CN104611424B - The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product - Google Patents
The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product Download PDFInfo
- Publication number
- CN104611424B CN104611424B CN201510016355.4A CN201510016355A CN104611424B CN 104611424 B CN104611424 B CN 104611424B CN 201510016355 A CN201510016355 A CN 201510016355A CN 104611424 B CN104611424 B CN 104611424B
- Authority
- CN
- China
- Prior art keywords
- radix
- apioris fortunei
- pcr
- lespedezae buergeri
- product
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
- C12Q1/683—Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of molecular marker, discloses a kind of PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product, including：1st, extract medical material DNA；2nd, enter performing PCR amplification with forward and reverse primer of the Internal Transcribed Spacer ITS2 sequences of pair for amplification rDNA；3rd, restricted enzyme NCO I digestion PCR primer；4th, agarose gel electrophoresiies analysis.2 DNA fragmentations are produced after medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) DNA cloning product enzymic digestion, size is respectively 335bp and 200bp or so, and various pseudo- mixed product are not recognized by NCO I enzymes.The present invention mixes the difference of product DNA sequence using Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its puppet, establish quick, convenient, reliable PCR RFLP discrimination methods, Radix Apioris Fortunei (Radix Lespedezae Buergeri) medical material can be differentiated and pseudo- mixed product whether have been mixed into, overcome the methods such as sense organ or physico-chemical analysis to be difficult to differentiate the technical problem of the Radix Apioris Fortunei (Radix Lespedezae Buergeri) true and false, ensure Radix Apioris Fortunei (Radix Lespedezae Buergeri) medical material drug safety.
Description
Technical field
The invention belongs to molecular marking technique field, more particularly to a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product
PCR-RFLP methods.
Background technology
Radix Apioris Fortunei (Radix Lespedezae Buergeri) (Tetrastigma hemsleyanum) also known as gold thread hoist, are that Vitaceae Tetrastigma is perennial
Herbaceous plant, wants medicinal part based on its underground tuber, can be used to treat hyperpyrexia, hepatitis, rheumatic arthritis and viral brain
Various diseases such as film inflammation, and antitumor common drug.The plant wild resource is endangered at present, and which is to growing environment
Requirement is very harsh, and artificial culture difficulty is big, and development and utilization is extremely restricted.Due to scarcity of resources, demand is big, and three
Leaf green grass or young crops price constantly rises, and various pseudo- mixed product such as Radix Apioris Fortunei, big Sinomenium acutum, Aconitum carmichjaelii Debx. daughter root, quality of medicinal material are occurred in that in medicinal material market
Extremely unstable, or even there occurs that patient takes the phenomenon of the fake and inferior Radix Apioris Fortunei (Radix Lespedezae Buergeri) medical material poisoning for being mixed with Aconitum carmichjaelii Debx. daughter root.To ensure Chinese medicine
Quality of medicinal material and drug safety, the identification to Radix Apioris Fortunei (Radix Lespedezae Buergeri) medical material base plant are extremely important.
The traditional identification of means of Chinese crude drug is used mostly according to its formalness and microstructure at present, but due to
The most formalness of plant daughter root class medical material is similar, and after place of production roughing and process of preparing, it is difficult to find out itself
Shape and color, microscopic features also have different degrees of destruction, cause identification difficult.Chinese crude drug germplasm Molecular Identification technology is not received
Growth and development stage, confession examination position, the impact of environmental condition, directly carry out the identification of species, with an only nothing using DNA sequence
Two accuracy and repeatability, and the primer is few, stability and versatility are high, experimentation standardization, simple to operate fast
Speed.Chinese patent application 201310373809.4 discloses a kind of method of identification medicinal plants Radix Apioris Fortunei (Radix Lespedezae Buergeri), and this is based on ISSR
The Radix Apioris Fortunei (Radix Lespedezae Buergeri) method for identifying molecules of molecular marker.Whether the technology can successfully differentiate Radix Apioris Fortunei (Radix Lespedezae Buergeri) by a pair of primer amplified
Common pseudo- mixed product, but to which, some nearly edge species also have positive findingses, and discrimination is not high, and do not verify in big Sinomenium acutum, Aconitum carmichjaelii Debx.
The suitability during the common pseudo- mixed tasting such as root is fixed, additionally needs a pair of specific primers of synthesis in advance.Interior turn of plant core rDNA
Record spacer (internal transcribed spacer, ITS) includes the ITS1 and ITS2 separated by 5.8SrDNA two
Fragment, the existing universal primer sequence of PCR amplifications, and sequencing is simple, ITS sequence variation is very fast, can provide more rich
Variant sites and informative site.PCR-RFLP is used for existing some successful examples of discriminating of sibling specieses, with quick, simple, accurate
Really the advantages of, but it is this differentiate to different species, primer used, PCR amplification conditions, the species of restricted enzyme and mirror
Other method is different from.The report of molecular identificalion is not carried out at present using PCR-RFLP technologies to Radix Apioris Fortunei (Radix Lespedezae Buergeri) still.
DNA bar code technology is analyzed by the DNA short-movie sections to a standard genes of interest, so as to quick, accurate
The technology of species identification is carried out really.DNA bar code concepts are to be carried by Canadian zoologist Paul Hebert first for 2003
Go out, using the relatively short stranded DNA fragment for having variation enough and easily expand, the specificity in kind is various with inter-species
A kind of new biological status identification system set up in property, it is achieved thereby that species are fast and accurately recognized and identified.
The ideal sequence of DNA bar code has 3 basic criterions：(1) sequence variations level is suitable, can be by different plant species area each other
Separate, while intraspecific variablity is less；(2) sequence at variable region two ends is highly conserved, can design steady in numerous species
The universal primer of fixed amplification；(3) extension increasing sequence is as far as possible short, and most what a reaction can complete sequencing.
DNA bar code is affected not by growth and development stage, for examination position, environmental condition, is directly carried out using DNA sequence
The identification of species, with unique accuracy and repeatability, and the primer is few, and stability and versatility are high, experiment
Process standardization, and can be shared by database realizing and DNA sequence can be converted into two-dimensional bar image and be applied to put into practice.
Focus candidate sequence has rbcL, matK, psbA-trnH, ITS2 etc. so far, but does not also obtain extensively general DNA of plants bar shaped
Code standard fragment.The deep Lignum Rhamnellae research of symbol finds that ITS, bcL+matK+ITS are to identify Radix Apioris Fortunei (Radix Lespedezae Buergeri) and other Tetrastigma plants most
Good bar code, Radix Apioris Fortunei (Radix Lespedezae Buergeri) can by ITS, ITs+rbcL, ITS+matK, ITs+trnH-psbA, matK+rbcL,；bcL+trnH-
PsbA and 2+x combination bar code precise Identifications (《The Idioplasm identification of medicinal plants Radix Apioris Fortunei (Radix Lespedezae Buergeri) and tissue-culturing rapid propagation research》, Zhejiang University
Master thesis, 2011).The method is firstly the need of extraction DNA of plants, then enters performing PCR amplification, by surveying to amplified production
Sequence and comparison could judge the species of the plant, be not suitable for Rapid identification.There was only other Tetrastigma plants in Genbank at present
Mao Zhiya climbs the ITS2 gene orders of rattan, Tetrastigma planicaule etc., does not also have the related gene sequence of Radix Apioris Fortunei (Radix Lespedezae Buergeri) ITS2, therefore this area is special
Do not need to set up the rapid identification method of Chinese medicine Radix Apioris Fortunei (Radix Lespedezae Buergeri).
The PCR-RFLP methods that the present invention is provided can realize the Rapid identification of Radix Apioris Fortunei (Radix Lespedezae Buergeri), improve the accuracy of qualification result.
The content of the invention
In order to set up the rapid identification method of Chinese medicine Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product, the DNA bar code of Chinese medicine Radix Apioris Fortunei (Radix Lespedezae Buergeri) is realized
Detection, the present invention are realized by the following method the purpose of the present invention.
A kind of PCR-RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product are established, including extracts medical material DNA and fine jade
Sepharose electrophoretic analysiss, are carried out with forward and reverse primer of the Internal Transcribed Spacer (ITS2) sequence of pair for amplification rDNA
PCR is expanded and is used digestion with restriction enzyme PCR primer, judges medicine according to enzymic digestion product agarose gel electrophoresiies analysis result
The true and false of material Radix Apioris Fortunei (Radix Lespedezae Buergeri) and whether it is mixed with pseudo- mixed product.
The Internal Transcribed Spacer (ITS2) of the PCR amplification genes of the present invention for rDNA, is SEQ ID NO.3 institutes
The gene order shown.
Pcr amplification primer thing of the present invention is the nucleotide sequence shown in SEQ ID NO.1 and SEQ ID NO.2, wherein positive
Primer is the nucleotide sequence shown in SEQ ID NO.1, and reverse primer is the nucleotide sequence shown in SEQ ID NO.2.
The restricted enzyme for using is Nco I, and its recognition sequence is CCATGG.
The genetic fragment size of PCR amplifications is 400～600bp, wherein preferably 490～550bp, is particularly preferred to be
533bp。
There are 335bp and 200bp bands in medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample electrophoresis analysis after digestion with restriction enzyme, and its puppet is mixed
The DNA cloning product of product is not by digestion with restriction enzyme.
PCR reaction conditions of the present invention are：95 DEG C of denaturations 5min；Subsequently into circulation, 95 DEG C of degeneration 30 seconds, 45
～55 DEG C are annealed 30 seconds, and 72 DEG C extend 40 seconds, 25～35 circulations；Last 72 DEG C extend 10 minutes.Wherein preferred annealing temperature
Spend for 55 DEG C, preferred PCR cycle is 35.
The digestion with restriction enzyme reaction condition of pcr amplification product is：10 μ L PCR primers, 2 10 × enzyme action of μ L buffering
Liquid, 8 μ L sterilizing ultra-pure waters, 5～25U restricted enzyme, 20～37 DEG C of constant temperature 2～8 hours, wherein preferred restriction enzyme
Enzyme addition is 20U, and 37 DEG C of reaction temperature, time are 4 hours.
The quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its PCR-RFLP methods of pseudo- mixed product that the present invention is provided can realize the quick of Radix Apioris Fortunei (Radix Lespedezae Buergeri)
Identification, improves the accuracy of qualification result, has the advantage that compared with prior art and good effect：
1st, method provided by the present invention can fast and effectively realize the authenticity of Radix Apioris Fortunei (Radix Lespedezae Buergeri).Reflect with traditional morphology
Determine method and other molecule labelling methods are compared, can effectively shorten the qualification time of Radix Apioris Fortunei (Radix Lespedezae Buergeri), needed using the inventive method identification
6～8h times are wanted, the purpose of Rapid identification has been reached, because the identification of species is carried out using DNA sequence difference, with an only nothing
Two accuracy and repeatability, and the primer is few, stability and versatility are high, increased the resolution to nearly edge species,
Considerably increase the accuracy of identification.
2nd, the invention provides the reaction condition of a pair of PCR universal primers, a kind of restricted enzyme needed for identification and
Endonuclease reaction condition, compared with existing Radix Apioris Fortunei (Radix Lespedezae Buergeri) molecular identification method, all SANYE to having now been found that on market of the invention
Blue or green puppet mixes product and which belongs to nearly edge species together and can realize effectively discriminating.
Description of the drawings
Fig. 1 is agarose gel electrophoresiies analysis PCR primer result；
Swimming lane 1：DNA Marker, from top to bottom 400bp, 500bp, 700bp, 900bp, 1500bp；
Swimming lane 2：From Lishui of Zhejiang Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 3：From plant resources in Wenling Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 4：From Xiangshan of Zhejiang Province Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 5：From Guangxi Tianlin County Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 6：Work in peace and contentment Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample from Guangxi；Swimming lane 7：From Hunan Shaoyang Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 8：From yiyang, hunan Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 9：From Hunan Yuanling Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 10：From Jiangxi Wan An Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 11：From Jiangxi Shangrao Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 12：Radix Apioris Fortunei sample；Swimming lane 13：Aconitum carmichjaelii Debx. sample；
Swimming lane 14：Big Sinomenium acutum sample；Swimming lane 15：Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Tetrastigma planicaule sample；
Swimming lane 16：Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Mao Zhiya climbs rattan sample.
Fig. 2 is Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample P CR product sequencing partial sequence；
Fig. 3 is agarose gel electrophoresiies analysis digestion with restriction enzyme PCR primer result；
Swimming lane 1：DNA Marker, from top to bottom 400bp, 400bp, 500bp, 700bp, 900bp, 1500bp；
Swimming lane 2：From Lishui of Zhejiang Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 3：From plant resources in Wenling Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 4：From Xiangshan of Zhejiang Province Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 5：From Guangxi Tianlin County Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 6：Work in peace and contentment Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample from Guangxi；Swimming lane 7：From Hunan Shaoyang Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 8：From yiyang, hunan Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 9：From Hunan Yuanling Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 10：From Jiangxi Wan An Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；Swimming lane 11：From Jiangxi Shangrao Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample；
Swimming lane 12：Radix Apioris Fortunei sample；Swimming lane 13：Aconitum carmichjaelii Debx. sample；
Swimming lane 14：Big Sinomenium acutum sample；Swimming lane 15：Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Tetrastigma planicaule sample；
Swimming lane 16：Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Mao Zhiya climbs rattan sample.
Fig. 4 is the PCR-RFLP identity process figures of medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product.
Specific embodiment
The present invention is further illustrated with reference to specific embodiment, but and the non-limiting present invention.
The extraction of one medical material DNA of embodiment
Radix Apioris Fortunei (Radix Lespedezae Buergeri) and various medical material samples are collected, CTAB (the cetyl trimethyl bromination general using DNA of plants is extracted
Ammonium) method or using plant genome DNA extraction agent box extract sample DNA.
1st, sample about 0.5g is taken in mortar, liquid feeding nitrogen is ground into fine powder, carefully proceeds in 2ml centrifuge tubes；
2nd, 2%CTAB extracts (CTAB 4g, NaCl 16.364g, the 1M Tris-HCl of 700 μ L, 65 DEG C of preheatings are added
20ml (pH8.0), 0.5M EDTA 8ml, are first dissolved with 70ml ddH2O, then are settled to 200ml sterilizings, and 0.2- is added after cooling
1% beta -mercaptoethanol), after fully mixing, 40min is incubated in 65 DEG C of water-baths, is gently shaked frequently therebetween；
3rd, centrifuge tube is taken out, 12000r/min centrifugation 10min suction out supernatant with micropipettor, are put into clean centrifugation
Guan Zhong, adds isopyknic chloroform-isoamyl alcohol (24:1), fully mix, 12000r/min centrifugation 10min；
4th, supernatant is transferred in another centrifuge tube, plus chloroform-isoamyl alcohol (24:1) 2～3 times are washed with method repetition,；
5th, supernatant is taken, the isopropanol of -20 DEG C of precoolings of 0.6 times of volume is added, -20 DEG C of 2h are placed；
6th, 12000r/min centrifugations 10min, takes precipitation, respectively washed once with 75% ethanol and dehydrated alcohol respectively, air-dries
TE (10mM Tris-HCl, 1mM EDTA, PH8.0) buffer solution is used afterwards；
7th, DNA sample quality examination：Take 5 μ L DNA samples, 1.0% agarose gel electrophoresiies, voltage 120V, electrophoresis time
Gel is dyeed after terminating by about 30min, electrophoresis with 0.5 μ g/mL EB, and DNA bands are detected under ultraviolet gel imaging system.
The PCR amplifications of two medical material DNA of embodiment
1st, primer sequence is designed according to the Internal Transcribed Spacer of rDNA, forward primer is shown in SEQ ID NO.1
Nucleotide sequence：5’ATGCGATACTTGGTGTGAAT 3’；Reverse primer is the nucleotide sequence shown in SEQ ID NO.2：5’
GACGCTTCTCCAGACTACAAT 3’。
2nd, PCR amplifications are 25 μ L reaction systems, are consisted of the following composition：
3rd, amplification program：95 DEG C of denaturations 5min；Subsequently into circulation, 95 DEG C of degeneration 30sec, 55 DEG C of annealing 30sec, 72
DEG C extend 40sec, 35 circulation；Finally extend 72 DEG C of 10min.
4th, pcr amplification product quality examination：Take 5 μ LDNA samples, 2% agarose gel electrophoresiies, voltage 120V, during electrophoresis
Between about 30min, gel dyes after terminating by electrophoresis with 0.5 μ g/mL EB, and DNA bands are detected under ultraviolet gel imaging system,
As a result such as Fig. 1.
The sequence analysis of three PCR primer of embodiment
Taking PCR primer carries out DNA sequencing, and using two-way sequencing, part sequencing peak figure is shown in Fig. 2, and sequencing results are SEQ
Nucleotide sequence shown in ID NO.3, the sequence ' and 3 ' primer sequences held not comprising 5.Determine from Lishui of Zhejiang, temperature
Ridge, Xiangshan, Guangxi Tianlin County, work in peace and contentment, Hunan Shaoyang, Yiyang, Yuanling, Jiangxi Wan An, the Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample in Shangrao and other nearly edge
Kind Radix Apioris Fortunei, Aconitum carmichjaelii Debx., big Sinomenium acutum, Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Tetrastigma planicaule, Mao Zhiya climb the pcr amplification product sequence of rattan, pass through
Sequence analysis, the restrictive restriction endonuclease Nco I recognition sequence CCATGG of Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample sequence, and other nearly edge samples exist
The not no enzyme recognition site near 315bp.
The restricted enzyme action digestion reaction of example IV
Following composition is added in 0.5ml sterile centrifugation tubes：
37 DEG C of constant temperature enzyme action 4 hours, wherein 10X buffer are consisted of：10mM Tris-HCL, 100mM KCL, 1mM
EDTA, 1mM DTT, 0.2mg/mL BSA, 50% glycerol.
Five agarose gel electrophoresiies of embodiment are analyzed
The endonuclease reaction product for taking appropriate step 4 is separated with 2% sepharose electrophoresis, voltage 120V, and electrophoresis time is about
Gel is dyeed after terminating by 40min, electrophoresis with 0.5 μ g/mL EB, if sample has two bands, size respectively may be about 335bp and
200bp, is as a result shown in Fig. 3, then test sample is Radix Apioris Fortunei (Radix Lespedezae Buergeri), if still the band or band molecular weight for 500bp or so is different from
Above-mentioned size, then test sample non-Radix Apioris Fortunei (Radix Lespedezae Buergeri) source or be contaminated with the mixed product of other puppets.
The PCR-RFLP identifications of six medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) of embodiment and its pseudo- mixed product
The PCR-RFLP identifications of medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product are carried out by the qualification program flow chart of Fig. 4, to be measured
Separation and Extraction DNA in plant tissue, with the DNA as template pair of primers：Forward primer is SEQ ID NO.1 sequences, reversely
Primer is SEQ ID NO.2 sequences, adds each reactive component by table one, amplifies ITS by PCR2Gene, amplification program is：
95 DEG C of denaturations 5min；Subsequently into circulation, 95 DEG C of degeneration 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 40sec, 35 are followed
Ring；Finally extend 72 DEG C of 10min.
Table one, PCR is loaded table
Then take appropriate above-mentioned pcr amplification product to be separated by electrophoresis with 2% agarose gel, after ethidium bromide staining
Observe under uviol lamp, according to the size result of determination of amplified production.If the band for amplifying is near 500bp, and band
Single then explanation expand successfully without miscellaneous band and primer band, recovery amplified production；
In pcr amplification product, restricted enzyme NCO I is added to carry out endonuclease reaction, endonuclease reaction condition is:10μL
PCR primer, 2 μ L 10 × Dilution Buffer (10mM Tris-HCL, 100mM KCL, 1mM EDTA, 1mM DTT,
0.2mg/mL BSA, 50% glycerol), 18 μ L sterilizing ultra-pure waters, 20U NCO I, 37 DEG C of temperature bath 4h；
Take appropriate step endonuclease reaction product to be separated with 2% sepharose electrophoresis, if sample there are two bands, size is respectively about
For 335bp and 200bp, then test sample is Radix Apioris Fortunei (Radix Lespedezae Buergeri).If still there is the amplified fragments of 500bp or so sizes after enzyme action,
The medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) is mixed with pseudo- mixed product.
<110>Zhejiang Pharmaceutical College
<120>The PCR-RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- mixed product
<160> 3
<170> PatentIn Version 2.1
<210> 1
<211> 20
<212> DNA
<213>Primer sequence
<400> 1
1 atgcgatact tggtgtgaat
<210> 2
<211> 21
<212> DNA
<213>Primer sequence
<400> 2
1 gacgcttctc cagactacaa t
<210> 3
<211> 492
<212> DNA
<213>It is natural
<220>
<221> misc_feature
<222> (80,100,112)
<223>N=a or g or c or t
<220>
<221> ITS2
<222> (1)...(492)
<400> 3
1 cggggggaag ccgattctca gctgggcttt tcccggttcg ctcgccgtta
51 ctaagggaat ccttgtaagt ttcttttcct ccgcttattg atatgcttaa
101 actcagcggg tgttcccgcc tgacctgggg tcgctgtcga ggttctcggg
151 cctttcgtgg tgccccgttg cgaagtgccg cgcccgacat ggagattctc
201 ctccttcctc ctctggacga gggggaaagg atcaggggtt cgtttcaaac
251 caccgcttgt cgtggcgtgc atcgccgcgg gacagatttt taaccaacca
301 cggatgcgat gttccatggg aggccaatgt ccgccccaac tccaagcccc
351 tgactcggta ggggtggagg gggcgacgcg tgcgtgacgc ccaggcaggc
401 gtgccctcga cctaatggcg tcgggcgcaa cttgcgttca aagactcgat
451 gattcacggg attctgcaat tcacaccagt aattcgcata ta
Claims (6)
1. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its pseudo- PCR-RFLP methods for mixing product, including extraction medical material DNA and agarose gel
Electrophoretic analysiss, it is characterised in that carried out with forward and reverse primer of the internal transcribed spacer sequence of pair for amplification rDNA
PCR is expanded and is used digestion with restriction enzyme PCR primer, judges medicine according to enzymic digestion product agarose gel electrophoresiies analysis result
The true and false of material Radix Apioris Fortunei (Radix Lespedezae Buergeri) and pseudo- mixed product whether are mixed with, its criterion is that medical material Radix Apioris Fortunei (Radix Lespedezae Buergeri) sample electrophoresis are analyzed after enzymic digestion
Existing 335bp and 200bp bands, and the DNA cloning product of the mixed product of its puppet is not by digestion with restriction enzyme；
The pseudo- mixed product of described Radix Apioris Fortunei (Radix Lespedezae Buergeri) are that Radix Apioris Fortunei, Aconitum carmichjaelii Debx., big Sinomenium acutum, Radix Apioris Fortunei (Radix Lespedezae Buergeri) kindred plant Tetrastigma planicaule, Mao Zhiya climb rattan；
Above-mentioned pcr amplification primer thing is the nucleotide sequence described in SEQ ID NO.1 and SEQ ID NO.2, and wherein forward primer is
Nucleotide sequence shown in SEQ ID NO.1, reverse primer are the nucleotide sequence shown in SEQ ID NO.2；
The restricted enzyme for using is NCO I, and its recognition sequence is CCATGG.
2. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) as claimed in claim 1 and its puppet mix the PCR-RFLP methods of product, it is characterised in that
The Internal Transcribed Spacer of the PCR amplification genes for rDNA, is the gene order shown in SEQ ID NO.3.
3. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) as claimed in claim 1 and its puppet mix the PCR-RFLP methods of product, it is characterised in that
The genetic fragment size of PCR amplifications is 400 ~ 600bp.
4. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) as claimed in claim 1 and its puppet mix the PCR-RFLP methods of product, it is characterised in that
The genetic fragment size of preferred PCR amplifications is 480 ~ 550bp.
5. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) as claimed in claim 1 and its puppet mix the PCR-RFLP methods of product, it is characterised in that
Described PCR reaction conditions are：95 DEG C of denaturations 5min；Subsequently into circulation, 95 DEG C of degeneration 30 seconds, 45 ~ 55 DEG C are annealed 30 seconds,
72 DEG C extend 40 seconds, 25 ~ 35 circulations；Last 72 DEG C extend 10 minutes.
6. a kind of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) as claimed in claim 1 and its puppet mix the PCR-RFLP methods of product, it is characterised in that
The digestion with restriction enzyme reaction condition of pcr amplification product is：10 μ L PCR primers, 2 μ 10 × enzyme cutting buffering liquids of L, 8 μ L are gone out
Bacterium ultra-pure water, 5 ~ 25U restricted enzyme, 20 ~ 37 DEG C of constant temperature 2 ~ 8 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016355.4A CN104611424B (en) | 2015-01-13 | 2015-01-13 | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016355.4A CN104611424B (en) | 2015-01-13 | 2015-01-13 | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611424A CN104611424A (en) | 2015-05-13 |
| CN104611424B true CN104611424B (en) | 2017-03-29 |
Family
ID=53146071
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510016355.4A Active CN104611424B (en) | 2015-01-13 | 2015-01-13 | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611424B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105936933B (en) * | 2016-05-11 | 2019-11-12 | 浙江医药高等专科学校 | The method for identifying the radix tetrastigme true and false is efficiently visualized with DNA analogue enztme |
| CN106555000A (en) * | 2016-11-10 | 2017-04-05 | 湖北省食品质量安全监督检验研究院 | A kind of method of plant derived component in plant identification protein beverage |
| CN107164487A (en) * | 2017-06-07 | 2017-09-15 | 苏州市李良济健康产业有限公司 | A kind of primer pair and its application for Identification chinese herbs medicine Chinese yew |
| CN107630014B (en) * | 2017-10-19 | 2018-08-31 | 中国科学院昆明植物研究所 | A kind of identification method of Aconitum transsectum DNA bar code and Aconitum transsectum based on big data |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5876977A (en) * | 1997-01-03 | 1999-03-02 | The Chinese University Of Hong Kong | Polymerase chain reaction-restriction fragment length polymorphism test for the authentication of traditional chinese medicines |
| CN103421907B (en) * | 2013-08-24 | 2015-08-05 | 浙江大学 | A kind of method identifying medicinal plant Radix Apioris Fortunei (Radix Lespedezae Buergeri) |
-
2015
- 2015-01-13 CN CN201510016355.4A patent/CN104611424B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611424A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898235B (en) | A kind of DNA bar code method for identifying molecules of Hirudo | |
| CN104611424B (en) | The PCR RFLP methods of quick discriminating Radix Apioris Fortunei (Radix Lespedezae Buergeri) and its various pseudo- mixed product | |
| CN102505045B (en) | Method for fast identifying ginseng and American ginseng | |
| CN103602738B (en) | Multiple PCR (Polymerase Chain Reaction) primer and method for quickly identifying variety of scallops | |
| CN105063036B (en) | The molecular labeling of Xanthomonas oryzae pv oryzae and its application | |
| CN107557434A (en) | Thin shell mountain pecan Peach cultivars Van Deman characteristic sequence, labeled primer and authentication method | |
| CN104480202B (en) | A kind of Fructus Luffae reference gene and application thereof | |
| CN107475449A (en) | A kind of transcript profile sequence measurement spliced suitable for dwarf virus section and geminivirus infection coe virus genome | |
| CN104073550B (en) | A kind of SCAR molecular marker differentiating Fructus Momordicae sex | |
| CN107164471B (en) | Molecular identification method for rapidly identifying truth of beauveria bassiana in traditional Chinese medicine stiff silkworm | |
| CN105002272B (en) | Method for identifying varieties of RAPD (random amplified polymorphic DNA) marked panax japonicus and kindred plants thereof | |
| CN105543373A (en) | Rapid molecular identification method for glycyrrhiza uralensis, glycyrrhiza glabra, glycyrrhiza inflate and hybrid variety thereof | |
| CN102337347A (en) | Characteristic nucleotide sequence for identifying ophiocordyceps crinalis, as well as probes and method thereof | |
| KR102283638B1 (en) | Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars | |
| CN105176995B (en) | Thalassemia α can be detected simultaneously based on hydrolysis probes method21.9The kit that deletion form and α 2 make a variation | |
| CN109609679A (en) | Identify characteristic nucleotide sequence, nucleic acid molecular probe, kit and the method for ganoderma strain GIMS1524 | |
| CN105936933A (en) | Method for efficiently and visually discriminating authenticity of Tetrastigma hemsleyanum Diels et Gilg by using DNA mimic enzyme | |
| CN104561270B (en) | The molecular biology differentiating method of two kinds of rice leaf folder larvas | |
| CN104894270B (en) | Primer pair used for identifying peucedanum decursivum and application thereof | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN103266171B (en) | Molecular fingerprint identification method of ferula ferulaeoides and congeneric sibling species | |
| CN104480211A (en) | Molecular specificity labeled primer for identifying T. chinensis seedling and method | |
| CN104450972B (en) | NASBA primer, test kit and the method for detection Fructus Mali pumilae rust fruit virus | |
| CN104498633B (en) | NASBA primer, test kit and the method for detection Peach latent mosaic viroid | |
| CN108018370A (en) | Detection primer group, detection kit and the detection method of Paecilomyces hepiali chen in cordyceps sinensis bacteria culture fluid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |