CN104404629A - DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara - Google Patents
DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara Download PDFInfo
- Publication number
- CN104404629A CN104404629A CN201410189583.7A CN201410189583A CN104404629A CN 104404629 A CN104404629 A CN 104404629A CN 201410189583 A CN201410189583 A CN 201410189583A CN 104404629 A CN104404629 A CN 104404629A
- Authority
- CN
- China
- Prior art keywords
- sequence
- rabdosia
- gene
- plant
- species
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a gene pool containing rbcL gene sequence fragments of labiate Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara. The invention also provides a method for identifying plant species of the labiate Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara. The method comprises the step of comparing a rbcL gene or its sequence fragment of a plant sample, plant species of which is to be identified, to the gene pool provided by the invention. The invention also provides an application of the rbcL gene or its sequence fragment in identifying the labiate Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara and the labiate Isodon serra(Maxim.)Kudo. It proves that the rbcL sequence is general, is easy to amplify and compare, and has good amplification and identification effects on the labiate Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara and the labiate Isodon serra(Maxim.)Kudo.
Description
Technical field
The invention belongs to plant species qualification field, specifically, the present invention relates to the species discrimination method of Linearstripe Rabdosia Herb, Rabdosia lophanthoides.
Background technology
Chinese medicine Linearstripe Rabdosia Herb is that the medication of resident's tradition is with, its dampness removing removing jaundice in Fujian, Guangdong one, for the treatment of the diseases such as hepatitis, acute and chronic cholecystitis, dysentery, and eats as cold tea daily health caring.
At Chinese medicine circle, the name of Part of Chinese Medicinal and its base former, namely plant taxonomy name is inconsistent.Chinese medicine Linearstripe Rabdosia Herb just also exists this situation, and the Chinese medicine Linearstripe Rabdosia Herb that folk tradition uses is labiate Rabdosia lophanthoides [Latin is called Rabdosia lophanthoides (Buch.-Ham.ex D.Don) H.Hara or Isodon striatus (Benth.) Kudo] and mutation fibre flower Herba Rabdosiae glaucocalycis [Latin is called Rabdosialophanthoides (Buch.-Ham.ex D.Don) H.Hara var.graciliflora (Benth.) H.Hara or lsodon lophanthoides (Buch.-Ham.ex D.Don) H.Hara var.graciliflora (Benth.) H.Hara] thereof, meanwhile, owing to there is no Specification, medicinal material market there is labiate Linearstripe Rabdosia Herb [Latin is called Isodon serra (Maxim.) Kudo or Rabdosia serra (Maxim.) H.Hara] confuse use, in addition, the base of the Linearstripe Rabdosia Herb of including in relevant academic monograph and provincial standard monograph is former inconsistent, the determination former about base and all contradictory part of the discriminating of kind: " conventional herbal medicine handbook ", " Guangdong Chinese veterinarian commonly uses herbal medicine ", " national herbal medicine compilation " (first volume), " Chinese medicine voluminous dictionary " and Guangdong, Guangxi, the Chinese medicinal materials standard that Hunan etc. are local, all being recited as the base of Linearstripe Rabdosia Herb former is Rabdosia lophanthoides Isodonlophanthoides (Buch.-Ham.ex D.Don) Hara), wherein plant Linearstripe Rabdosia Herb Rabdosia serra (Maxim.) H.Hara includes into as base is one of former by " Guangdong Province's Chinese medicinal materials standard " second simultaneously, but in plant is differentiated, some crude drugs features of Linearstripe Rabdosia Herb Rabdosia serra (Maxim.) H.Hara do not meet standard, and (present patent application hereinafter described " Linearstripe Rabdosia Herb " all refers to labiate Linearstripe Rabdosia Herb [Latin is called Isodon serra (Maxim.) Kudo or Rabdosia serra (Maxim.) H.Hara], instead of Chinese medicine Linearstripe Rabdosia Herb).
Plant Linearstripe Rabdosia Herb and Rabdosia lophanthoides are two kinds under dicotyledons Labiatae, and on fresh plant, on both morphological appearance such as stem, leaf, difference is large, but after drying or segment, both not easily differentiate.Dry product is generally at the Chinese medicinal materials of market circulation.Effective discrimination method can distinguish plant Linearstripe Rabdosia Herb and Rabdosia lophanthoides, can provide part technique means again in the establishment research that base is former.
Discrimination method at present for this two kind of plant and medicine materical crude slice has the methods such as macroscopical identification, microscopical identification and physics and chemistry qualification.The experience dependency degree of these prior aries to operator is high, and the theoretical basis of conventional identification method builds on the analysis of properties and characteristics of taxonomical group, these properties and characteristicses are the phenotypes be closely related with environment, being subject to the restriction at such environmental effects and sample morphology and material position when differentiating, occurring error.
The kind real and fake discrimination of Chinese medicine is directly connected to drug safety and clinical efficacy.Therefore, at present can precise Identification Linearstripe Rabdosia Herb plant species thus the novel method of accurate medication can be helped in the urgent need to providing.
Molecular biology identification applies the novel method that DNA molecular marker technology comes the former plant of Identification chinese herbs medicine and medicinal material and medicine materical crude slice at present.In brief, from molecular genetic angle, the phenotype of species should trace back to genotypic difference after all, the difference namely on DNA sequence dna.Therefore, to the comparative studies of genome sequence difference be plant classification and qualification provide the most essential foundation.
In recent years, along with the development of Protocols in Molecular Biology, DNA molecular marker technology has been widely used in medicinal plant genetic diversity, systematics, means of taxonomic research, and penetrates into the qualification field of herbal medicine gradually, has promoted the development of herbal medicine identification research.DNA molecular is as the carrier of genetic information, information content is large, in of the same race, there is genetic stability highly, and be not subject to the impact of outside environmental elements and biological development stage and organ-tissue difference, therefore carry out herbal medicine by DNA molecular feature as genetic marker and differentiate to have more accurately and reliably, be highly suitable for the plant identification of sibling species, confusion varieties kind, rare kind etc.
At present, molecular marking technique for herbal medicine qualification mainly contains " restriction fragment length polymorphism " (RFLP) technology, " randomly amplified polymorphic DNA " (RAPD) technology, " micro-satellite " (SSR) technology, ISSR labeling technique, " amplified fragment length polymorphism " (AFLP) technology etc., and DNA bar code technology (DNA barcoding).Wherein, DNA bar code qualification is the latest developments of Molecular Identification, its be defined as utilize one section of recognised standard in genome, relatively short DNA fragmentation identifies quickly and accurately species and identifies molecular diagnosis new technology.It is advantageous that, only need one or a few suitable gene fragment can be differentiated accurately to most species of whole genus, section; Discriminating speed is faster; Repeatability and stability high; Experimentation is simplified, stdn, more easily realizes the automatization that species are differentiated.DNA bar code authenticate technology is effectively supplementing of traditional discrimination method, can realize the stdn of the former qualification of Chinese medicine base, contributes to the present situation alleviating conventional identification talent shortage.
When utilizing DNA bar code technical evaluation plant, the screening of DNA bar code and determine it is an important ring.Usually, DNA bar code screening has following standard: the short-movie section of (1) standard; (2) enough variations will be had species can be separated, difference between species is larger, is convenient to the differentiation of carrying out planting Yu planting, and in planting, sequence variations is as far as possible little, thus makes there is distinct defining with intraspecific variablity between kind; (3) sequence two sections is relatively conservative, to facilitate the design of primer.
Make its Successful amplification in default of universal primer, first most of single copy gene of plant nucleus gene group and their intron are excluded the candidate as barcode.Separately have investigator to propose, internal transcription space ITS and ITS2 of core DNA then may become potential DNA bar code sequence.Further, the gene of Chloroplast gene and the research of intron thereof find, the non-coding region of psbA-trnH and ITS may as potential DNA bar code sequence for the identification of multifarious angiosperm species.Somebody proposes, and matK gene can identify flowering plant as universal bar shape code, and matK and psbA-trnH is both applicable to myristicaceae plant.Therefore, up to now, for the DNA bar code being applicable to plant identification, successively propose the sequences such as matK, psbA-trnH, rbcL, rpoC1, rpoB, matK, ITS2 at present, but neither one barcode can be suitable in all plant sections genus is planted.
More existing investigator attempts by DNA molecular Biological assay for the identification of Linearstripe Rabdosia Herb, as utilized RAPD technology to identify.RAPD technology is s-generation molecular marking technique, does not have DNA bar code consistent.And, although investigator constantly improves the application of DNA bar code technology in plant species qualification, but owing to reporting that any DNA bar code can be suitable for the discriminating of all plants at present in addition, therefore to concrete plant species, still need to carry out testing to search out suitable gene order and use as DNA bar code.
Based on above-mentioned situation, at present as DNA bar code technology will be utilized to carry out precise Identification to labiate Rabdosia lophanthoides and labiate Linearstripe Rabdosia Herb, need to screen the DNA bar code that may use, find optimal gene order as DNA bar code.
Summary of the invention
An object of the present invention is to provide the DNA bar code of the most applicable discriminating Linearstripe Rabdosia Herb and Rabdosia lophanthoides, i.e. specific DNA sequence dna.
Another object of the present invention is, has determined the Linearstripe Rabdosia Herb of species, the multiple sample in Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) country of origin, set up the DNA bar code gene pool of Linearstripe Rabdosia Herb, Rabdosia lophanthoides by collection.
Another object of the present invention is, by the gene fragment of new measuring samples and this DNA bar code gene pool being compared, sets up the discrimination method of this unknown sample.
Another object of the present invention is, provides this DNA bar code or the purposes of gene pool in Linearstripe Rabdosia Herb and Rabdosia lophanthoides.
Concrete technical scheme of the present invention is as follows:
On the one hand, the present inventor is through great many of experiments, with regard to the screening of the DNA bar code gene of Linearstripe Rabdosia Herb, Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis), the DNA bar code of the discriminating of the most applicable Linearstripe Rabdosia Herb and Rabdosia lophanthoides is filtered out, i.e. the sequence fragment of rbcL gene or rbcL gene from ITS2, matK, psbA-trnH, rbcL4 sequence.
The large subunit of rbcL genes encoding 1,5-diphosphoribulose carboxylase/oxydase, is positioned at large single copy area of cpDNA (plant chloroplast genome), is always about 1400bp, is to apply one of the most general gene in plant molecular systematics research.Although the evolutionary rate of rbcL gene in different phyto-group has larger difference, generally speaking relatively conservative, for plant provides important proterties source compared with the phylogeny research of high-class rank unit.The present inventor finds through screening study, has the feature of general, easy amplification, easily comparison compared to other gene such as ITS2, matK, psbA-trnH, rbcL sequence.And, although the variation of existing document display rbcL is mainly present in kind of an above level, on species level, variation is large not usually, but the present inventor finds, in labiate Rabdosia lophanthoides and labiate Linearstripe Rabdosia Herb, rbcL gene has good amplification and identification result, can as DNA bar code for differentiating above-mentioned plant species.
Therefore, the present invention provides rbcL gene or its sequence fragment differentiating the purposes in labiate Rabdosia lophanthoides and labiate Linearstripe Rabdosia Herb in this regard.Wherein, described rbcL gene order fragment to increase as primer preferably by the following sequence of employing and obtains from the genomic dna of plant sample to be identified: SEQ ID NO.42 and SEQ ID NO.43.
On the other hand, the invention provides the gene pool of the rbcL gene order fragment comprising Linearstripe Rabdosia Herb and Rabdosia lophanthoides.Specifically, first the multiple sample in Linearstripe Rabdosia Herb and Rabdosia lophanthoides country of origin is gathered, respective species are differentiated with plant traditional taxonomy method, then its genomic dna is extracted respectively, with its genomic dna for template, adopt the rbcL gene order fragment of specific primer sequence, preferably SEQ ID NO.42 and SEQ IDNO.43 amplification sample, set up the gene pool comprising the rbcL gene order fragment of Linearstripe Rabdosia Herb and Rabdosia lophanthoides thus.Described gene pool comprises the rbcL gene order fragment shown in following sequence numbering: SEQ ID NO.1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41.Wherein, SEQ ID NO.1-8 is accredited as Linearstripe Rabdosia Herb sample rbcL gene order fragment separately with plant traditional taxonomy method; SEQID NO.9-15 is accredited as Rabdosia lophanthoides sample rbcL gene order fragment separately with plant traditional taxonomy method; SEQ ID NO.16-41 is accredited as Rabdosia lophanthoides (mutation fibre flower Herba Rabdosiae glaucocalycis) sample rbcL gene order fragment separately with plant traditional taxonomy method.
Another aspect, the invention provides the discrimination method of Linearstripe Rabdosia Herb and Rabdosia lophanthoides plant species, and described method comprises the step rbcL gene of plant to be identified or its sequence fragment and gene pool mentioned above compared.Specifically, described method comprises the steps:
1) genomic dna of plant to be identified is extracted;
2) with step 1) genomic dna that obtains is template, amplification rbcL gene or its sequence fragment;
3) by step 2) the rbcL gene that obtains or its sequence fragment and gene pool provided by the invention compare, thus differentiate the species of described plant to be identified.
In discrimination method provided by the invention, step 1) in any plant genome DNA extracting method or commercial extraction kits can be adopted to carry out.According to the specific embodiment of the present invention, get the sample such as blade of plant to be identified, dry after using 75% aqueous ethanolic solution scrub surfaces, take 5mg-2g, after liquid nitrogen grinding, extract test kit with plant genome DNA and extract.
Step 2) in the condition of any rbcL of amplification gene or its sequence fragment can be adopted to carry out.According to the specific embodiment of the present invention, when increasing the rbcL gene order fragment of plant sample to be identified, its primer and amplification condition as follows:
Primer---
SEQ ID NO.42 (forward): ATGTCACCACAAACAGAGACTAAAGC
SEQ ID NO.43 (oppositely): GTAAAATCAAGTCCACCRCG
Reaction system---
ExTaqMix25 μ l, each 1.0 μ l of upstream and downstream primer, DNA masterplate 3.0 μ l, adds sterile purified water to 50 μ l
Response procedures---
95 DEG C, 4min; 94 DEG C of-30s, 55 DEG C of-1min, 72 DEG C of-1min, 35 circulations; 72 DEG C of-10min
Detect, check order and result treatment---
Agarose gel electrophoresis method for detecting is taked to detect PCR primer.After electrophoresis, should there is the band of an entry in PCR primer, negative control should without band in corresponding DNA bar code sequence length position.To the sample of pcr amplification band be had to send order-checking company to carry out determined dna sequence, use DNA sequencer to carry out two-way order-checking to object band, pcr amplification primer be as sequencing primer.Sequencing result adopts sequence assembly software CodonCode Align er V2.06 (CodonCode Co, USA) check and correction splicing, and remove inferior quality sequence and guiding region, sequence direction should be consistent with pcr amplification forward primer direction.
In step 3) in, by step 2) the rbcL gene that obtains or its sequence fragment and gene pool provided by the invention are when comparing, and the corresponding species that similarity is the highest or matching degree is the highest or genetic distance is minimum are the species of plant to be identified.By comparing between sequence existing in the sequence of plant to be identified and gene pool, the similarity between multiple sequence can be obtained, draws its species classification.BLAST analysis, distance method, tree building method are all the methods differentiating species based on sequence alignment.
According to the specific embodiment of the present invention, the gene fragment of the rbcL gene order fragment of sample to be identified gene pool is therewith carried out comparison between two, obtain the multiple minimum variation value between existing multiple sequence in the sequence of plant to be identified and gene pool, follow maximum variation value in the kind of Linearstripe Rabdosia Herb and the Rabdosia lophanthoides calculated to compare again, carry out result judgement.As: according to embodiment 1, in the kind of Linearstripe Rabdosia Herb rbcL gene and Rabdosia lophanthoides rbcL gene, maximum variation value is respectively " 0.2 " and " 0 ", adopt the computer software of sequence alignment, as MatGat2.01, MEGA5, Vector NTI Suite assembly AlignX etc., comparison between two one by one between the multiple sequences treating the Rabdosia lophanthoides in the sequence of differential plant and gene pool, obtain minimum variation value between multiple sequence, these values equal 0, then corresponding species are Rabdosia lophanthoides; Comparison between two one by one between multiple sequences that same employing computer software treats the Linearstripe Rabdosia Herb in the sequence of differential plant and gene pool, obtain minimum variation value between multiple sequence, these values are equal to or less than 0.2, then corresponding species are Linearstripe Rabdosia Herb.
Specifically, first, the rbcL gene order fragment peak map file obtained from sample to be identified is imported CodonCode Aligner V3.7 splice, then hand inspection splicing effect, comprise (1) adjustment sequence forward and reverse (edit-reverse complement), (2) primer or other border sequences (sample-trim vector is removed ...), (3) check residue base mass value (qual needs to be more than or equal to 20), finally deriving concensus sequence is standard bar code data.Then, these standard bar code data are imported sequence alignment program (MatGat2.01) together with the data of the gene pool of rbcL gene order fragment, default scoring matrix (Scoring Matrix:blosum50) is selected to carry out multiple ratio to (align), preserve calculation result (Similarity table), numerical value retains one decimal place, Format adjusting (two txt files needed for subsequent software TaxonGap, one is species name catalogue, one is species DNA sequence dna comparison result, i.e. similarity matrix).Next, software TaxonGap2.4.1 is utilized to check identification result.Species name catalogue (Files-Data Files-Load) is imported at the main interface of software, under Biomarker option, import species DNA sequence dna comparison result (Biomarker-Add-Load-Save), other minor parameters can be arranged by reference software specification sheets.After operating software, (Run-Execute) obtains result, in the suitable figure of txt file, check measuring samples sequence and Linearstripe Rabdosia Herb, Rabdosia lophanthoides " between kind minimum variation value " (supposing that sample to be identified is a new species) that (comprising mutation fibre flower Herba Rabdosiae glaucocalycis), each sample sequence was corresponding respectively, if the minimum variation value between the sequence fragment of measuring samples sequence and Linearstripe Rabdosia Herb each sample (i.e. " between kind minimum variation value ") is equal to or less than 0.2, can judge that these species to be checked are as Linearstripe Rabdosia Herb; If the minimum variation value between the sequence fragment of measuring samples and Rabdosia lophanthoides each sample (i.e. " between kind minimum variation value ") is 0, can judge that these species to be checked are as Rabdosia lophanthoides.
Also can adopt such as other method following, this several method is also by sequence alignment, comparison match degree or compares similarity etc., confirms the ownership between species:
BLAST analyzes---
The DNA bar code sequence (query sequence) deriving from unknown sample is compared with DNA bar code database (reference library), if find duplicate sequence (reference sequence) in DNA bar code database, so unknown sample is exactly species corresponding to this reference sequence; Otherwise unknown sample does not exist in a database.Profit can identify further in the following method, in this case, need to pay close attention to the species to the most relevant 10 sequences of unknown sample DNA bar code sequence or the species that in comparison, the frequency of occurrences is the highest, unknown sample can be defined as a certain section and belong to.Simultaneously the method also can directly be compared with GenBank database, identifies with the Nucleotide data-guiding that utility is global up-to-date.
Distance method---
Calculate the genetic distance of each sequence (reference sequence) in unknown sample DNA bar code sequence (query sequence) and database, unknown sample should be the species with minimum average B configuration genetic distance (meandistance) or the species with minimum genetic distance (nearest distance).The threshold value (threshold) of genetic distance is determined in " building DNA of medicine plants barcode qualification platform " process, in theory to same species, sampling covers the enough individualities in its whole regional distribution (different populations) and same population, this threshold value accurately can reflect the heritable variation size of these species, also the species determining unknown sample are better conducive to, but consider research cost, it is generally acknowledged that the sampling of same species preferably includes 5 population, each population 2 individualities.
Tree building method---
First apply CLUSTAL and carry out MSA, select the genetic distance in suitable genetic distance model (generally using K2P distance model) calculating kind and between planting, the phylogenetic trees such as software building NJ, UPGMA, MP such as application MEGA or PAUP, the species of DNA bar code sequence (querysequence) together with sequence in database (reference sequence) cluster of inspection unknown sample, determine species further according to cluster situation.
Paired alignment process---
When still unknown sample can not to be differentiated kind by above method, the reference sequence of unknown sample and closely-related 10 species can be carried out paired comparison, species are differentiated by analyzing nucleotide variation site, or be judged as novel species, or be judged as the species of not yet including in reference library.
Compared to prior art, the present invention has made following contribution and beneficial effect:
First, the present invention spends the genetic barcode of Herba Rabdosiae glaucocalycis to screen to Linearstripe Rabdosia Herb, Rabdosia lophanthoides and fibre, the DNA bar code of the most applicable discriminating Linearstripe Rabdosia Herb and Rabdosia lophanthoides is filtered out, i.e. rbcL gene or its sequence fragment from ITS2, matK, psbA-trnH, rbcL4 gene order.Compared to other genes, rbcL sequence has the feature of general, easy amplification, easily comparison.And, although the variation of existing document display rbcL is mainly present in kind of an above level, on species level, variation is large not usually, originally experimental studies have found that, in labiate Rabdosia lophanthoides and labiate Linearstripe Rabdosia Herb, it has good amplification and identification result.
Second, the present invention is through gathering the multiple sample in Linearstripe Rabdosia Herb, Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) country of origin, obtain the gene pool comprising rbcL gene fragment, thus establish the standard rbcL sequence gene storehouse of Linearstripe Rabdosia Herb, Rabdosia lophanthoides.
3rd, based on above-mentioned discovery, the present invention also establishes the discrimination method of fresh sample, comprises and the gene fragment of new sample to be identified gene pool therewith being compared, judge the species of fresh sample.Particularly by calculating variation value between kind of interior kind; For the Linearstripe Rabdosia Herb in gene pool and Rabdosia lophanthoides sequence, calculate minimum variation value between the kind in Linearstripe Rabdosia Herb and Rabdosia lophanthoides kind separately between maximum variation value and two species, after the gene fragment of new sample to be identified gene pool therewith carries out one by one comparison between two, obtain the minimum variation value (i.e. " between kind minimum variation value ") between multiple sequence, maximum variation value in the kind that these values are equal to or less than certain species calculated, can be considered species same with it.This discrimination method can differentiate Linearstripe Rabdosia Herb, the herb of Rabdosia lophanthoides, organ and medicine materical crude slice.Compared to the existing discrimination method of Linearstripe Rabdosia Herb and Rabdosia lophanthoides, the integrated degree that method of the present invention has for sample requires low, the advantage that identification beacon can quantize.
Accompanying drawing explanation
Below, describe embodiment of the present invention in detail by reference to the accompanying drawings, wherein:
Fig. 1 shows DNA bar code authentication method design sketch provided by the invention, and it take plant species as classification, adopts TaxonGap method.Between wherein planting, minimum variation value is shown as dark bars; In kind, maximum variation value is shown as light bar, and Rs represents species Linearstripe Rabdosia Herb, and Rlvg represents species fibre flower Herba Rabdosiae glaucocalycis, and Rl represents species Rabdosia lophanthoides.
Embodiment
Referring to specific embodiment, the present invention is described.It will be appreciated by those skilled in the art that these embodiments are only for illustration of the present invention, its scope do not limited the present invention in any way.
Experimental technique in following embodiment, if no special instructions, is ordinary method.Medicinal raw material used in following embodiment, reagent material etc., if no special instructions, be commercially available purchase product.
embodiment 1the screening of DNA bar code and comprise the foundation of gene pool of rbcL gene order fragment
The present embodiment is with regard to the screening of the DNA bar code gene of Linearstripe Rabdosia Herb, Rabdosia lophanthoides and Rabdosia lophanthoides (mutation fibre flower Herba Rabdosiae glaucocalycis), the DNA bar code of the discriminating of the most applicable Linearstripe Rabdosia Herb and Rabdosia lophanthoides is filtered out, i.e. rbcL gene order fragment from ITS2, matK, psbA-trnH, rbcL4 sequence.In addition, the present embodiment establishes the gene pool of the rbcL gene order fragment comprising Linearstripe Rabdosia Herb and Rabdosia lophanthoides.
1 instrument, material and reagent
1.1 material
In 7 sampling points (Guangdong, Fujian), have collected Linearstripe Rabdosia Herb, Rabdosia lophanthoides and Rabdosia lophanthoides (mutation fibre flower Herba Rabdosiae glaucocalycis) totally 41 increment product, details sees the following form 1.Following barcode screening experiment take plant leaf as material.
Table 1 sample message table
1.2 reagent and instrument
Have employed plant genome DNA and extract test kit (Beijing Tian Gen Bioisystech Co., Ltd); 10 × PCR Buffer damping fluid, Tris alkali (Ai Zite bio tech ltd, Shanghai); Taq archaeal dna polymerase, dNTP (precious biotechnology (Dalian) company limited of TaKaRa); Pcr amplification primer synthesis (Hua Da gene); D-37520 type desk centrifuge (German Eppendorf company); PTC-100 type PCR instrument (MJ Research company of the U.S.); DDY-III type electrophoresis apparatus (Liuyi Instruments Plant, Beijing); Gel imaging system (BIO-RAD company of the U.S.).
2 methods
The extraction of 2.1DNA
After material collection, carry out drying with discolour silica gel.Get about 100mg plant tissue during experiment, after liquid nitrogen grinding, extract test kit with plant genome DNA and extract.This experimental plant extracting genome DNA all adopts " sky root " plant genome DNA to extract test kit (centrifugal column type catalog number (Cat.No.): DP305), and concrete operation step is as follows:
1) get fresh tissues of plants and be about 100mg or dry weight tissue is about 30mg, add liquid nitrogen and fully grind.
2) ground powder is transferred to rapidly in the centrifuge tube that 700 μ l65 DEG C of preheating damping fluid GP1 are housed in advance and (before experiment, in the GP1 of preheating, add mercaptoethanol, its final concentration is made to be 0.1%), put upside down mixing rapidly, centrifuge tube is placed on 65 DEG C of water-baths 20 minutes, puts upside down centrifuge tube in water-bath process to mix sample for several times.
3) add 700 μ l chloroforms, fully mix, centrifugal 5 minutes of 12000rpm (~ 13400*g).
4) carefully previous step gained upper strata aqueous phase is proceeded in a new centrifuge tube, add 700 μ l damping fluid GP2, fully mix.
5) proceed in adsorption column CB3 by the liquid of mixing, centrifugal 30 seconds of 12000rpm (~ 13400*g), discards waste liquid.
6) in adsorption column CB3, add 500 μ l damping fluid GD, centrifugal 30 seconds of 12000rpm (~ 13400*g), outwells waste liquid, adsorption column CB3 is put into collection tube.
7) in adsorption column CB3, add 700 μ l rinsing liquid PW, centrifugal 30 seconds of 12000rpm (~ 13400*g), outwells waste liquid, adsorption column CB3 is put into collection tube.
8) in adsorption column CB3, add 500 μ l rinsing liquid PW, centrifugal 30 seconds of 12000rpm (~ 13400*g), outwells waste liquid, adsorption column CB3 is put into collection tube.
9) put back in collection tube by adsorption column CB3, centrifugal 2 minutes of 12000rpm (~ 13400*g), outwells waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.
10) adsorption column CB3 is proceeded in a clean centrifuge tube, the unsettled dropping 100 in middle part to adsorption film μ l elution buffer TE, room temperature places 2-5 minute, 12000rpm (~ 13400*g) centrifugal 2 minutes, by solution collection in centrifuge tube.
2.2PCR amplification
Plant group DNA extraction product carries out pcr amplification, and primer is by Hua Da gene chemical synthesis, and the raw materials such as archaeal dna polymerase are purchased from precious biotechnology (Dalian) company limited.Concrete primer sequence, reaction system and response procedures are as shown in table 2 below.
Table 2 primer sequence, reaction system and response procedures
2.3 order-checking
Pcr amplification product transfers to Hua Da gene sequencing (partial sequence is checked order by Ji Diao company), and must check order peak figure.Peak plot quality standard is that all base mass values (QV) are greater than 20, namely more than 99% accuracy.
2.4 data processing
Sequencing result adopts sequence assembly software CodonCode Aligner V3.7 (CodonCode Co, USA) check and correction splicing, removes inferior quality sequence and guiding region, obtains all standard bar code data.All standard bar code data importing sequence alignment program (MatGat2.01) will be obtained, default scoring matrix (Scoring Matrix:blosum50) is selected to carry out multiple ratio to (align), preserve calculation result (Similarity table) (numerical value reservation one decimal place), Format adjusting (two txt files needed for subsequent software TaxonGap, one is species name catalogue, one is species DNA sequence dna comparison result, i.e. similarity matrix), utilize software TaxonGap2.4.1 to carry out identification result analysis.
3. conclusion
3.1 each sequence successful rate statistics
Sample amounts to 41 parts, the result display after extracting through gene, increase and checking order: ITS2 sequence success 36, matK sequence success 29, successful 37 of psbA-trnH sequence, successful 41 (see table 1) of rbcL sequence.100% is up to rbcL sequence success ratio, easy-to-use in actually operating.
3.2 Sequence Identification effects
Interpretation of result is carried out under software TaxonGap2.4.1.Species name catalogue (Files-Data Files-Load) is imported at the main interface of software, under Biomarker option, import species DNA sequence dna comparison result (Biomarker-Add-Load-Save), other minor parameters can be arranged by reference software specification sheets.After operating software, (Run-Execute) obtains result.As shown in Figure 1, light bar length value in the kind that under certain mark (Biomarker) condition, species are corresponding on maximum variation value (Heterogeneity) i.e. schematic diagram, the dark bars length value between corresponding kind on minimum variation value (Separability) i.e. schematic diagram.If maximum variation value (Heterogeneity) value is less than minimum variation value (Separability) between kind in the kind of species, then mean that two species can distinguish.In Fig. 1, Rs is the abbreviation of Linearstripe Rabdosia Herb, and Rl is the abbreviation of Rabdosia lophanthoides, and Rlvg is the abbreviation of fine flower Herba Rabdosiae glaucocalycis.Result display in Fig. 1, for ITS2 sequence, the maximum variation value of the kind inside of Linearstripe Rabdosia Herb is 4.8, and Rabdosia lophanthoides and the inner maximum variation value of fine fragrance of a flower tea colza are 1.4, and between Linearstripe Rabdosia Herb and Rabdosia lophanthoides kind, minimum variation value is 15.1; For psbA-trnH sequence, the inner maximum variation value of the kind of Linearstripe Rabdosia Herb is 3.9, and in Rabdosia lophanthoides and fine fragrance of a flower tea colza, maximum variation value is 0; Between Linearstripe Rabdosia Herb and Rabdosia lophanthoides kind, minimum variation value is 25.4; In kind for rbcL sequence Linearstripe Rabdosia Herb, maximum variation value is 0.2, and in Rabdosia lophanthoides and fine fragrance of a flower tea colza, maximum variation value is 0; Between Linearstripe Rabdosia Herb and Rabdosia lophanthoides kind, minimum variation value is 1.4.Specifically see the following form 3.
Maximum variation value and minimum variation value between planting in the kind of table 3 Linearstripe Rabdosia Herb and Rabdosia lophanthoides
3.3 conclusion
3.3.1matK sequence success ratio is lower, and the species being unsuitable for this experiment are differentiated.
3.3.2 be up to 100% with rbcL sequence success ratio, and intraspecific variablity is minimum, is suitable for Linearstripe Rabdosia Herb and Rabdosia lophanthoides discriminating most.
3.3.3 " in planting the maximum variation value " of Linearstripe Rabdosia Herb is 0.2; " in planting the maximum variation value " of Rabdosia lophanthoides and fibre flower Herba Rabdosiae glaucocalycis is all 0; Linearstripe Rabdosia Herb and Rabdosia lophanthoides (containing mutation fibre flower Herba Rabdosiae glaucocalycis) " between kind minimum variation value " are 1.4; " between kind the minimum variation value " of Rabdosia lophanthoides and fibre flower Herba Rabdosiae glaucocalycis is 0, namely belongs to both undistinguishables of same kind.
Whether whether 3.3.4 experimentally result can find out that Rabdosia lophanthoides and fibre flower Herba Rabdosiae glaucocalycis belong to a kind together and cannot distinguish, be Linearstripe Rabdosia Herb as long as namely new species identify or be Rabdosia lophanthoides, without the need to again for the discriminating of fibre flower Herba Rabdosiae glaucocalycis.
3.3.5 Rabdosia lophanthoides and its mutation fibre flower Herba Rabdosiae glaucocalycis can not be distinguished; Linearstripe Rabdosia Herb and Rabdosia lophanthoides can being differentiated, meeting the needs of Chinese medicinal materials for " Chinese medicine origin identification is to planting ".
4rbcL sequence gene storehouse
According to method mentioned above, take genomic dna as template, adopt SEQ ID NO.42 and SEQID NO.43 as the rbcL gene order fragment of each sample of primer amplification, set up the gene pool comprising the rbcL gene order fragment of Linearstripe Rabdosia Herb and Rabdosia lophanthoides thus.Described gene pool comprises the rbcL gene order fragment shown in following sequence numbering: SEQ ID NO.1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41.Wherein, SEQ ID NO.1-8 is the rbcL gene order fragment being accredited as the sample of Linearstripe Rabdosia Herb with plant traditional taxonomy method; SEQ ID NO.9-15 is the rbcL gene order fragment being accredited as the sample of Rabdosia lophanthoides with plant traditional taxonomy method; SEQ ID NO.16-41 is the rbcL gene order fragment of the sample being accredited as Rabdosia lophanthoides (mutation fibre flower Herba Rabdosiae glaucocalycis) with plant traditional taxonomy method.
embodiment 2the discriminating of unknown Linearstripe Rabdosia Herb, Rabdosia lophanthoides plant species
The present embodiment adopts the sample of method provided by the invention to unknown Linearstripe Rabdosia Herb and Rabdosia lophanthoides plant species to differentiate.
Select doubtful but without qualification, Linearstripe Rabdosia Herb and Rabdosia lophanthoides, fresh or herb after drying, is divided into two parts, a with the qualification of traditional taxonomy method.In the present invention of another part, method therefor is differentiated.
The preparation of samples of method therefor in the present invention: except special indicating, medicinal material dries after using 75% aqueous ethanolic solution scrub surfaces, takes 5mg ~ 2g blade for subsequent use.
Adopt step described in embodiment 1 to extract the genomic dna in plant tissue blade, using SEQID NO.42 and SEQ ID NO.43 as primer amplification rbcL gene order fragment, condition is as shown in table 2.As described in Example 1, carry out PCR primer detection, order-checking, the acquisition of DNA bar code sequence, then carry out following result judgement.
The Linearstripe Rabdosia Herb the comprising rbcL gene order fragment rbcL gene order fragment of acquisition and embodiment 1 obtained and Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) gene pool comparison, carry out result judgement.Particularly by calculating variation value between kind of interior kind; For the Linearstripe Rabdosia Herb in gene pool and Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) sequence, calculate minimum variation value between the kind in the respective kind of Linearstripe Rabdosia Herb and Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) between maximum variation value and two species, when between the sequence after the gene fragment of new sample to be identified gene pool is therewith compared, minimum variation value (i.e. " between kind minimum variation value ") is equal to or less than greatest genetic distance in the kind that calculated, can be considered same species.
Specifically, the rbcL sequence peak map file obtained by measuring samples imports CodonCodeAligner V3.7 and splices, then hand inspection splicing effect, comprise (1) adjustment sequence forward and reverse (edit-reverse complement), (2) primer or other border sequences (sample-trimvector is removed ...), (3) check residue base mass value (qual needs to be more than or equal to 20), finally deriving concensus sequence is standard bar code data; These standard bar code data are imported sequence alignment program (MatGat2.01) together with the data in rbcL base sequence storehouse, default scoring matrix (ScoringMatrix:blosum50) is selected to carry out multiple ratio to (align), preserve calculation result (Similarity table), numerical value retains one decimal place, Format adjusting (two txt files needed for subsequent software TaxonGap, one is species name catalogue, one is species DNA sequence dna comparison result, i.e. similarity matrix); Software TaxonGap2.4.1 is utilized to check identification result: to import species name catalogue (Files-Data Files-Load) at the main interface of software, under Biomarker option, import species DNA sequence dna comparison result (Biomarker-Add-Load-Save), other minor parameters can be arranged by reference software specification sheets.After operating software, (Run-Execute) obtains result, in the suitable figure of txt file, check " between most microspecies variation value " that measuring samples is corresponding with Linearstripe Rabdosia Herb and Rabdosia lophanthoides, if " between most microspecies variation value " that measuring samples is corresponding with Linearstripe Rabdosia Herb is equal to or less than 0.2, can judge that these species to be checked are as Linearstripe Rabdosia Herb; If " most between microspecies variation value " that measuring samples and Rabdosia lophanthoides (comprising mutation fibre flower Herba Rabdosiae glaucocalycis) are corresponding is equal to or less than 0, can judge that these species to be checked are as Rabdosia lophanthoides.
After present method is differentiated, the conclusion obtained and traditional method contrast, and result is consistent.
But through comparing, present method is easy to get to the requirement of the requirement of sample than traditional method.
Sample needed for present method is position that certain on plant easily obtains DNA of plants, and Fresh Plants more easily obtains DNA of plants, usually adopts blade as the sample extracting DNA of plants, do not require the complete stool of plant or certain organ complete.
Tradition discrimination method needs maintenance can reflect feature plant position, during discriminating to unknown Linearstripe Rabdosia Herb and Rabdosia lophanthoides plant species, needs to keep that the form of stem is complete, blade is complete, to complete its character identification and microscopical identification; In conventional sorting methods, if plant has flower and fruit, then more can reflect that interspecific difference is other, but when using as Chinese medicinal materials, Linearstripe Rabdosia Herb and Rabdosia lophanthoides all to be gathered before flowering, be difficult to the form that flower and fruit are provided; These situations all cause the limitation of traditional discrimination method.
embodiment 3the discriminating of unknown Linearstripe Rabdosia Herb and Rabdosia lophanthoides medicine materical crude slice species
The present embodiment adopts the sample of method provided by the invention to unknown Linearstripe Rabdosia Herb and Rabdosia lophanthoides medicine materical crude slice species to differentiate.
Select doubtful but without qualification, the medicine materical crude slice of Linearstripe Rabdosia Herb and Rabdosia lophanthoides, is divided into two parts, a with the qualification of traditional taxonomy method.In the present invention of another part, method therefor is differentiated, differentiates that step is with embodiment 2.
After present method is differentiated, the conclusion obtained and traditional method contrast, and result is consistent.
But through comparing, present method is easy to get to the requirement of the requirement of sample than traditional method.
Sample needed for present method is position that certain on plant easily obtains DNA of plants, although medicine materical crude slice be dried with fragmentation after sample, its DNA is not destroyed, and still comparatively easily extracts and obtains.
Traditional taxonomy method is differentiated to need sample to keep reflecting the plant position of feature, during discriminating to unknown Linearstripe Rabdosia Herb, Rabdosia lophanthoides plant species, needs to keep that the form of stem is complete, blade is complete, to complete its character identification and microscopical identification; For segment but the medicine materical crude slice of above-mentioned requirements can be met, can be differentiated by traditional taxonomy method, but for medicine materical crude slice broken especially after cutting, to differentiate then there is larger difficulty by traditional taxonomy method.In conventional sorting methods, if plant has flower and fruit, then more can reflect that interspecific difference is other, but when using as Chinese medicinal materials, Linearstripe Rabdosia Herb and Rabdosia lophanthoides all to be gathered before flowering, be difficult to the form that flower and fruit are provided; These situations all cause the limitation of traditional discrimination method.
embodiment 4the species of the organ of known Linearstripe Rabdosia Herb and Rabdosia lophanthoides are differentiated
The present embodiment adopts method provided by the invention to differentiate known Linearstripe Rabdosia Herb and the blade of Rabdosia lophanthoides or the sample of stem, differentiates that step is with embodiment 2.
After present method is differentiated, the conclusion obtained is consistent with known results.
When only taking the sample of blade, stem or certain organ under traditional method, be difficult to confirm its plant species, but present method can be differentiated it.
Specific description of embodiments of the present invention does not above limit the present invention, and those skilled in the art can make various change or distortion according to the present invention, only otherwise depart from spirit of the present invention, all should belong to the scope of claims of the present invention.
Claims (9)
1. comprise a gene pool for the rbcL gene order fragment of Linearstripe Rabdosia Herb and Rabdosia lophanthoides, described gene pool comprises the rbcL gene order fragment shown in following sequence numbering: SEQ ID NO.1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41.
2. differentiate a method for Linearstripe Rabdosia Herb and Rabdosia lophanthoides plant species, described method comprises the step rbcL gene of plant to be identified or its sequence fragment and gene pool according to claim 1 compared.
3. method according to claim 2, is characterized in that, described method comprises the steps:
1) genomic dna of plant to be identified is extracted;
2) with step 1) genomic dna that obtains is template, amplification rbcL gene or its sequence fragment;
3) by step 2) the rbcL gene that obtains or its sequence fragment and gene pool according to claim 1 compare, thus differentiate the species of described plant to be identified.
4. method according to claim 3, is characterized in that, described step 2) in adopt following sequence to increase from the genomic dna of described plant to be identified rbcL gene order fragment as primer: SEQ ID NO.42 and SEQ ID NO.43.
5. the method according to claim 3 or 4, it is characterized in that, described step 3) in by by step 2) compare between existing sequence in the rbcL gene that obtains or its sequence fragment and gene pool according to claim 1, obtain the similarity between existing sequence in the sequence of described plant to be identified and gene pool, thus differentiate the species of described plant to be identified.
6. the method according to any one of claim 3 to 5, it is characterized in that, described step 3) in by step 2) the rbcL gene that obtains or its sequence fragment and gene pool according to claim 1 compare, the corresponding species that similarity is the highest or matching degree is the highest or genetic distance is minimum are the species of plant to be identified.
7.rbcL gene or its sequence fragment are differentiating the purposes in Rabdosia lophanthoides and Linearstripe Rabdosia Herb.
8. purposes according to claim 7, is characterized in that, described rbcL gene order fragment is obtain by adopting following sequence to increase from the genomic dna of plant to be identified as primer: SEQ ID NO.42 and SEQ ID NO.43.
9. gene pool according to claim 1 is differentiating the purposes in Rabdosia lophanthoides and Linearstripe Rabdosia Herb.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410189583.7A CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410189583.7A CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404629A true CN104404629A (en) | 2015-03-11 |
| CN104404629B CN104404629B (en) | 2017-01-25 |
Family
ID=52642291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410189583.7A Active CN104404629B (en) | 2014-05-06 | 2014-05-06 | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404629B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132549A (en) * | 2015-08-31 | 2015-12-09 | 中国农业科学院植物保护研究所 | Vigna radiata specific PCR (polymerase chain reaction) primer pair and method for detecting vigna radiata in phytophagous insect bodies |
| CN107190090A (en) * | 2017-07-19 | 2017-09-22 | 福建农林大学 | The molecular identificalion primer and method of a kind of Chinese lobelia and Mazus japonicus |
| CN110079593A (en) * | 2019-05-08 | 2019-08-02 | 中国环境科学研究院 | A kind of discrimination method of artemisiifolia, Ambrosia trifida |
| CN110890134A (en) * | 2019-10-31 | 2020-03-17 | 南京师范大学 | Method for identifying dendrobium candidum base source by using chloroplast genome large single copy area |
| CN113755626A (en) * | 2021-09-14 | 2021-12-07 | 广州中医药大学(广州中医药研究院) | Rabdosia lophanthide molecular identification kit and identification method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191318A (en) * | 2011-03-04 | 2011-09-21 | 广州中医药大学 | Application of nucleotide sequence of rDNA (recombinant deoxyribonucleic acid) ITS (internal transcribed spacer)-D3 region in establishment of DNA (deoxyribonucleic acid) bar code identification system for medicinal plants |
| CN102978208A (en) * | 2012-12-11 | 2013-03-20 | 中国科学院植物研究所 | Specific primer pair for identification of spermatophyte species and applications of specific primer pair |
| CN103305620A (en) * | 2013-06-26 | 2013-09-18 | 中国科学院植物研究所 | Specific primer pair based on rbcL gene and used for identifying land plant species and application thereof |
-
2014
- 2014-05-06 CN CN201410189583.7A patent/CN104404629B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191318A (en) * | 2011-03-04 | 2011-09-21 | 广州中医药大学 | Application of nucleotide sequence of rDNA (recombinant deoxyribonucleic acid) ITS (internal transcribed spacer)-D3 region in establishment of DNA (deoxyribonucleic acid) bar code identification system for medicinal plants |
| CN102978208A (en) * | 2012-12-11 | 2013-03-20 | 中国科学院植物研究所 | Specific primer pair for identification of spermatophyte species and applications of specific primer pair |
| CN103305620A (en) * | 2013-06-26 | 2013-09-18 | 中国科学院植物研究所 | Specific primer pair based on rbcL gene and used for identifying land plant species and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| CHEN,S.-L.: "HQ839682.1", 《GENBANK》 * |
| 邓乔华，等: "《2010版《中国药典》溪黄草基原及溪黄草鉴别方法的探讨》", 《广东省医学会第九次医学历史学术会议暨第五届岭南医学研讨会 》 * |
| 高蝶娜 范志高: "基于psbA-trnH 序列鉴别溪黄草及其习用品的研究", 《江西中医药》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132549A (en) * | 2015-08-31 | 2015-12-09 | 中国农业科学院植物保护研究所 | Vigna radiata specific PCR (polymerase chain reaction) primer pair and method for detecting vigna radiata in phytophagous insect bodies |
| CN107190090A (en) * | 2017-07-19 | 2017-09-22 | 福建农林大学 | The molecular identificalion primer and method of a kind of Chinese lobelia and Mazus japonicus |
| CN110079593A (en) * | 2019-05-08 | 2019-08-02 | 中国环境科学研究院 | A kind of discrimination method of artemisiifolia, Ambrosia trifida |
| CN110890134A (en) * | 2019-10-31 | 2020-03-17 | 南京师范大学 | Method for identifying dendrobium candidum base source by using chloroplast genome large single copy area |
| CN113755626A (en) * | 2021-09-14 | 2021-12-07 | 广州中医药大学(广州中医药研究院) | Rabdosia lophanthide molecular identification kit and identification method |
| CN113755626B (en) * | 2021-09-14 | 2023-06-20 | 广州中医药大学(广州中医药研究院) | Molecule identification kit and identification method for rabdosia lophanthide |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404629B (en) | 2017-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104404129B (en) | DNA bar code differentiates rabdosia lophanthide and its method closely belonged to | |
| Arulandhu et al. | Development and validation of a multi-locus DNA metabarcoding method to identify endangered species in complex samples | |
| Kojoma et al. | DNA fingerprinting of Cannabis sativa using inter-simple sequence repeat (ISSR) amplification | |
| CN104404629A (en) | DNA identification method of Isodon serra(Maxim.)Kudo and Rabdosia lophanthoides (Buch.-Ham. ex D. Don) Hara var. graciliflora (Benth.) Hara | |
| Ma et al. | Unusual patterns of hybridization involving a narrow endemic Rhododendron species (Ericaceae) in Yunnan, China | |
| CN103484558B (en) | Molecular identification method of Yunnan manyleaf Paris rhizome | |
| CN104293778B (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| Adhikary et al. | Morphologic and taxonomic analysis of the weedy and cultivated Amaranthus hybridus species complex | |
| CN107502665A (en) | Differentiate the method for locust tree kind based on Capillary Electrophoresis fluorescence SSR finger-prints | |
| CN110195126A (en) | SSR core primers group and its application based on bitter buckwheat full-length genome data mining | |
| Zhang et al. | Genetic diversity and population structure of cannabis based on the genome-wide development of simple sequence repeat markers | |
| CN105969879A (en) | High-throughput primer set and detection method for detection of AhFAD2A gene mutation site typing | |
| CN108265123B (en) | Kit and method for identifying paris polyphylla genuine product and different genotypes | |
| CN113151542B (en) | Development method and application of Huashansong genome SNP | |
| CN105002272A (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN107164525B (en) | A kind of DNA for differentiating 6 kinds of Pterocarpus timber combines bar code and its discrimination method and application | |
| Matielo et al. | Whole Plastome Sequences of Two Drug‐Type Cannabis: Insights Into the Use of Plastid in Forensic Analyses | |
| CN111808983B (en) | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof | |
| Zhang et al. | RAPD fingerprint construction and genetic similarity of Mesona chinensis (Lamiaceae) in China | |
| CN107365840A (en) | Animal in deer family Rapid identification kit and its application based on DNA bar code | |
| CN103509871A (en) | Method for identifying DNA barcodes of three gentiana macrophylla medicinal materials in pharmacopeia | |
| CN106544438A (en) | A kind of application of genetic marker in purpleapricot identification | |
| CN116064921A (en) | SNP locus combination for identifying honeysuckle varieties, primer combination and method for identifying honeysuckle varieties | |
| CN106755431A (en) | A kind of method for identifying cynomorium songaricum | |
| CN109055603A (en) | A method of building paris plant finger-print is marked using CDDP |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |