CN104404629B - DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara - Google Patents
DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara Download PDFInfo
- Publication number
- CN104404629B CN104404629B CN201410189583.7A CN201410189583A CN104404629B CN 104404629 B CN104404629 B CN 104404629B CN 201410189583 A CN201410189583 A CN 201410189583A CN 104404629 B CN104404629 B CN 104404629B
- Authority
- CN
- China
- Prior art keywords
- rabdosia
- sequence
- species
- plant
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention provides a gene pool containing rbcL gene sequence fragments of labiate Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara. The invention also provides a method for identifying plant species of the labiate Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara. The method comprises the step of comparing a rbcL gene or its sequence fragment of a plant sample, plant species of which is to be identified, to the gene pool provided by the invention. The invention also provides an application of the rbcL gene or its sequence fragment in identifying the labiate Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara and the labiate Isodon serra(Maxim.)Kudo. It proves that the rbcL sequence is general, is easy to amplify and compare, and has good amplification and identification effects on the labiate Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara and the labiate Isodon serra(Maxim.)Kudo.
Description
Technical field
The invention belongs to plant species identification field, specifically, the present invention relates to the species of rabdosia lophanthide, Rabdosia lophanthoides
Discrimination method.
Background technology
Chinese medicine rabdosia lophanthide is Guangdong Fujian one band resident's tradition medication, and its removing dampness through diuresis and removing jaundice, for hepatitis, acute and chronic gall-bladder
The treatment of the diseases such as inflammation, dysentery, and eat as cold tea daily health caring.
In Chinese medicine circle, the name of Part of Chinese Medicinal and its base, that is, Plant Taxonomy name is inconsistent.Chinese medicine rabdosia lophanthide is just
There is this situation, the Chinese medicine rabdosia lophanthide that folk tradition uses is that [Latin is entitled for labiate Rabdosia lophanthoides
Rabdosia lophanthoides (buch.-ham.ex d.don) h.hara or isodon striatus (benth.)
Kudo] and its mutation fine flower Rabdosia amethystoides [Latin entitled rabdosia lophanthoides (buch.-ham.ex d.don)
H.hara var.graciliflora (benth.) h.hara or lsodon lophanthoides (buch.-ham.ex
d.don)h.hara var.graciliflora(benth.)h.hara]；Simultaneously as there is no Specification, in medicinal material
Labiate rabdosia lophanthide [Latin entitled isodon serra (maxim.) kudo or rabdosia serra is had on market
(maxim.) h.hara] confuse use；In addition, the base of the rabdosia lophanthide included in related science monograph and provincial standard monograph is not
Unanimously, all contradictory part of the discriminating of the determination with regard to base and kind: " conventional Chinese herbal medicine handbook ", " Guangdong Chinese veterinarian commonly uses
Herbal medicine ", the local Chinese medicine standard in " national Chinese herbal medicine compilation " (first volume), " dictionary of medicinal plant " and Guangdong, Guangxi, Hunan etc.,
The base being all recited as rabdosia lophanthide is Rabdosia lophanthoides isodon lophanthoides (buch.-ham.ex d.don)
Hara), wherein " Guangdong Province's Chinese medicine standard " second is simultaneously by plant rabdosia lophanthide rabdosia serra (maxim.)
H.hara includes into as one of base, but in plant differentiates, rabdosia lophanthide rabdosia serra (maxim.)
Some crude drugs features of h.hara are not inconsistent standardization, and (present patent application " rabdosia lophanthide " described below refers to labiate
Rabdosia lophanthide [Latin entitled isodon serra (maxim.) kudo or rabdosia serra (maxim.) h.hara], rather than
Chinese medicine rabdosia lophanthide).
Plant rabdosia lophanthide and Rabdosia lophanthoides are two kinds under dicotyledon Labiatae, on fresh plant both
On the morphological appearance such as stem, leaf, difference is big, but after drying or segment, both are difficult to differentiate.It is usually in the Chinese medicine of market circulation
Dry product.Effectively discrimination method can distinguish plant rabdosia lophanthide and Rabdosia lophanthoides, can provide in the establishment research of base again
Portion of techniques means.
Discrimination method currently for both plants and medicine materical crude slice has the sides such as Characters Identification, Microscopic Identification and physics and chemistry identification
Method.These prior arts are high to the experience dependency degree of operating personnel, and the theoretical foundation of conventional identification method builds on taxon
Analysis of properties and characteristics, these properties and characteristicses are the phenotypes being closely related with environment, are easily subject to such environmental effects when differentiating
And the restriction at sample morphology and material position, error occurs.
The kind true and false of Chinese medicine differentiates to be directly connected to drug safety and clinical efficacy.Therefore, at present in the urgent need to providing
Being capable of precise Identification rabdosia lophanthide plant species, the new method so as to help accurate medication.
Molecular biology identification is that application dna molecular marking technique comes the former plant of Identification chinese herbs medicine and its medicinal material and medicine materical crude slice at present
New method.In brief, from the point of view of molecular genetic angle, the phenotype of species should trace back to the difference of genotype after all
Different, i.e. difference in dna sequence.Therefore, the comparative studies to genome sequence difference is plant classification and identification provides
Foundation the most essential.
In recent years, with the development of Protocols in Molecular Biology, dna molecular marking technique is widely used in medicinal plant heredity
Diversity, systematics, means of taxonomic research, and gradually penetrate into the identification field of Chinese herbal medicine, promote Chinese herbal medicine identification research
Development., as the carrier of hereditary information, information content is big, in the interior genetic stability with height of the same race, and is not subject to for dna molecule
Outside environmental elements and the impact of biological development stage and organ-tissue difference, therefore use dna characterization of molecules as genetic marker
Carry out Chinese herbal medicine and differentiate have more accurately and reliably, be highly suitable for the plant mirror of sibling species, confusion varieties kind, rare kind etc.
Fixed.
