angiosperm are more stable, including including 5.8SrDNA, total length typically only has 600-700bp.It is wide
General to be applied to polant systematics research, the degree of its base sequence homology determines that the affiliation between biology is far and near[9-10]。
The cultivar identification of current cynomorium songaricum is only limitted to traditional Materia Medica Identification method, such as form, microstructure, ultra microstructure
With chemical fingerprint etc., but these traditional authentication methods have its own shortcoming.The sibling species similar for shape, medicine
The identification of material morphological characters is difficult to differentiate between, and phytomorph proterties is easily by geographical environment, growth period, storage requirement factors
Influence, so as to influence the accuracy of identification；Chemical analysis method can be subject to its physiological condition, adopt because of the content of active ingredient of Chinese herbs
Between the time receiving, storage etc. factor influence, while the species similar to chemical composition are also relatively difficult to differentiate between；The chemistry such as HPLC, CE, MS
Analysis Instrument equipment is expensive, and non-common laboratory can be born.By traditional morphological taxonomy method cynomorium songaricum mirror
Limitation is there is on not.
The content of the invention
For the defect for overcoming cynomorium songaricum to be identified on morphology, the present invention, will for the cynomorium songaricum authenticity that presently, there are
Bar codes technique is applied to discriminating cynomorium songaricum kind, by expanding ITS sequence and it being analyzed, them is inquired into from molecular level
Between affiliation, and then provide it is a kind of differentiate cynomorium songaricum nucleotide sequence and differentiate cynomorium songaricum method, from DNA molecular level
The hereditary feature of upper analysis cynomorium songaricum germ plasm resource, for identification cynomorium songaricum provides effective molecular labeling.
The ITS sequence length of rDNA is relatively short, for crude drug medicine materical crude slice, powder, sample, long-term storage Chinese medicine and sample
For the material of Partial digestion, ITS sequence shows PCR amplifications and sequencing efficiency higher to product DNA.In addition, ITS possesses two
Level structure, for cynomorium songaricum species differentiate the molecular conformation feature for providing uniqueness.The present invention differentiates Chinese medicine cynomorium songaricum with ITS sequence first
And its mixed adulterant, the method is easy to operate, consumption is few, practical, can fast and accurately distinguish cynomorium songaricum and its mixed puppet
Product, are suitable to wide popularization and application.
Specifically, the present invention provides the following：
1. a kind of method for identifying cynomorium songaricum, the described method comprises the following steps：
(1) genome DNA is extracted from sample；
(2) with the middle DNA for extracting of step (1) as template, using the specific primer for expanding ITS sequence to carrying out
PCR is expanded；
(3) PCR primer is sequenced；
(4) sequence alignment and cluster analysis, drawing system development tree are carried out to sequencing result；
(5) according to sequence alignment and/or cluster analysis result identification cynomorium songaricum kind.
2. the method according to 1, wherein, the ITS sequence is the rDNA ITS sequences of cynomorium songaricum, is to be located at cynomorium songaricum 18S
DNA sequence dna and 26S between.
3. the method according to 1, the nucleotide sequence of the ITS sequence is such as SEQ ID NO：Sequence shown in 1, or
With SEQ ID NO：Sequence shown in 1 is compared to the sequence with T627C mutation.
4. the method according to 1, the primer pair includes SEQ ID NO：2 and SEQ ID NO：Sequence shown in 3.
5. the method according to 1, the sequence alignment and cluster analysis are utilized respectively DNAMAN3.0, Mega5.0 software
Carry out.
6. a kind of molecular marked compound for identifying cynomorium songaricum, the molecular marked compound is cynomorium songaricum ITS sequence.
7. the molecular marked compound according to 6, the ITS sequence is the rDNAITS sequences of cynomorium songaricum, is to be located at cynomorium songaricum 18S
DNA sequence dna and 26S between.
8. the molecular marked compound according to 6, the nucleotide sequence of the ITS sequence is such as SEQ IDNO：Sequence shown in 1
Row, or with SEQ ID NO：Sequence shown in 1 is compared to the sequence with T627C mutation.
9. the molecular marked compound according to 6, the ITS sequence is by primer pair SEQ ID NO：2 and SEQ ID NO：3 expand
Increase.
10. it is a kind of identify cynomorium songaricum kit, it includes the primer pair for expanding ITS sequence, preferably described primer pair
Including SEQ ID NO：2 and SEQ ID NO：Sequence shown in 3.
Compared with prior art, beneficial effects of the present invention are embodied in：
The ITS sequence from cynomorium songaricum that the present invention is provided, can differentiate that cynomorium songaricum is analyzed by DNA level with comparing
The hereditary feature of cynomorium songaricum, effective molecular labeling is provided to distinguish cynomorium songaricum and its adulterant etc., is the kind authenticity of cynomorium songaricum
And screening improved seeds etc. are laid a good foundation.
Meanwhile, the method that the above-mentioned ITS sequence of utilization that the present invention is provided differentiates cynomorium songaricum, operation is simple, the side of can reach
Just purpose that is, quick, objective, accurately distinguishing cynomorium songaricum and other pseudo- kinds.Compared with traditional Morphological Identification method, the present invention
The gene order of acquisition is conducive to the identification of cynomorium songaricum kind.
Brief description of the drawings
Fig. 1 is cynomorium songaricum Research advance on electrophoretypes.
Wherein, M is Maker Trans 2K (Beijing Quanshijin Biotechnology Co., Ltd), and swimming lane numbering represents cynomorium songaricum sample
Product are originated：1：Zhangye；2：Plateau；3：Guazhou County；4：Respectful north；5：Delingha；6：Golmud；7：Guide.
Fig. 2 is the electrophoresis pattern of the product using primer pair PCR of the invention amplification cynomorium songaricum specimen materials.Wherein, M is
Trank2K (Beijing Quanshijin Biotechnology Co., Ltd), swimming lane numbering represents cynomorium songaricum sample source：1：Zhangye；2：Plateau；3：
Guazhou County；4：Respectful north；5：Delingha；6：Golmud；7：Guide.
Fig. 3 is different sources cynomorium songaricum material ITS sequence comparison result figure.
Fig. 4 is different sources cynomorium songaricum material ITS sequence cluster analysis result figure.
Fig. 5 is the PCR primer electrophoresis pattern of saline cistanche, glutinous rehmannia and cynomorium songaricum.Wherein, M is Trank2K (the full Shi Jinsheng in Beijing
Thing Technology Co., Ltd.), swimming lane numbering represents cynomorium songaricum sample source：1-2：Saline cistanche；3-4：Glutinous rehmannia；5-6：Cynomorium songaricum (is produced in Zhangye
Ground)；7-8：Cynomorium songaricum (the plateau place of production)
Fig. 6 is the ITS sequence sequence alignment result figure of saline cistanche, glutinous rehmannia and cynomorium songaricum.Wherein zhangye：It is cynomorium songaricum (Zhangye
The place of production)；gaotai：It is cynomorium songaricum (the plateau place of production)；C.deserticola：Saline cistanche；R.glutinosa：Glutinous rehmannia.
Fig. 7 is the ITS sequence cluster analysis result figure of saline cistanche, glutinous rehmannia and cynomorium songaricum.Wherein C.songaricum-
zhangye：It is cynomorium songaricum (Zhangye place of production)；C.songaricum-gaotai：Cynomorium songaricum (the plateau place of production)；C.deserticola：Meat
Desert cistanche；R.glutinosa：Glutinous rehmannia.
Specific embodiment
Further describe the present invention with reference to specific embodiment, advantages of the present invention and feature will be with description and
It is apparent.But these embodiments are only preferences of the invention, any limitation is not constituted to the scope of the present invention.This area
Technical staff can be changed to the details of technical solution of the present invention and form without departing from the spirit and scope of the invention
With improvement, each fall within protection scope of the present invention.
Embodiment 1
The present embodiment determine from 7 rDNA ITS sequences of place of production cynomorium songaricum (Zhangye, plateau, Guazhou County, Su Bei,
Delingha, Golmud, Guide), step is as follows：
1st, the collection and treatment of sample
, as the material for extracting genomic DNA, cut into using ripe cynomorium songaricum succulent stem (locality collection) raw then
It is put into after fraction fragment in the hermetic bag made by blotting paper, and is placed in the drying box equipped with silica gel and is dried.
2nd, the extraction of genome DNA
Using the new quick-speed plant genome DNA extracting reagent kit (centrifugation of the Tyke Bioisystech Co., Ltd of Beijing hundred
Column type) (DP3111)
(1) Buffer P1 are placed on 65 DEG C of preheatings, use preceding addition beta -mercaptoethanol to final concentration 0.2%.
(2) Buffer P1 to 65 DEG C of preheating sterile deionized water is heated.
(3) 30mg or so cynomorium songaricum succulent stems are taken to be placed in 2ml centrifuge tubes, is fully ground in plant high-speed organization beveller
Clay into power.
(4) 65 DEG C of preheatings Buffer P1 (having added beta -mercaptoethanol to final concentration 0.2%) of 550ul and 4ul are added
RnaseA is acutely vortexed to shake and mixes 1min, and room temperature places 10min.
(5) the Buffer P2 of 130ul are added, is fully mixed, 12,000rpm centrifugation 3min.
(6) careful supernatant of drawing is careful not to be drawn onto boundary material to a splitter A, and 12,000rpm are centrifuged 1min,
Collect lower liquid.
(7) add the Buffer P3 of 1.5 times of volumes to be softly vortexed at once, fully mix.
(8) (adsorbed in the mixture (including the precipitation being likely to occur) obtained by previous step being added into an adsorption column AC
Post is put into collecting pipe) 12,000rpm centrifugation 1min, outwell the waste liquid in collecting pipe.
(9) 700ul rinsing liquids WB (first check whether and added absolute ethyl alcohol), 12,000rpm centrifugation 1min is added to discard
Waste liquid.
(10) 500ul rinsing liquids WB, 12,000rpm centrifugation 1min are added, waste liquid is discarded.
(11) adsorption column AC is put back in sky collecting pipe, 13,000rpm centrifugation 3-5min remove rinsing liquid as far as possible, in order to avoid
Residual ethanol suppresses downstream reaction in rinsing liquid.
(12) adsorption column AC is taken out, is put into a clean centrifuge tube, add 50ul to wash in the middle part of adsorbed film
De- buffer solution EB (elution buffer is heated in 65-70 DEG C of water-bath in advance), room temperature places 3-5min, 12,000rpm centrifugations
1min collects DNA.- 20 DEG C of the DNA sample placement of collection is standby.
3rd, the detection of cynomorium songaricum genome quality
The quality for carrying cynomorium songaricum genome is detected with 1.0% agarose gel electrophoresis, electrophoresis 120V runs glue 30min.As a result
As shown in figure 1, DNA extraction effects are good, genome is complete, meets next experiment required.
4th, PCR amplifications
By document analysis and experimental study, cynomorium songaricum karyogene ITS, i.e., the DNA sequences positioned between 18S and 28SrRNA are chosen
Column-slice section designs the pcr amplification primer thing of cynomorium songaricum ITS in the present invention as testing goal sequence.
Shown in forward primer Primer F and reverse primer Primer R be respectively shown in it is as follows：
Primer F：5’GGAAGTAAAAGTCGTAACAAGG3’(SEQ ID NO：2)
Primer R：5’TCCTCCTCCGCTTATTGATATGC 3’(SEQ ID NO：3)
Total genomic dna with the extraction of above-mentioned steps 1 and 2 carries out pcr amplification reaction as template：
PCR reaction systems are as follows：
PCR response procedures are：94 DEG C of predegenerations 5min, 94 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 1min40s,
35 circulations, 72 DEG C of extension 7min, 4 DEG C of preservations.
PCR primer is detected
PCR product detects whether Successful amplification candidate sequence by 1.2% agarose gel electrophoresis, takes
The PCR product of 7ul, DNA Maker loadings 7ul, 120v, 30min.As shown in Fig. 2 result shows, each PCR is produced result
Thing size meets in 750bp with expection.
PCR product sequencings
Pcr amplification product is directly sent to Sangon Biotech (Shanghai) Co., Ltd. carries out two-way sequencing, to protect
Demonstrate,prove the accuracy of data.Sequencing result finds that seven ITS sequences of place of production cynomorium songaricum are substantially completely consistent, only the cynomorium songaricum in Zhangye with
Other area exist a variant sites, wherein, from plateau, Guazhou County, Su Bei, Delingha, Golmud, Guide cynomorium songaricum sample
2nd, 3,4,5,6,7 nucleotide sequence such as SEQ ID NO：Shown in 1.
5th, DNA sequence data analysis
It is right using Contig Express softwares (InforMax, Frederick, Md.) according to rDNA ITS sequencing results
Sequencing result is spliced, BioEdit softwares (Carlsbad, CA) removal primer and uncertain sequence, using DNAMAN3.0
(Lynnon Corporation, Quebec, Canada) software carries out sequence alignment, sequence alignment result as shown in figure 3, utilizing
MEGA softwares (version 5.0, www.megasoftware.net), drawing system development tree, cluster result 4 institute as shown in the figure
Show.The ITS sequence of different sources cynomorium songaricum does not have difference, only exists a variant sites, and homology is almost in being 100%.Zhangye
City's sample is completely the same with ncbi database cynomorium songaricum ITS sequence, and other regional sample ITS sequences only exist base with it
Difference.
Embodiment 2
With the stem tuber that plant material is replaced with saline cistanche and glutinous rehmannia of differing only in of embodiment 1, sample meat is obtained
Desert cistanche and the genomic DNA of glutinous rehmannia.Expanded by PCR and obtain its ITS sequence, PCR product is coagulated by 1.2% agarose
Gel electrophoresis detect whether Successful amplification candidate sequence, take the PCR product of 7ul, DNA Maker loading 7ul, 120v,
30min.As shown in figure 5, result shows, each PCR primer size meets result in 750bp with expection.PCR primer is direct
Sending to Sangon Biotech (Shanghai) Co., Ltd. carries out two-way sequencing.The ITS sequence of gained glutinous rehmannia and Zhangye and plateau
Cynomorium songaricum contrasted and cluster analysis, sequence alignment result as shown in fig. 6, sequence alignment homology be more than 95%, can see
Make to derive from same species, such that it is able to distinguish different germ plasm resources according to comparison result, reach the purpose for differentiating cynomorium songaricum.It is poly-
As shown in fig. 7, the cynomorium songaricum homology 100% in Zhangye place of production and the plateau place of production, it is one to gather, saline cistanche gathers and is class result with glutinous rehmannia
One, but differed farther out with cynomorium songaricum homology, so as to be made a distinction with cynomorium songaricum.Result shows the sequence and lock of saline cistanche and glutinous rehmannia
There is significant difference in sun.To sum up, cynomorium songaricum can effectively be differentiated with the method for the present invention.
It can be seen that the ITS specific fragments that the present invention is developed are suitable as differentiating the bar code sequence of cynomorium songaricum kind, for
The use of specification cynomorium songaricum medicinal material is significant.
Bibliography
[1] Ma Jianbin, the chemical composition and pharmacological action [J] Qinghai Normal Universitys journal of all beautiful Rong's cynomorium songaricums：Natural section
Learn version, 2008,2008 (2)：72-75.
[2] Cui Shude, waits Chinese medicines complete works [M] Harbin：Heilungkiang science tech publishing house：1997：574-575.
[3] Chinese Pharmacopoeia, mono- .2005 of version [S] in 2005：241.
The crude drug of [4] Jiao Fugui, Yao Qiang glutinous rehmannia and its adulterant cynomorium songaricum differentiates [J] R＆D of modern TCM with practice, 2000
(2)：21-21.
[5] Huang Min, Liu Gang saline cistanches study [J] Hubei Journal of Traditional Chinese Medicine, 2004,26 with the discriminating of its easily mixed product cynomorium songaricum
(6)：54-55.
[6] Hebert P D N, Cywinska A, Ball S L, et al.Biological
identificationsthrough DNA barcodes[J].Proceedings of the Royal Society B
BiologicalSciences, 2003,270 (1512)：313--321.
[7] Gao Lianming, Liu Jie, Cai Jie, wait on DNA of plants bar code investigative technique specification [J] plant classifications and money
Source journal, 2012,34 (6)：592-606.
[8] Pei Nancai, old step peak biologies DNA bar code：Development course, Research scale and function [J] are biological more within 10 years
Sample, 2013,21 (5)：616-627.
[9] Xie Hui, Chao Zhi, Huo Keke, wait the ribosomes ITS sequence of .9 kind Bupleunim. Ls and its in Med Mat Appreciation
Using [J] Nanfang Medical Univ journal, 2006,26 (10)：1460-1463.
[10] Zhao Huan, Wu Wei, Zheng Youliang, wait rDNAs ITS sequence to analyze the application in medicinal plants study
Precious traditional Chinese medical science traditional Chinese medicines, 2009,20 (4) during [J]：959-962.
SEQUENCE LISTING
<110>China Environmental Science Research Institute
<120>A kind of method for identifying cynomorium songaricum
<130> IB168734
<160> 3
<170> PatentIn version 3.1
<210> 1
<211> 658
<212> DNA
<213> C.songaricum
<400> 1
ttgaaacttg catagcagtg caactggggt aacctgtagc gttaagcggg gtgagatgtg 60
ggcaacctgt tgggcctcac tcttgccctt tcgccgaaga agctccaagt gtctcgcttc 120
taaaactttc gagacatgcg tgtgttctct tgggcgtgta acaaattccg gcgcgaacag 180
cgtcaaggca tactagaagt ggcacgcgcg tgcgccacga aacggttgca cgcgtgatgc 240
gatttggaat ctcaaggact ctcgacaacg gatatcttgg ctcttgcatc gatgaagaac 300
gtagcgaaat gcgatacttg gtgtgaattg cagaatcccg tgaaccatcg agtatttgaa 360
cgcaagttgc gcccaaggcc tgtgggtcga gggcacatct gcctgagtgt cactcaatgt 420
gctgctgctt cctttcgatt ctcaattatt tgaggtgcat tgtaagaagc gttctgttgg 480
cctcccttgt cgctgcaaag gttggctcaa aagcttcatt gtgagcggta agtctgcaca 540
ttcactggtg ggtagtaagg cttgtccctt attgtggtgt ttgtgtctgg tccctcactt 600
ttccctaggc cctgtaaggt cttcaactgg ccccttcatt gcgacctcag gtcaggtg 658
<210> 2
<211> 22
<212> DNA
<213>Artificial sequence
<400> 2
ggaagtaaaa gtcgtaacaa gg 22
<210> 3
<211> 23
<212> DNA
<213>Artificial sequence
<400> 3
tcctcctccg cttattgata tgc 23
Claims (10)
1. a kind of method for identifying cynomorium songaricum, the described method comprises the following steps：
(1) genome DNA is extracted from sample；
(2) DNA with extraction in step (1) expands entering performing PCR as template using for expanding the specific primer of ITS sequence
Increase；
(3) PCR primer is sequenced；
(4) sequence alignment and cluster analysis, drawing system development tree are carried out to sequencing result；
(5) according to sequence alignment and/or cluster analysis result identification cynomorium songaricum kind.
2. method according to claim 1, wherein, the ITS sequence is the rDNA ITS sequences of cynomorium songaricum, is to be located at cynomorium songaricum
DNA sequence dna between 18S and 26S.
3. method according to claim 1, the nucleotide sequence of the ITS sequence is such as SEQ ID NO：Sequence shown in 1
Row, or with SEQ ID NO：Sequence shown in 1 is compared to the sequence with T627C mutation.
4. method according to claim 1, the primer pair includes SEQ ID NO：2 and SEQ ID NO：Sequence shown in 3.
5. method according to claim 1, the sequence alignment and cluster analysis are utilized respectively DNAMAN3.0, Mega5.0
Software is carried out.
6. a kind of molecular marked compound for identifying cynomorium songaricum, the molecular marked compound is cynomorium songaricum ITS sequence.
7. molecular marked compound according to claim 6, the ITS sequence is the rDNA ITS sequences of cynomorium songaricum, is to be located at lock
DNA sequence dna between positive 18S and 26S.
8. molecular marked compound according to claim 6, the nucleotide sequence of the ITS sequence is such as SEQ ID NO：1 institute
The sequence shown, or with SEQ ID NO：Sequence shown in 1 is compared to the sequence with T627C mutation.
9. molecular marked compound according to claim 6, the ITS sequence is by primer pair SEQ ID NO：2 and SEQ ID
NO：3 amplifications.
10. it is a kind of identify cynomorium songaricum kit, it includes the primer pair for expanding ITS sequence, and preferably described primer pair includes
SEQ ID NO：2 and SEQ ID NO：Sequence shown in 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611233472.7A CN106755431A (en) | 2016-12-27 | 2016-12-27 | A kind of method for identifying cynomorium songaricum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611233472.7A CN106755431A (en) | 2016-12-27 | 2016-12-27 | A kind of method for identifying cynomorium songaricum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106755431A true CN106755431A (en) | 2017-05-31 |
Family
ID=58921384
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611233472.7A Pending CN106755431A (en) | 2016-12-27 | 2016-12-27 | A kind of method for identifying cynomorium songaricum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106755431A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834446A (en) * | 2017-01-06 | 2017-06-13 | 中国医学科学院药用植物研究所 | A kind of authentication method of cynomorium songaricum of being adulterated in saline cistanche product |
| CN109576390A (en) * | 2018-12-26 | 2019-04-05 | 中国环境科学研究院 | A method of identification overlord |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586398A (en) * | 2015-08-13 | 2016-05-18 | 北京工商大学 | Method for identifying aloe vera species with ITS sequence |
-
2016
- 2016-12-27 CN CN201611233472.7A patent/CN106755431A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586398A (en) * | 2015-08-13 | 2016-05-18 | 北京工商大学 | Method for identifying aloe vera species with ITS sequence |
Non-Patent Citations (4)
| Title |
|---|
| GAUBE.F等: "Cynomorium songaricum voucher Herbasin, Ch. 040801H349 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence", 《GENBANK DATABASE》 * |
| 候典元等: "中药材锁阳的ITS2条形码分子鉴定研究", 《中国中药杂志》 * |
| 李振华等: "基于ITS序列位点特异性PCR的肉苁蓉与其混伪品的鉴别研究", 《中国中医杂志》 * |
| 李金博等: "15个白三叶品种的ISSR和ITS遗传多样性分析", 《草业科学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834446A (en) * | 2017-01-06 | 2017-06-13 | 中国医学科学院药用植物研究所 | A kind of authentication method of cynomorium songaricum of being adulterated in saline cistanche product |
| CN109576390A (en) * | 2018-12-26 | 2019-04-05 | 中国环境科学研究院 | A method of identification overlord |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104404129B (en) | DNA bar code differentiates rabdosia lophanthide and its method closely belonged to | |
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN105483282B (en) | One group of PCR specificity diagnostic primers and its method for identifying paris polyphylla | |
| CN104450905B (en) | A kind of Chinese mesona herb and the DNA identification method of rabdosia lophanthide | |
| CN103849687A (en) | Molecular biological identification method of fritillaria taipaiensis | |
| CN106834467A (en) | A kind of DNA bar code method for identifying molecules of earthworm | |
| US20210207226A1 (en) | Dna barcoding-based method for rapid identification of lycium chinensis | |
| CN104404629B (en) | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara | |
| CN108265123B (en) | Kit and method for identifying paris polyphylla genuine product and different genotypes | |
| CN104073550B (en) | A kind of SCAR molecular marker differentiating Fructus Momordicae sex | |
| CN106755431A (en) | A kind of method for identifying cynomorium songaricum | |
| CN111004860B (en) | Primer for identifying atractylodes medicinal species by chloroplast gene and application thereof | |
| CN105002272B (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN104762370B (en) | The nucleotide sequence and method of Chinese Taxus kind and kind are distinguished in identification | |
| CN101445827B (en) | Nucleotide sequence and method for identifying radix cyathulae genunie medicinal materials | |
| CN105177151B (en) | A kind of DNA bar code primer pair, kit and method for differentiating Chinese yew kind | |
| CN106244694A (en) | Two kinds of restricted enzyme of application realize fungus mirror method for distinguishing simultaneously | |
| CN112143826B (en) | SSR molecular marker primer for identifying liquorice producing area, method and application | |
| CN107475359A (en) | A kind of DNA bar code authentication method of integration of drinking and medicinal herbs medicinal material spina date seed and its mixed adulterant | |
| CN105200130B (en) | The bar code identification method and its primer special of Michigan clavibacter difference subspecies | |
| CN102134604B (en) | Marker and method for identifying single nucleotide polymorphism of bostrichthys sinensis group | |
| CN105274245A (en) | Method for authenticating polygonatum cyrtonema and special primer pair thereof | |
| NL2029315B1 (en) | Method for identifying cynomorium songaricum rupr | |
| CN105821128A (en) | SNP marker of medicinal plant murraya paniculata as well as identifying method and application thereof | |
| CN103266171B (en) | Molecular fingerprint identification method of ferula ferulaeoides and congeneric sibling species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170531 |
|
| RJ01 | Rejection of invention patent application after publication |