The molecular marking technique being presently used for Chinese herbal medicine identification mainly has " RFLP " (rflp) skill
Art, " random amplified polymorphic dna " (rapd) technology, " microsatellite " (ssr) technology, issr labelling technique, " expanding fragment length is many
State property " (aflp) technology etc., and dna bar codes technique (dna barcoding).Wherein, the identification of dna bar code is molecule mirror
Fixed latest developments, its be defined as using in genome one section of recognised standard, relatively short dna fragment carries out to species
Quickly and accurately identify and identification molecular diagnosis new technology.It is advantageous that, only need one or a few suitable gene piece
Section accurately can be differentiated to most species of whole genus, section；Differentiate speed faster；Repeatability and stability are high；
Experimentation is simplified, standardization, is more easy to realize the automation of species discriminating.Dna bar code identification technology is traditional discriminating side
Effective supplement of method, is capable of the standardization of Chinese medicine base identification, contributes to alleviating the present situation of conventional identification talent shortage.
When using dna bar codes technique plant identification, the screening of dna bar code and determination are important rings.Generally,
The screening of dna bar code has following standard: the short-movie section of (1) standard；(2) enough variations to be had can to separate species, inter-species
Diversity ratio is larger, is convenient for the differentiation planted with plant, in kind, sequence variations are as far as possible little, so that inter-species and intraspecific variablity have one
Distinct defines；(3) two sections of sequence is relatively conservative, the design to facilitate primer.
Make its Successful amplification in default of universal primer, most of single copy genes of plant nucleus gene group are interior with theirs
It is eliminated as the candidate of bar code containing son first.Researcher is separately had to propose, internal transcription space its and its2 of core dna
Then it is likely to become potential dna bar code sequence.And, the research of the gene of Chloroplast gene and its introne finds,
The noncoding region of psba-trnh and its are used for identifying multifarious angiosperm thing possibly as potential dna bar code sequence
Kind.It has also been proposed that matk gene can identify flowering plant as general bar code, and matk and psba-trnh is both
It is applied to myristicaceae plant.Therefore, so far, for the dna bar code being applied to plant identification, successively propose at present
The sequence such as matk, psba-trnh, rbcl, rpoc1, rpob, matk, its2, but neither one bar code can be in all plants
It is suitable in thing section genus kind.
Some researchers existing attempt being used for identifying rabdosia lophanthide by dna molecular biological variety identification method, such as using rapd skill
Art is being identified.Rapd technology is second generation molecular marking technique, does not have dna bar codes technique stable.And although research
Person constantly improves application in plant species identification for the dna bar codes technique, but due to also having been reported that any one at present
Dna bar code can be suitable for the discriminating of all plants, therefore to specific plant species it is still necessary to carry out experiment to search out conjunction
Suitable gene order uses as dna bar code.
Based on above-mentioned situation, at present such as will be using dna bar codes technique come to labiate Rabdosia lophanthoides and lip
Section plant rabdosia lophanthide carries out precise Identification, needs the dna bar code that may use is screened, finds optimal gene sequence
Row are as dna bar code.
Content of the invention
It is an object of the present invention to provide being best suitable for differentiating the dna bar code of rabdosia lophanthide and Rabdosia lophanthoides, that is, specific
Dna sequence.
It is a further object of the invention that having determined that the rabdosia lophanthide of species, Rabdosia lophanthoides (include mutation fine by collection
Flower Rabdosia amethystoides) original producton location multiple sample, set up the dna bar code gene pool of rabdosia lophanthide, Rabdosia lophanthoides.
A further object of the present invention is, by by the genetic fragment of new measuring samples and this dna bar code gene pool
Compare, set up the discrimination method of this unknown sample.
It is a further object of the invention to provide this dna bar code or gene pool are in rabdosia lophanthide and Rabdosia lophanthoides
Purposes.
The concrete technical scheme of the present invention is as follows:
On the one hand, the present inventor is through many experiments, with regard to rabdosia lophanthide, Rabdosia lophanthoides (including mutation fine flower Rabdosia amethystoides)
The screening of dna bar code gene, filters out from its2, matk, psba-trnh, rbcl4 sequence and is best suitable for rabdosia lophanthide and line
The dna bar code of the discriminating of line Rabdosia amethystoides, i.e. the sequence fragment of rbcl gene or rbcl gene.
Rbcl gene code 1,5- diphosphoribulose carboxylase/oxidizing ferment large subunit, positioned at cpdna (plant chloroplast
Genome) single greatly copy area, be always about 1400bp, be to apply one of most common gene in plant molecular systematics research.
Although evolutionary rate in different plant groups for the rbcl gene has larger difference, generally speaking relatively conservative, for planting
Thing provides important proterties source compared with the systematic growth research of high-class rank unit.The present inventor finds through screening study, phase
There is general, easy amplification, easily compare than in other genes such as its2, matk, psba-trnh, rbcl sequence.And
And, although existing document shows that the variation of rbcl is primarily present in kind of a level above, on species level, generally variation is not big,
The inventors discovered that, in labiate Rabdosia lophanthoides and labiate rabdosia lophanthide, rbcl gene has good amplification
Property and identification result, can be used for differentiating above-mentioned plant species as dna bar code.
Therefore, the present invention provides rbcl gene or its sequence fragment differentiating labiate Rabdosia lophanthoides in this regard
With the purposes in labiate rabdosia lophanthide.Wherein, described rbcl gene order fragment is preferably by being used as using following sequences
Primer expands from the genome dna of plant sample to be identified and obtains: seq id no.42 and seq id no.43.
On the other hand, the invention provides including the gene of the rbcl gene order fragment of rabdosia lophanthide and Rabdosia lophanthoides
Storehouse.Specifically, gather the multiple sample in rabdosia lophanthide and Rabdosia lophanthoides original producton location first, with plant traditional taxonomy method mirror
Not respective species, then extract its genome dna respectively, with its genome dna as template, using specific primer sequence, excellent
Select seq id no.42 and seq id no.43 to expand the rbcl gene order fragment of sample, thus set up and include rabdosia lophanthide and line
The gene pool of the rbcl gene order fragment of line Rabdosia amethystoides.Described gene pool includes the rbcl gene sequence shown in following sequence numbers
Column-slice section: seq id no.1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,
24、25、26、27、28、29、30、31、32、33、34、35、36、37、38、39、40、41.Wherein, seq id no.1-8 be with
Plant traditional taxonomy method is accredited as rabdosia lophanthide sample respective rbcl gene order fragment；Seq id no.9-15 is to plant
Thing traditional taxonomy method is accredited as Rabdosia lophanthoides sample respective rbcl gene order fragment；Seq id no.16-41 is
Rabdosia lophanthoides (mutation fine flower Rabdosia amethystoides) sample respective rbcl gene order piece is accredited as with plant traditional taxonomy method
Section.
Another aspect, the invention provides the discrimination method of rabdosia lophanthide and Rabdosia lophanthoides plant species, methods described bag
Include the step that the rbcl gene of plant to be identified or its sequence fragment are compared with gene pool mentioned above.Concrete and
Speech, methods described comprises the steps:
1) extract the genome dna of plant to be identified；
2) with step 1) the genome dna that obtains as template, amplification rbcl gene or its sequence fragment；
3) by step 2) gene pool that provided with the present invention of the rbcl gene that obtains or its sequence fragment is compared, thus
Differentiate the species of described plant to be identified.
In the discrimination method that the present invention provides, step 1) in can using any Plant Genome dna extracting method or
Commercial extraction kits are carried out.According to the specific embodiment of the present invention, take the sample such as blade of plant to be identified, use
75% ethanol water dries after cleaning surface, weighs 5mg-2g, after liquid nitrogen grinding, with Plant Genome dna extracts reagent
Box is extracted.
Step 2) in can be carried out using the condition of any amplifiable rbcl gene or its sequence fragment.According to the present invention's
Specific embodiment, when expanding the rbcl gene order fragment of plant sample to be identified, its primer and the following institute of amplification condition
Show:
Primer
Seq id no.42 (positive): atgtcaccacaaacagagactaaagc
Seq id no.43 (reverse): gtaaaatcaagtccaccrcg
Reaction system
Extaqmix25 μ l, each 1.0 μ l of upstream and downstream primer, dna masterplate 3.0 μ l, plus sterile purified water are to 50 μ l
Response procedures
95 DEG C, 4min；94 DEG C of -30s, 55 DEG C of -1min, 72 DEG C of -1min, 35 circulations；72℃-10min
Detection, sequencing and result treatment
Take agarose gel electrophoresis method for detecting detection pcr product.After electrophoresis, pcr product should be in corresponding dna bar code sequence
A purpose band in row extension position, and negative control should no band.The sample having pcr amplified band is sent sequencing company to enter
Row dna sequencing, carries out two-way sequencing using dna sequenator to purpose band, pcr amplimer is as sequencing primer.Survey
Sequence result adopts sequence assembly software codoncode align er v2.06 (codoncode co, usa) check and correction splicing, removes
Low quality sequence and guiding region, sequence direction should be consistent with pcr amplification forward primer direction.
In step 3) in, by step 2) gene pool that provided with the present invention of the rbcl gene that obtains or its sequence fragment entered
When row compares, the corresponding species of similarity highest or matching degree highest or genetic distance minimum are the species of plant to be identified.
The phase between multiple sequences can be obtained by comparing between existing sequence in the sequence of plant to be identified and gene pool
Like property, draw its species classification.Blast analysis, Furthest Neighbor, tree building method are all based on the method that sequence alignment differentiates species.
According to the specific embodiment of the present invention, by the base of the rbcl gene order fragment of sample to be identified and this gene pool
Because fragment is compared two-by-two, the multiple minimums between existing multiple sequences in the sequence of acquisition plant to be identified and gene pool
In variation value, then the kind of the rabdosia lophanthide with having calculated that and Rabdosia lophanthoides, maximum variation value compares, and carries out result judgement.As:
According to embodiment 1, in the kind of rabdosia lophanthide rbcl gene and Rabdosia lophanthoides rbcl gene, maximum variation value is respectively " 0.2 "
" 0 ", using the computer software of sequence alignment, such as matgat2.01, mega5, vector nti suite assembly alignx
Deng treating comparing two-by-two one by one between multiple sequences of the Rabdosia lophanthoides in the sequence and gene pool of differential plant, obtain many
Minimum variation value between individual sequence, these values are equal to 0, then corresponding to species is Rabdosia lophanthoides；Equally treated using computer software
Compare two-by-two one by one between multiple sequences of the rabdosia lophanthide in the sequence and gene pool of differential plant, obtain minimum between multiple sequences
Variation value, these values are equal to or less than 0.2, then corresponding to species is rabdosia lophanthide.
Specifically, first, the rbcl obtaining from sample to be identified gene order fragment peak figure file is imported
Codoncode aligner v3.7 is spliced, then hand inspection splicing effect, forward and reverse including (1) adjustment sequence
(edit reverse complement), (2) remove primer or other border sequences (sample trim vector ...),
(3) check remaining base mass value (qual needs more than or equal to 20), finally deriving concensus sequence is standard bar code data.So
Afterwards, this standard bar code data is imported sequence alignment program together with the data of the gene pool of rbcl gene order fragment
(matgat2.01), select default scoring matrix (scoring matrix:blosum50) to carry out multiple alignment (align), protect
Deposit result of calculation (similarity table), numerical value retains one decimal place, lattice according to needed for subsequent software taxongap
(two txt files, one is species name catalogue, and one is species dna sequence alignment result, i.e. similitude square for formula adjustment
Battle array).Next, checking identification result using software taxongap2.4.1.Import species name catalogue in software main interface
(files data files load), imports species dna sequence alignment result under biomarker option
(biomarker add load save), other minor parameters refer to software document and are configured.After runs software
(run execute) obtains result, in the suitable in figure of txt file, checks measuring samples sequence and rabdosia lophanthide, strain line scented tea
Dish (including mutation fine flower Rabdosia amethystoides) each sample sequence corresponding respectively " inter-species minimum variation value " (assumes that sample to be identified is
One new species), if (i.e. " inter-species is for the minimum variation value between the sequence fragment of measuring samples sequence and rabdosia lophanthide each sample
Little variation value ") it is equal to or less than 0.2, you can judge this species to be checked as rabdosia lophanthide；If measuring samples and Rabdosia lophanthoides various kinds
Minimum variation value (i.e. " inter-species minimum variation value ") between the sequence fragment of product is 0, you can judge this species to be checked as strain line
Rabdosia amethystoides.
Can also be using such as following other methods, this several method is also by sequence alignment, comparison match degree or ratio
Relatively similitude etc., the ownership between confirmation species:
Blast analyzes
Dna bar code sequence (query sequence) and dna bar code data storehouse from unknown sample
(reference library) compares, if finding duplicate sequence in dna bar code data storehouse
(reference sequence), then unknown sample is exactly this corresponding species of reference sequence；Otherwise it is unknown
Sample does not exist in database.Available method below is identified further, in this case it is necessary to pay close attention to not
Know the species of the most related 10 sequences of sample dna bar code sequence, or frequency of occurrences highest species in comparison, can be by not
Know that sample is defined as a certain section and belongs to.The method also can directly be compared with genbank database simultaneously, with the utility whole world
Up-to-date nucleotides data-guiding identification.
Furthest Neighbor
Calculate unknown sample dna bar code sequence (query sequence) and each of database sequence
The genetic distance of (reference sequence), unknown sample should be with minimum average B configuration genetic distance (mean
Distance species) or the species with minimum genetic distance (nearest distance).The threshold value of genetic distance
(threshold) it is to determine during " building medicinal plant dna bar code identification platform ", in theory to same thing
Kind, sampling covers the individuality enough in its whole geographical distribution (different populations) and same population, and this threshold value can be accurate
Reflect the hereditary variation size of this species, be also beneficial to preferably determine the species of unknown sample, but consider research cost, one
As think that the sampling of same species preferably includes 5 population, 2 individualities of each population.
Tree building method
First application clustal carries out msa, is calculated from suitable genetic distance model (typically using k2p distance model) and plants
The interior genetic distance with inter-species, the phylogenetic tree such as software building nj, upgma, mp such as application mega or paup, check unknown sample
Together with the dna bar code sequence (query sequence) of product is clustered with sequence in database (reference sequence)
Species, species are further determined that according to cluster situation.
Alignment process in pairs
When still unknown sample can not be differentiated kind by above method, can by unknown sample with closely related 10
The reference sequence of species carry out in contrast with right, differentiate species by analyzing nucleotide variation site, or be judged as
Novel species, or it is judged as the species not yet included in reference library.
Compared to prior art, the present invention made following contribution and beneficial effect:
First, the present invention screens to the genetic barcode of rabdosia lophanthide, Rabdosia lophanthoides and fine flower Rabdosia amethystoides, from
The dna being best suitable for differentiating rabdosia lophanthide and Rabdosia lophanthoides is filtered out in its2, matk, psba-trnh, rbcl4 gene order
Bar code, i.e. rbcl gene or its sequence fragment.Compared to other genes, rbcl sequence has general, easy amplification, easily compares
Feature.Although and, existing document shows that the variation of rbcl is primarily present in kind of a level above, species level generally makes a variation not
Enough big, this experimental studies have found that, in labiate Rabdosia lophanthoides with labiate rabdosia lophanthide, it has good amplification
Property and identification result.
Second, the present invention through collection rabdosia lophanthide, many parts of Rabdosia lophanthoides (include mutation fine flower Rabdosia amethystoides) original producton location
Sample, has obtained including the gene pool of rbcl genetic fragment, thus establishing the standard rbcl sequence of rabdosia lophanthide, Rabdosia lophanthoides
Gene pool.
3rd, based on above-mentioned discovery, the present invention has also set up the discrimination method of fresh sample, including by new sample to be identified
Compare with the genetic fragment of this gene pool, judge the species of fresh sample.Especially by inter-species variation value in calculating kind；Right
Rabdosia lophanthide in gene pool and Rabdosia lophanthoides sequence, have calculated maximum in rabdosia lophanthide and the respective kind of Rabdosia lophanthoides
Between variation value and two species inter-species minimum variation value, when the genetic fragment of new sample to be identified and this gene pool carry out by
After individual comparison two-by-two, obtain the minimum variation value (i.e. " inter-species minimum variation value ") between multiple sequences, these values are equal to or less than
In the kind of certain species having calculated that, maximum variation value, can be considered and its same species.This discrimination method can differentiate rabdosia lophanthide,
The herb of Rabdosia lophanthoides, organ and medicine materical crude slice.Compared to the existing discrimination method of rabdosia lophanthide and Rabdosia lophanthoides, the side of the present invention
The integrated degree that method has for sample requires low, the advantage that identification beacon can quantify.
Brief description
Hereinafter, to describe embodiment of the present invention in detail in conjunction with accompanying drawing, wherein:
Fig. 1 shows the dna bar code authentication method design sketch that the present invention provides, and it is adopted with plant species as classification
Taxongap method.Wherein inter-species minimum variation value is shown as dark bars；In kind, maximum variation value is shown as light bar, and rs represents thing
Plant rabdosia lophanthide, rlvg represents species fine flower Rabdosia amethystoides, rl represents species Rabdosia lophanthoides.
Specific embodiment
Referring to specific embodiment, the present invention to be described.It will be appreciated by those skilled in the art that these embodiments are only
For the present invention is described, it limits the scope of the present invention never in any form.
Experimental technique in following embodiments, if no special instructions, is conventional method.Medicine used in following embodiments
Material raw material, reagent material etc., if no special instructions, are commercially available purchase product.
Embodiment 1The foundation of the gene pool of the screening of dna bar code and inclusion rbcl gene order fragment
The present embodiment is with regard to the dna bar code base of rabdosia lophanthide, Rabdosia lophanthoides and Rabdosia lophanthoides (mutation fine flower Rabdosia amethystoides)
The screening of cause, filters out from its2, matk, psba-trnh, rbcl4 sequence and is best suitable for rabdosia lophanthide and Rabdosia lophanthoides
The dna bar code differentiating, i.e. rbcl gene order fragment.Additionally, the present embodiment establishes including rabdosia lophanthide and Rabdosia lophanthoides
Rbcl gene order fragment gene pool.
1 instrument, material and reagent
1.1 material
In 7 sampled points (Guangdong, Fujian), have collected rabdosia lophanthide, Rabdosia lophanthoides and Rabdosia lophanthoides (the mutation fibre fragrance of a flower
Tea dish) totally 41 parts of samples, details see table 1.Following bar code screening experiments are with plant leaf blade as material.
Table 1 sample message table
1.2 reagent and instrument
Employ Plant Genome dna extracts kit (Beijing Tiangeng Bioisystech Co., Ltd)；10×pcr
Buffer buffer solution, tris alkali (Shanghai Ai Zite bio tech ltd)；(takara is precious raw for taq dna polymerase, dntp
Thing engineering (Dalian) Co., Ltd)；Pcr amplimer synthesizes (Hua Da gene)；D-37520 type desk centrifuge (Germany
Eppendorf company)；Ptc-100 type pcr instrument (mj research company of the U.S.)；Ddy- type electrophoresis apparatus (Beijing 61 instrument
Device factory)；Gel imaging system (bio-rad company of the U.S.).
2 methods
The extraction of 2.1dna
After material is collected, it is dried with variable color silica gel.Take about 100mg plant tissue during experiment, after liquid nitrogen grinding, use
Plant Genome dna extracts kit is extracted.This experimental plant genome dna extracts all using " Tiangeng " Plant Genome
Dna extracts kit (centrifugation column type catalog number (Cat.No.): dp305), concrete operation step is as follows:
1) take fresh tissues of plants about 100mg or dry weight tissue about 30mg, add liquid nitrogen to be fully ground.
2) ground powder is quickly transferred to be pre-loaded with (real in the centrifuge tube of l65 DEG C of preheating buffer solution gp1 of 700 μ
Add mercaptoethanol in the gp1 of preheating so as to final concentration of 0.1%) before testing, overturn rapidly and mix, centrifuge tube is placed on 65
DEG C water-bath 20 minutes, during water-bath, reverse centrifuge tube is to mix sample for several times.
3) add 700 μ l chloroforms, fully mix, 12000rpm (～13400*g) is centrifuged 5 minutes.
4) carefully previous step gained upper strata aqueous phase is proceeded in a new centrifuge tube, adds 700 μ l buffer solution gp2,
Fully mix.
5) liquid of mixing is proceeded in adsorption column cb3,12000rpm (～13400*g) is centrifuged 30 seconds, discards waste liquid.
6) 500 μ l buffer solution gd are added in adsorption column cb3,12000rpm (～13400*g) is centrifuged 30 seconds, outwells useless
Liquid, adsorption column cb3 is put in collecting pipe.
7) 700 μ l rinsing liquid pw are added in adsorption column cb3,12000rpm (～13400*g) is centrifuged 30 seconds, outwells useless
Liquid, adsorption column cb3 is put in collecting pipe.
8) 500 μ l rinsing liquid pw are added in adsorption column cb3,12000rpm (～13400*g) is centrifuged 30 seconds, outwells useless
Liquid, adsorption column cb3 is put in collecting pipe.
9) adsorption column cb3 is put back in collecting pipe, 12000rpm (～13400*g) is centrifuged 2 minutes, outwells waste liquid.To inhale
Attached column cb3 is placed in room temperature and places several minutes, thoroughly to dry remaining rinsing liquid in sorbing material.
10) adsorption column cb3 is proceeded in a clean centrifuge tube, to the hanging dropping in the middle part 100 μ l of adsorbed film
Elution buffer te, room temperature places 2-5 minute, and 12000rpm (～13400*g) is centrifuged 2 minutes, and solution is collected centrifuge tube
In.
2.2pcr amplification
Plant group dna is extracted product and is carried out pcr amplification, and primer is purchased from treasured by Hua Da gene chemical synthesis, the raw material such as dna polymerase
Bioengineering (Dalian) Co., Ltd.Concrete primer sequence, reaction system and response procedures are as shown in table 2 below.
Table 2 primer sequence, reaction system and response procedures
2.3 sequencing
Pcr amplified production transfers to Hua Da gene sequencing (partial sequence is sequenced) by Ji Diao company, obtains sequencing peak figure.Peak figure
Quality standard is that all base mass values (qv) are more than 20, that is, more than 99% accuracy.
2.4 data processing
Sequencing result adopts sequence assembly software codoncode aligner v3.7 (codoncode co, usa) to proofread
Splicing, removes low quality sequence and guiding region, obtains all standard bar code data.All standard bar code data will be obtained lead
Enter sequence alignment program (matgat2.01), select default scoring matrix (scoring matrix:blosum50) to carry out multiple
Compare (align), preserve result of calculation (similarity table) (numerical value reservation one decimal place), according to subsequent software
(two txt files, one is species name catalogue to the adjustment of taxongap desirable format, and one is species dna sequence alignment knot
Really, i.e. similarity matrix), carry out identification result analysis using software taxongap2.4.1.
3. conclusion
3.1 each sequence successful rate statistics
Sample amounts to 41 parts, and the result after gene extracts, expands and is sequenced shows: its2 sequence success 36
Bar, matk sequence success 29, psba-trnh sequence success 37, rbcl sequence 41 (being shown in Table 1) of success.With rbcl sequence
Sequencing success rate is up to 100%, easy-to-use in practical operation.
3.2 Sequence Identification effects
Carry out interpretation of result under software taxongap2.4.1.Import species name catalogue in software main interface
(files data files load), imports species dna sequence alignment result under biomarker option
(biomarker add load save), other minor parameters refer to software document and are configured.After runs software
(run execute) obtains result.As shown in figure 1, maximum in the corresponding kind of species under the conditions of certain mark (biomarker) become
Light bar length value on different value (heterogeneity) i.e. schematic diagram, corresponding inter-species minimum variation value
(separability) i.e. dark bars length value on schematic diagram.If maximum variation value (heterogeneity) in the kind of species
Value less than inter-species minimum variation value (separability), then means that two species can distinguish.In Fig. 1, rs is rabdosia lophanthide
Abbreviation, rl is the abbreviation of Rabdosia lophanthoides, and rlvg is the abbreviation of fine flower Rabdosia amethystoides.Result in Fig. 1 shows, for its2 sequence
Row, the internal maximum variation of planting of rabdosia lophanthide is worth for 4.8, and the maximum variation of Rabdosia lophanthoides and fine fragrance of a flower tea colza inside is worth and is
1.4, rabdosia lophanthide is worth for 15.1 with the minimum variation of Rabdosia lophanthoides inter-species；For psba-trnh sequence, inside the kind of rabdosia lophanthide
Big mutation rate value is 3.9, and maximum variation in Rabdosia lophanthoides and fine fragrance of a flower tea colza is worth for 0；Rabdosia lophanthide and Rabdosia lophanthoides inter-species
Minimum variation is worth for 25.4；It is worth for 0.2 for variation maximum in the kind of rbcl sequence rabdosia lophanthide, Rabdosia lophanthoides and fine fragrance of a flower tea
In colza, maximum variation is worth for 0；Rabdosia lophanthide is worth for 1.4 with the minimum variation of Rabdosia lophanthoides inter-species.It is specifically shown in table 3 below.
Table 3 rabdosia lophanthide and variation value maximum in the kind of Rabdosia lophanthoides and inter-species minimum variation value
3.3 conclusion
3.3.1matk sequence success rate is relatively low, and the species being unsuitable for this experiment differentiate.
3.3.2 it is up to 100% with rbcl sequence success rate, and intraspecific variablity is minimum, is best suitable for for rabdosia lophanthide
Differentiate with Rabdosia lophanthoides.
3.3.3 " the maximum variation value in kind " of rabdosia lophanthide is 0.2；Rabdosia lophanthoides and fibre spend the " maximum in kind of Rabdosia amethystoides
Variation value " is all 0；Rabdosia lophanthide is 1.4 with Rabdosia lophanthoides (containing mutation fine flower Rabdosia amethystoides) " inter-species minimum variation value "；Strain line is fragrant
" the inter-species minimum variation value " of tea dish and fine flower Rabdosia amethystoides is 0, that is, belong to both undistinguishables of same kind.
3.3.4 can be seen that Rabdosia lophanthoides and fine flower Rabdosia amethystoides belong to a kind together and cannot be distinguished by according to experimental result, that is, newly
As long as the species coming identify and whether being rabdosia lophanthide or whether be Rabdosia lophanthoides, fine flower Rabdosia amethystoides need not be directed to again and reflect
Not.
3.3.5 Rabdosia lophanthoides can not be distinguished with its mutation fine flower Rabdosia amethystoides；Rabdosia lophanthide and strain line scented tea can be differentiated
Dish, meets the needs for " Chinese medicine origin identification is to kind " for the Chinese medicine.
4rbcl sequence gene storehouse
Method as described above, with genome dna as template, using seq id no.42 and seq id no.43 conduct
The rbcl gene order fragment of each sample of primer amplification, thus sets up the rbcl gene sequence including rabdosia lophanthide and Rabdosia lophanthoides
The gene pool of column-slice section.Described gene pool includes the rbcl gene order fragment shown in following sequence numbers: seq id no.1,
2、3、4、5、6、7、8、9、10、11、12、13、14、15、16、17、18、19、20、21、22、23、24、25、26、27、28、29、
30、31、32、33、34、35、36、37、38、39、40、41.Wherein, seq id no.1-8 is with plant traditional taxonomy method
It is accredited as the rbcl gene order fragment of the sample of rabdosia lophanthide；Seq id no.9-15 is with the identification of plant traditional taxonomy method
Rbcl gene order fragment for the sample of Rabdosia lophanthoides；Seq id no.16-41 is with plant traditional taxonomy method mirror
It is set to the rbcl gene order fragment of the sample of Rabdosia lophanthoides (mutation fine flower Rabdosia amethystoides).
Embodiment 2Unknown rabdosia lophanthide, the discriminating of Rabdosia lophanthoides plant species
The method that the present embodiment is provided using the present invention is entered to the sample of unknown rabdosia lophanthide and Rabdosia lophanthoides plant species
Go discriminating.
Select doubtful but not identified, rabdosia lophanthide and Rabdosia lophanthoides, fresh or herb after drying, it is divided into two parts,
A traditional taxonomy method is identified.Another uses method therefor in the present invention to differentiate.
The preparation of samples of method therefor in the present invention: in addition to special indicating, medicinal material uses 75% ethanol water to clean table
Dry behind face, weigh 5mg～2g blade standby.
Genome dna in plant tissue blade is extracted using step described in embodiment 1, with seq id no.42 and
, as primer amplification rbcl gene order fragment, condition is as shown in table 2 for seq id no.43.As described in Example 1, carry out pcr
Product detection, sequencing, dna bar code sequence obtain, and then carry out following result judgement.
The rabdosia lophanthide of the inclusion rbcl gene order fragment that the rbcl gene order fragment of acquisition and embodiment 1 are obtained and
Rabdosia lophanthoides (including mutation fine flower Rabdosia amethystoides) gene pool compares, and carries out result judgement.Especially by inter-species in calculating kind
Variation value；For the rabdosia lophanthide in gene pool and Rabdosia lophanthoides (including mutation fine flower Rabdosia amethystoides) sequence, calculate small stream
In yellow grass and Rabdosia lophanthoides (including mutation fine flower Rabdosia amethystoides) respective kind, the inter-species between maximum variation value and two species is
Little variation value, between the sequence after genetic fragment of new sample to be identified and this gene pool is compared, minimum variation value is (i.e.
" inter-species minimum variation value ") it is equal to or less than greatest genetic distance in the kind having calculated that, can be considered same species.
Specifically, the rbcl sequence peak figure file that measuring samples obtain is imported codoncode aligner v3.7 to enter
Row splicing, then hand inspection splicing effect, including (1) adjustment sequence forward and reverse (edit reverse complement),
(2) primer or other border sequences (sample trim vector ...) are removed, (3) check that (qual needs remaining base mass value
It is greater than equal to 20), finally deriving concensus sequence is standard bar code data；By this standard bar code data and rbcl base sequence
The data in row storehouse imports sequence alignment program (matgat2.01) together, select default scoring matrix (scoring matrix:
Blosum50) carry out multiple alignment (align), preserve result of calculation (similarity table), after numerical value retains decimal point
One, according to the adjustment of subsequent software taxongap desirable format, (two txt files, one is species name catalogue, and one is thing
Plant dna sequence alignment result, i.e. similarity matrix)；Check identification result using software taxongap2.4.1: on the main boundary of software
Face imports species name catalogue (files data files load), imports species dna sequence under biomarker option
Comparison result (biomarker add load save), other minor parameters refer to software document and are configured.Fortune
After row software, (run execute) obtains result, in the suitable in figure of txt file, checks measuring samples and rabdosia lophanthide and strain line
Rabdosia amethystoides corresponding " minimum inter-species variation value ", if measuring samples corresponding with rabdosia lophanthide " minimum inter-species variation value " are equal to or little
In 0.2, you can judge this species to be checked as rabdosia lophanthide；If measuring samples are right with Rabdosia lophanthoides (including mutation fine flower Rabdosia amethystoides)
" the minimum inter-species variation value " answered is equal to or less than 0, you can judge this species to be checked as Rabdosia lophanthoides.
After differentiating through this method, the conclusion and the conventional method that obtain contrast, and result is consistent.
But through comparing, the requirement to sample for this method is easy to get than the requirement of conventional method.
Sample needed for this method is certain the easy position obtaining plant dna on plant, and Fresh Plants are easier to obtain plant
Dna, generally adopts blade as the sample extracting plant dna, does not require the complete stool of plant or certain organ complete.
Traditional discrimination method needs holding can reflect feature plant position, and unknown rabdosia lophanthide and Rabdosia lophanthoides are planted
During the discriminating of thing species, need to keep stem form is complete, blade complete, differentiated and microscopical characters with completing its proterties；Passing
In system sorting technique, if flower and fruit are had on plant, more can reflect inter-species difference, but when using as Chinese medicine,
Rabdosia lophanthide and Rabdosia lophanthoides will harvest before flowering it is difficult to provide the form of flower and fruit；These situations all cause biography
The limitation of system discrimination method.
Embodiment 3Unknown rabdosia lophanthide and the discriminating of Rabdosia lophanthoides medicine materical crude slice species
The method that the present embodiment is provided using the present invention is entered to the sample of unknown rabdosia lophanthide and Rabdosia lophanthoides medicine materical crude slice species
Go discriminating.
Select doubtful but not identified, the medicine materical crude slice of rabdosia lophanthide and Rabdosia lophanthoides, be divided into two parts, portion traditional taxonomy
Method is identified.Another uses method therefor in the present invention to differentiate, differentiates step with embodiment 2.
After differentiating through this method, the conclusion and the conventional method that obtain contrast, and result is consistent.
But through comparing, the requirement to sample for this method is easy to get than the requirement of conventional method.
Sample needed for this method be certain on plant easily obtain plant dna position although medicine materical crude slice be dried and
Sample after broken, but its dna is not destroyed, and is still easier to extraction and obtains.
Traditional taxonomy method differentiates to need sample to keep to reflect the plant position of feature, to unknown rabdosia lophanthide, strain line
During the discriminating of Rabdosia amethystoides plant species, need to keep stem form is complete, blade complete, differentiated and micro- mirror with completing its proterties
Not；For segment but the medicine materical crude slice of above-mentioned requirements can be met, can be differentiated by traditional taxonomy method, but for cutting
Especially broken medicine materical crude slice after system, to differentiate then there is larger difficulty by traditional taxonomy method.In conventional sorting methods
In, if flower and fruit are had on plant, more can reflect inter-species difference, but when using as Chinese medicine, rabdosia lophanthide and line
Line Rabdosia amethystoides will harvest before flowering it is difficult to provide the form of flower and fruit；These situations all cause traditional discrimination method
Limitation.
Embodiment 4The species of the organ of known rabdosia lophanthide and Rabdosia lophanthoides differentiate
The present embodiment adopts the sample of the blade to known rabdosia lophanthide and Rabdosia lophanthoides for the method that the present invention provides or stem
Differentiated, differentiate step with embodiment 2.
After differentiating through this method, the conclusion obtaining is consistent with known results.
Only take under conventional method blade, stem or certain organ sample when it is difficult to confirm its plant species, but this method
It can be differentiated.
Specific description of embodiments of the present invention above is not intended to limit the present invention, and those skilled in the art can be according to this
Invention is variously modified or deforms, and without departing from the spirit of the present invention, all should belong to the model of claims of the present invention
Enclose.
Claims (7)
1. a kind of gene pool of the rbcl gene order fragment including rabdosia lophanthide and Rabdosia lophanthoides, described gene pool includes following
Rbcl gene order fragment shown in sequence number: seq id no.1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,
16th, 17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40 and
41.
2. a kind of method differentiating rabdosia lophanthide and Rabdosia lophanthoides plant species, methods described is included the rbcl of plant to be identified
The step that gene or its sequence fragment are compared with gene pool according to claim 1.
3. method according to claim 2 is it is characterised in that methods described comprises the steps:
1) extract the genome dna of plant to be identified；
2) with step 1) the genome dna that obtains as template, amplification rbcl gene or its sequence fragment；
3) by step 2) the rbcl gene that obtains or its sequence fragment compared with gene pool according to claim 1,
Thus differentiating the species of described plant to be identified.
4. method according to claim 3 is it is characterised in that described step 2) in using following sequences as primer from institute
State amplification rbcl gene order fragment in the genome dna of plant to be identified: seq id no.42 and seq id no.43.
5. the method according to claim 3 or 4 is it is characterised in that described step 3) in by by step 2) obtain
Compare between existing sequence in rbcl gene or its sequence fragment and gene pool according to claim 1, obtain
Similitude between existing sequence in the sequence of described plant to be identified and gene pool, thus differentiate described plant to be identified
Species.
6. method according to claim 5 is it is characterised in that described step 3) in by step 2) the rbcl gene that obtains
Or its sequence fragment and gene pool according to claim 1 are when comparing, similarity highest or matching degree highest or something lost
Pass the species that the minimum corresponding species of distance are plant to be identified.
7. purposes in differentiating Rabdosia lophanthoides and rabdosia lophanthide for the gene pool according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410189583.7A CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410189583.7A CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404629A CN104404629A (en) | 2015-03-11 |
| CN104404629B true CN104404629B (en) | 2017-01-25 |
Family
ID=52642291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410189583.7A Active CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404629B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132549A (en) * | 2015-08-31 | 2015-12-09 | 中国农业科学院植物保护研究所 | Vigna radiata specific PCR (polymerase chain reaction) primer pair and method for detecting vigna radiata in phytophagous insect bodies |
| CN107190090A (en) * | 2017-07-19 | 2017-09-22 | 福建农林大学 | The molecular identificalion primer and method of a kind of Chinese lobelia and Mazus japonicus |
| CN110079593A (en) * | 2019-05-08 | 2019-08-02 | 中国环境科学研究院 | A kind of discrimination method of artemisiifolia, Ambrosia trifida |
| CN110890134B (en) * | 2019-10-31 | 2023-05-16 | 南京师范大学 | Method for identifying dendrobium candidum group source by using chloroplast genome large single copy region |
| CN113755626B (en) * | 2021-09-14 | 2023-06-20 | 广州中医药大学(广州中医药研究院) | Molecule identification kit and identification method for rabdosia lophanthide |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191318B (en) * | 2011-03-04 | 2013-11-06 | 广州中医药大学 | Application of nucleotide sequence of rDNA (recombinant deoxyribonucleic acid) ITS (internal transcribed spacer)-D3 region in establishment of DNA (deoxyribonucleic acid) bar code identification system for medicinal plants |
| CN102978208A (en) * | 2012-12-11 | 2013-03-20 | 中国科学院植物研究所 | Specific primer pair for identification of spermatophyte species and applications of specific primer pair |
| CN103305620B (en) * | 2013-06-26 | 2014-12-31 | 中国科学院植物研究所 | Specific primer pair based on rbcL gene and used for identifying land plant species and application thereof |
-
2014
- 2014-05-06 CN CN201410189583.7A patent/CN104404629B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404629A (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104404129B (en) | DNA bar code differentiates rabdosia lophanthide and its method closely belonged to | |
| CN104404629B (en) | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara | |
| Ma et al. | Unusual patterns of hybridization involving a narrow endemic Rhododendron species (Ericaceae) in Yunnan, China | |
| Khan et al. | Authentication of the medicinal plant Senna angustifolia by RAPD profiling | |
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| CN105349651A (en) | Method utilizing EST-SSR marker for identification of traditional Chinese medicine serrate rabdosia herb varieties and primers | |
| CN104561332B (en) | A kind of SSR molecular marker identifying Populus davidiana sex and application thereof | |
| CN107502665A (en) | Differentiate the method for locust tree kind based on Capillary Electrophoresis fluorescence SSR finger-prints | |
| CN104762370B (en) | The nucleotide sequence and method of Chinese Taxus kind and kind are distinguished in identification | |
| CN105002272B (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| Arumugam et al. | Molecular fingerprinting of the Indian medicinal plant Strychnos minor Dennst | |
| CN109517920A (en) | A kind of construction method of the finger-print of eremochloa ophiuroides germplasm and application | |
| CN105177151B (en) | A kind of DNA bar code primer pair, kit and method for differentiating Chinese yew kind | |
| WO2023231532A1 (en) | Snp site combination for identifying variety of lonicera japonica thunb., primer combination, and method for identifying variety of lonicera japonica thunb. | |
| CN104894276B (en) | A kind of Rapid identification tea germplasm oolong tea fits the molecule labelling method of property processed | |
| CN103509871A (en) | Method for identifying DNA barcodes of three gentiana macrophylla medicinal materials in pharmacopeia | |
| CN109182573A (en) | Discrimination method and the application of a kind of herbal tea tuber of pinellia certified products and its mixed adulterant | |
| CN107630014B (en) | A kind of identification method of Aconitum transsectum DNA bar code and Aconitum transsectum based on big data | |
| CN106636319A (en) | Molecular biological method for rapidly identifying Hoolock leuconedys and Nomascus leucogenys | |
| CN104988240A (en) | Method for identifying swarm royal jelly high yield character with SNP mark rs16287910 | |
| CN106755431A (en) | A kind of method for identifying cynomorium songaricum | |
| CN108754007A (en) | Using SSR molecular marker to the identification method of opium poppy | |
| CN105755114A (en) | Specific primer pair for identifying alien Invasion pomacea canaliculata two genotypes in assisted manner and application of specific primer pair | |
| CN105087564A (en) | Specific molecular marking primer and method for identifying sarcandra glabra and three adulterants | |
| CN105063202A (en) | Method for identification of bee colony royal jelly high yield characters by SNP marker rs4208349 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |