CN106047889A

CN106047889A - Application of soybean MYB transcription factor gene in improvement of soybean isoflavone biosynthesis

Info

Publication number: CN106047889A
Application number: CN201610389577.5A
Authority: CN
Inventors: 王庆钰; 赵明珠; 闫帆; 王英; 李景文; 王天亮; 郭文云; 申梓邑; 何禹璇; 程浩
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2016-06-03
Filing date: 2016-06-03
Publication date: 2016-10-26
Anticipated expiration: 2036-06-03
Also published as: CN106047889B

Abstract

The invention relates to an application of a soybean MYB transcription factor gene in improvement of soybean isoflavone biosynthesis and belongs to the technical field of genetic engineering. The GmMYB9 gene is 1188bp and encodes 395 amino acids; a yeast one-hybrid experiment result indicates that GmMYB9 has transcriptional activation activity, and a subcellular localization result proves that GmMYB9 is located in a cell nucleus; a real-time fluorescence quantification PCR (polymerase chain reaction) result shows that expression tendency of GmMYB9 in a soybean development process from immature embryos to mature seeds is consistent with accumulation tendency of isoflavone, and the expression quantity of GmMYB9 in a variety with high isoflavone content is higher than that of GmMYB9 in a variety with low isoflavone content; the isoflavone content of seeds and leaves of T2-generation transgenic soybeans with the transformed GmMYB9 gene is increased, therefore, the GmMYB9 gene participates in regulation of the soybean isoflavone biosynthesis and has great significance in cultivation of the soybean varieties with high isoflavone content.

Description

Semen sojae atricolor myb transcription factor gene improves the biosynthetic application of soybean isoflavone

Technical field

The invention belongs to gene engineering technology field, relate to Semen sojae atricolor myb transcription factor GmMYB9 gene and improve the different Huang of Semen sojae atricolor The biosynthetic application of ketone.

Background technology

Semen sojae atricolor contains rich in protein and oils and fats, is important grain and industrial crops.Isoflavone in Semen sojae atricolor can Improve the ability of plant defense abiotic stress, in terms of the nutrition and health of the mankind, there is many effects simultaneously.Isoflavone closes One-tenth approach is branch's approach of plant phenylalanine metabolic pathways approach, and phenylalanine metabolic pathways generally exists in plant, but isoflavone Main synthesis in leguminous plant, its accumulation is together decided on by inherited genetic factors and environmental factors.

Isoflavonoid biosynthetic pathway is completed by multiple key enzyme co-catalysis, individually regulates some key enzyme and cannot obtain pre- The result of phase.But myb transcription factor gene is by being combined with the promoter of isoflavone route of synthesis key gene, it is possible to adjust Control the expression of multiple key gene and that mRNA transcribes is initial, and then participate in the biosynthesis of regulation and control isoflavone.Therefore, research The myb transcription factor of Semen sojae atricolor, analyzes its regulation and control biosynthetic to isoflavone on transcriptional level, illustrates its correlation function, have Help further appreciate that the Regulation Mechanism of soybean isoflavone.

Summary of the invention

It is an object of the invention to provide a kind of Semen sojae atricolor myb transcription factor GmMYB9 gene and improve soybean isoflavone biosynthesis Application.

Isoflavone content belongs to quantitative trait, is quantitative inheritance type.In recent years, existing research report shows and is positioned at Gene near quantitative trait locus (Quantitative Trait Locus, QTL) can regulate and control corresponding quantitative trait, as FASCIATED EAR2 near corn kernel line number QTL improves corn yield by the seed line number regulating and controlling every fringe Semen Maydis, So target is focused on the MYB class transcription factor being positioned near soybean isoflavone QTL by us.In order to reduce inherited genetic factors and ring The impact of border factors on soybean isoflavone content, the result of study of we comparative analysis forefathers, choose the selfing line of different cultivars Navigate in different year, different location is positioned at 2 that No. 6 chromosome upstream of Semen sojae atricolor is relevant to soybean isoflavone synthesis QTL, GLY1 and qGm06, find candidate's myb transcription factor gene at the closet marker downstream 0.3cM of qGm06 GmMYB9, up to the present, the effect about GmMYB9 have not been reported.

The present invention utilizes the plant expression vector of gateway technique construction GmMYB9, by agriculture bacillus mediated Semen sojae atricolor embryo GmMYB9 is proceeded in Semen sojae atricolor by point genetic transforming method, it is thus achieved that T₂For genetically engineered soybean, measure T with high-efficient liquid phase technique (HPLC)₂Generation Isoflavone content in the blade of genetically engineered soybean and seed, compared with wild type, transfer-gen plant seed isoflavone content carries High 1.11 times, blade isoflavone content improves 1.56 times, and it is higher that the isoflavone content in blade promotes amplitude, explanation GmMYB9 gene mainly regulates and controls the biosynthesis of isoflavone in blade.In the research of forefathers, R1-MYB transcription factor GmMYB176 can in root of hair the biosynthesis of regulating and controlling soybean isoflavone；The CRC gene of Semen Maydis (transcribe by Semen Maydis R2R3-MYB class The factor and the gene fusion sequence of bHLH class transcription factor) overexpression in soybean seed, the content of total isoflavone improves 3 times It is many, if the table of the enzyme gene F3H (flavanone 3-hydroxylase) of substrate is competed in suppression with IFS while expressing CRC Reaching, the content of isoflavone can improve more than 4 times.Although GmMYB9 gene regulates and controls the biosynthesis effect of isoflavone in soybean seed The CRC gene not having Semen Maydis is obvious, but GmMYB9 gene can improve the isoflavone content in soybean leaves, and this grinds existing Relevant report is there is not yet in studying carefully.Owing to isoflavone can improve the ability of plant defense abiotic stress, so speculating greatly If running into abiotic stress during compound leaf phase to the full ripe stage of bean, GmMYB9 regulates and controls the life of isoflavone in soybean leaves Thing synthesis will play the effect resisting abiotic stress.

Semen sojae atricolor myb transcription factor GmMYB9 provided by the present invention, encoding gene as shown in SEQ ID No.1, it be by The protein of 395 amino acid residue compositions, sequence, as shown in SEQ ID No.2, belongs to typical R2R3 type Semen sojae atricolor MYB and transcribes The factor.

Semen sojae atricolor myb transcription factor GmMYB9 gene provided by the present invention answering in improving soybean isoflavone biosynthesis With.

Semen sojae atricolor myb transcription factor GmMYB9 gene provided by the present invention is isoflavone biosynthesis in improving soybean leaves In application.

Utilize the carrier that any one can guide exogenous gene to express in plant, by GmMYB9 provided by the present invention Encoding gene imports plant cell, can obtain transgenic cell line and transfer-gen plant that isoflavone content improves.Use this During bright gene constructed plant expression vector, promoter or induction can be strengthened plus any one before its transcription initiation nucleotide Type promoter.For the ease of transgenic plant cells or plant being identified and screening, the carrier used can be added Work, as added plant alternative labelling (gus gene, luciferase genes etc.) or having the antibiotic marker thing (celebrating of resistance Big mycin, kanamycin etc.).The expression vector carrying GmMYB9 of the present invention can be by using Ti-plasmids, Ri plasmid, phytopathy Poisonous carrier, directly delivered DNA, microinjection, conductance, the conventional biology methods such as agriculture bacillus mediated convert plant cell or tissue, And the plant tissue of conversion is cultivated into plant.The host being converted both can be monocotyledon, it is also possible to be dicotyledonous planting Thing.The gene pairs improvement leguminous plant isoflavone metabolism of the present invention, particularly cultivates homoisoflavone soybean varieties and has important meaning Justice.

Accompanying drawing explanation

Fig. 1 is the PCR amplification figure of GmMYB9, M.DNA Marker (DL2000), 1.PCR result；

Fig. 2 is GmMYB9 activation capability analysis chart in Yeast system；

Fig. 3 is Subcellular Localization vector Agrobacterium bacterium solution PCR figure, and M.DNA Marker (DL2000), 1-2PCR tie Really；

Fig. 4 is the Subcellular Localization result figure of GmMYB9；

Fig. 5 is GmMYB9 expression figure in Semen sojae atricolor different tissues；

Fig. 6 is the pCAMBIA1301 vector Agrobacterium electrophoretogram connecting CHS8 promoter sequence, M.DNA Marker (DL2000), 1-2PCR result；

Fig. 7 is tobacco leaf GUS activity analysis figure, A:CK；B:CaMV 35S；C:CHS8promoter；D: CHS8promoter+GmMYB9；

Fig. 8 is that plant expression vector converts Agrobacterium bacterium solution PCR electrophoretogram, M.DNA Marker (DL2000), 1-4PCR Result；

Fig. 9 is part T₀、T₁、T₂For the PCR testing result figure of transfer-gen plant, M:DNA Marker (DL2000)；P: sun Character grain；N: Wild-type soy；1-14: genetically engineered soybean；

Figure 10 is part T₂For the Southern blot testing result figure of transfer-gen plant, P: positive plasmid；WT: wild Type Semen sojae atricolor；1-3: convert the plant of pCB35SR1R2-GFP-GmMYB9 carrier；

Figure 11 a is wild type and T₂For the seed isoflavone content figure of transfer-gen plant, WT: Wild-type soy；1-3: turn Change the plant of pCB35SR1R2-GFP-GmMYB9 carrier；

Figure 11 b is the T of wild type and transformed gene GmMYB9₂For the fresh blade isoflavone content figure of transfer-gen plant, WT: Wild-type soy；1-3: convert the plant of pCB35SR1R2-GFP-GmMYB9 carrier；

Figure 12 is GmMYB9 expression spirogram in transfer-gen plant, WT: Wild-type soy；1-3: convert The plant of pCB35SR1R2-GFP-GmMYB9 carrier；

Figure 13 is to turn GmMYB9 gene T₂For the expression analysis figure of isoflavone synthesis key gene in blade；WT: wild Raw type Semen sojae atricolor；1-3: convert the plant of pCB35SR1R2-GFP-GmMYB9 carrier.

Detailed description of the invention

Embodiment 1, the clone of Semen sojae atricolor GmMYB9 gene

The 20d embryo total serum IgE of soybean varieties Williams 82 is extracted, through 1% fine jade with RNAiso Plus (purchased from TaKaRa) The integrity of lipolysaccharide electrophoresis detection RNA.The synthesis of cDNA is according to Reverse Transcriptase M-MLV (RNase H^-) Description is carried out.Full length sequence design primer according to GmMYB9, primer is:

GmMYB9-F:AACAACATAGAGAGCCATAATACCC

GmMYB9-R:CATAGACTCCTCTTTCAAACACCTC

PCR amplification is carried out according to table 1 reaction system:

Table 1PCR amplification reaction system

PCR response procedures is: 95 DEG C of 4min；94 DEG C of 30s, 57 DEG C of 50s, 72 DEG C of 90s, 30 circulations；72 DEG C of extensions 10min.Obtaining GmMYB9 gene through PCR amplification, as it is shown in figure 1, be made up of 1188 base pairs, reading frame is from the 1st, 5' end To the 1188th bit base, encode the protein being made up of 395 amino acid residues, wherein from nitrogen end 13-63 and 66- 114 amino acid residue conserved domains are typical MYB binding domain.

Embodiment 2, the expression in yeast of the Semen sojae atricolor GmMYB9 gene

5' end and 3' end at gene separately design containing EcoR I and the primer of Sal I restriction enzyme site, are just identifying with order-checking The plasmid of true pMD18-T-GmMYB9 is template, carries out PCR amplification, and pMD18-T is purchased from TaKaRa company.Primer is following (to be used Underscore marks restriction enzyme site):

GmMYB9-HF:5'-CCGGAATTCATGGGAAGGAGTCCTTGC-3', EcoR I

GmMYB9-HR:5'-ACGCGTCGACCTACAGATACTGAATGTA-3', Sal I

Amplified production is reclaimed test kit (purchased from BioTeke company) through agarose gel DNA purification and after purification, uses EcoR I and Sal I double digestion, reclaims after purification, with same by pGBKT7 (purchased from the clontech) load of EcoR I and Sal I double digestion Body connects.Connect product and convert angstrom Xi Shi escherichia coli (E.coli) DH5 α, after empirical tests, proceed to yeast AH109 and (be purchased from Clontech) express in.

Competent yeast preparation and method for transformation are with reference to Matchmaker^TMOne-HybridLibrary Construction&Screening Kit (clontech) description is carried out.

After recombiant plasmid pGBKT7-GmMYB9 proceeds to yeast AH109, it is possible to train at the auxotroph containing 5mM 3-AT Support the upper growth of base SD/-Trp/-His/-Ade (Fig. 2), illustrate that GmMYB9 has transcriptional activation activity, be transcription activator.

Embodiment 3, the Subcellular Localization research of Semen sojae atricolor GmMYB9 gene

Remove the termination codon of GmMYB9, use the method for Overlap extension PCR (SOE-PCR) to build GmMYB9 with green The fusion gene of fluorescence protein gene eGFP, separately designs containing Xba I and the primer of SacI restriction enzyme site at 5' end and 3' end, with Identify that correct pMD18-T-GmMYB9 and peGFP-X1 is template, respectively with O-F3 and O-R3, O-F4 and O-R4 for drawing in pairs Thing carries out regular-PCR amplification, and PCR primer carries out labelling after reclaiming.Primer is following (marking restriction enzyme site with underscore):

GmMYB9-SOE-F(O-F3):5'-GCTCTAGAATGGGAAGGAGTCCTTGC-3',Xba I

GmMYB9-SOE-R(O-R3):

5'-CACCATCAGATACTGAATGTACTT-3'(wave represents even

Meet the Linker between genes of interest and reporter gene)

eGFP-SOE-F(O-F4):

5'-GTATCTGATGGTGAGCAAGGGCGAG-3'

eGFP-SOE-R(O-R4):5'-CGAGCTCTTACTTGTACAGCTCGTC-3',SacI

Using reclaim GmMYB9 and eGFP as template, O-F3 and O-R4 is primer, select high-fidelity enzyme Primer Star (purchased from TaKaRa) carries out SOE-PCR, to obtain GmMYB9:eGFP fusion gene.Reaction system is as shown in table 2:

Table 2SOE-PCR amplification system

Response procedures is: 94 DEG C of 5min

95 DEG C of 10s, 68 DEG C-1 DEG C/cycle 20s, 68 DEG C of 3min, 10cycles

95℃10s

46 DEG C of 20s, 68 DEG C of 3min, 22cycles

68℃10min

10℃forever

Amplified production is reclaimed test kit (purchased from BioTeke company) through agarose gel DNA purification and after purification, uses Xba I and SacI double digestion, reclaims after purification, with same use Xba I and pBI121 (preservation of this laboratory) carrier of SacI double digestion Connect.Connect product and convert angstrom Xi Shi escherichia coli (E.coli) DH5 α, after empirical tests, proceed to Agrobacterium tumefaciems EHA105 (this Laboratory preserves) middle expression.

The competent preparation of Agrobacterium tumefaciems EHA105 uses conventional CaCl₂Method.

After recombiant plasmid pBI121-GmMYB9:eGFP proceeds to Agrobacterium tumefaciems EHA105 (Fig. 3), convert onion epidermis thin Born of the same parents, make Temporary slide, observe the positioning scenarios of GmMYB9 under laser confocal microscope, and result shows that GmMYB9 is positioned at In nucleus (Fig. 4).

Embodiment 4, the tissue specific expression of Semen sojae atricolor GmMYB9 gene

Extract Semen sojae atricolor Williams 82, stem, leaf, flower, pod and 20d, 30d, 40d, 50d immature embryo, Semen sojae atricolor respectively Williams 82 mature seed, Semen sojae atricolor cultivate the total serum IgE of mirror 35 mature seeds, and reverse transcription becomes cDNA, and method is with embodiment 1.Profit With real-time fluorescence quantitative PCR to GmMYB9 gene Semen sojae atricolor Williams 82 different tissues and Semen sojae atricolor cultivate mirror 35 mature seeds in Expression detect.According to SYBR Premix Ex Taq (purchased from TaKaRa) description, at real-time fluorescence quantitative PCR Instrument ABI 7500 is carried out.With Semen sojae atricolor β-tubulin as reference gene, primer is as follows: β-Tublin-F:5'- GGAAGGCTTTCTTGCATTGGTA-3'

β-Tublin-R:5'-AGTGGCATCCTGGTACTGC-3'

GmMYB9-Q-F:5'-TAAGCCAAGAAGAAGAGCAGAC-3'

GmMYB9-Q-R:5'-CGTTATCAGTTCGCTTTGGTA-3'

PCR reaction system such as table 3:

Table 3 real-time fluorescence quantitative PCR reaction system

Response procedures is: 95 DEG C of 30s；95 DEG C of 5s, 60 DEG C of 34s, 72 DEG C of 30s, 40 circulations.

Use 2^-ΔΔCTMethod analytical data, determines the relative expression quantity of gene.Test sets 3 technology altogether and repeats, 3 secondary pollutants Learn and repeat.

Result (Fig. 5) shows that GmMYB9 gene all has expression, in blade at each tissue site of Semen sojae atricolor Williams 82 Expression is the highest, is 10 times in mature seed.Along with the prolongation of soybean immature embryonic development time, the expression of GmMYB9 gene Amount also increases, and this is consistent with the isoflavone of forefathers' research accumulation trend in soybean immature embryo.Simultaneously at different product Planting the expression in soybean seed the most different, the expression in the Williams82 that isoflavone content is higher is higher than isoflavone What content was relatively low cultivates mirror 35, shows that GmMYB9 gene is likely to be of regulating and controlling effect in soybean isoflavone route of synthesis.

Embodiment 5, the regulating and controlling effect of Semen sojae atricolor GmMYB9 gene pairs CHS8 gene

The construction method of plant expression vector is identical with embodiment 2 method.GmMYB9 is subcloned on plant expression vector In pCAMBIA1301, replace the CaMV35S promoter construction of expression vector of pCAMBIA1301 by the promoter (CHS8P) of CHS8 PCAMBIA1301-CHS8P, after identifying correctly, converts Agrobacterium EHA105 (Fig. 6).

Use Agrobacterium-mediated transformation tobacco leaf.With removing the 1ml syringe of syringe needle, will contain respectively PCAMBIA1301 empty carrier, pCAMBIA1301-CHS8P carrier, and pCAMBIA1301-CHS8P and pCB35SR1R2-GFP- (the resuspended rear OD600 of thalline is about for the re-suspension liquid of the Agrobacterium EHA105 of two kinds of vector plasmids of GmMYB9 and carrier-free re-suspension liquid It is 0.2), it is slowly injected into from tobacco leaf back, carries out labelling with marking pen, after infecting, at 16h illumination, 8h dark photoperiod, Under the conditions of 22 DEG C, 2d is cultivated in moisturizing.

GUS fluoremetry

5.1GUS enzyme extraction

1) take 0.1g tobacco leaf, remove main lobe arteries and veins, put in mortar, add liquid nitrogen grinding and become powder；

2) ground powder is put in the centrifuge tube weighing and crossing Liquid nitrogen precooler in advance, again weigh, record sample-adding Before and sample-adding after the weight (twice difference is example weight) of centrifuge tube, in centrifuge tube, add the enzyme extraction buffering of 600 μ l Liquid, vortex mixes；

3) 4 DEG C, 12000rpm is centrifuged 10min, takes supernatant, and-80 DEG C save backup.

5.1Bradford method measures the protein content of GUS extracting solution

1) configure BSA Concentraton gradient liquid according to table 4, mix with Coomassie brilliant blue G250 solution according to the ratio of 1:5, room temperature Place 5min, wavelength 595nm at measure absorption value, with protein concentration as abscissa, absorption value be vertical coordinate make standard song Line:

Table 4BSA gradient solution

2) draw 20 μ l GUS extracting solution, moisturizing to 4ml, sucking-off 1ml after mixing, add Coomassie brilliant blue G250 solution 5ml, after mixing, room temperature places 5min, measures absorption value at wavelength 595nm, according to protein content in regression equation calculation sample.

5.3 fluoremetry

1) making of standard curve: prepare 10 μm 4-MU mother solutions, with reaction terminating liquid, it is linearly diluted, concentration It is followed successively by 1000nmol/L, 500nmol/L, 250nmol/L, 125nmol/L, 62.5nmol/L, in exciting light 365nm, transmitting Light 455nm, by each fluorescence intensity of fluorescent spectrophotometer assay under the conditions of slit 3nm, makes standard curve；

2) 6 1.5mL centrifuge tubes are taken, each 900 μ l reaction terminating liquids that add, numbering；

3) take 1 1.5mL centrifuge tube, add the 1mL detection liquid 2mmol/LMUG 37 DEG C of preheatings, add appropriate GUS and carry Take liquid (with the protein concentration that measures as foundation), be sufficiently mixed rapidly, take out 100 μ l and add in No. 1 pipes, when record now reacts Between be 0, strict timing；

4) reaction tube is put into 37 DEG C of water bath heat preservations and is carried out enzyme reaction, respectively at 5,10,15,30,60min time respectively take out 100 μ L is equipped with in the 2-6 pipe of 900 μ l reaction terminating liquids mixing, respectively enzyme reaction 5,10,15,30,60min time sample, At exciting light 365nm, launch light 455nm, under the conditions of slit 3nm, measure each fluorescence intensity, read No. 2-6 pipe by standard curve Middle 4-MU content.

5.4GUS enzymatic activity calculates

1) enzyme activity unit definition: hydrolysis 4-MUG per minute generation 1nmol or 1mg, 1 μ g, the enzyme amount of 1ng 4-MU are Individual unit of activity, obtains the enzyme activity of each sample according to definition；

2) gus gene expression activity: represent with the enzyme activity of every milligram of albumen, with every milligram of albumen catalysis per minute MUG Generate a 1pmol 4-MU active unit as GUS.

Fluorescence measurement (Fig. 7) shows, the tobacco leaf fluorescent value infecting re-suspension liquid is relatively low；Infect containing CaMV35S Promoter improves with the GUS fluorescent value of the tobacco leaf of the pCAMBIA1301 plasmid vector of CHS8 promoter；Infect altogether The GUS fluorescent value ratio of the tobacco leaf of pCAMBIA1301-CHS8P with pCB35SR1R2-GFP-GmMYB9 plasmid vector is individually invaded Wanting of dye pCAMBIA1301-CHS8P plasmid vector is high.This indicates that, having proceeded to GmMYB9 gene has tune to CHS8 gene really Control effect, makes the tobacco leaf GUS fluorescence activity of cotransformation raise.And CHS8 gene is the pass in Isoflavone route of synthesis Key enzyme.

Embodiment 6, the GmMYB9 expression in Semen sojae atricolor and the analysis to the regulation and control of isoflavone biosynthesis pathway

Utilize gateway technique construction plant expression vector pCB35SR1R2-GFP-GmMYB9, public with reference to invitrogen The method that department provides.Use agriculture bacillus mediated Semen sojae atricolor embryo point genetic transformation by plant expression vector pCB35SR1R2-GFP- GmMYB9 (Fig. 8) soybean transformation Jilin 35, and transfer-gen plant is carried out PCR, Southern blot qualification, detect sun simultaneously Property plant in the expression of key gene, tool on destination gene expression amount, isoflavone content and isoflavone synthesis path Body method and result are as follows:

The genetic transformation of 6.1 Semen sojae atricolor embryo points and screening

1) seed disinfection: picking full seed, ganoid Semen sojae atricolor Jilin 35 seed are laid in clean culture dish, In fume hood, being opened wide by culture dish and be placed in exsiccator, the 250ml beaker that will be equipped with 52ml water and 44ml sodium hypochlorite is also put Entering in exsiccator, be slowly added to 4ml concentrated hydrochloric acid along beaker inwall, the lid of the exsiccator that closes rapidly seals, sterilizing 12h.Sterilizing After end, seal the seam crossing of culture dish with preservative film, be placed in superclean bench and open culture dish, blow 20-30min and remove many Remaining chlorine；

2) picking contains the Agrobacterium monoclonal of pCB35SR1R2-GFP-GmMYB9 carrier in 2ml additional 50mg/L rif With in the liquid YEP medium of 50mg/L Km, 28 DEG C of 160rpm shaken cultivation 24h；

3) taking the above-mentioned bacterium solution of 1ml to pour in the 200ml liquid YEP containing same antibiotic, 28 DEG C of 250rpm shaken cultivation are extremely OD₆₀₀About=0.6；

4) bacterium solution after cultivating proceeds in 50mL sterile centrifugation tube, and room temperature 5000rpm is centrifuged 10min and abandons supernatant, collection Thalline, is resuspended in thalline in the 1/2MS fluid medium of additional 0.02%silwet77 (pH 5.4), and ice bath 1h activates bacterium Liquid；

5) Semen sojae atricolor after sterilizing is proceeded to additional 2mg/L 2, in the liquid MS medium of 4-D, 25 DEG C of light culture 12-16h；

6) in superclean bench, separate Semen sojae atricolor embryo point with scalpel with tweezers, be positioned in the bacterium solution activated, vacuum Infecting 15min, the embryo point after infecting is placed on the 1/2MS solid medium of additional 5mg/L 6-BA (pH5.4), 25 DEG C of dark Condition co-cultures 2-3d；

7) the Semen sojae atricolor embryo point after co-culturing proceeds to additional 0.6mg/L Basta, the 1/2MS solid of 250mg/L Cef lures In bud screening culture medium (pH 5.7-5.8), cultivate under 25 DEG C/22 DEG C 16/8h illumination/dark conditions, after 2 weeks, embryo point is shifted Lure in bud screening culture medium to new；

8) through 4 weeks screen after, with shears clip plumelet part proceed to additional 0.5mg/L IBA, the 3/ of 100mg/L Cef In 8MS solid root media；

9), after 4 weeks, the seedling seedling exercising 2-3d that will take root, the culture medium cleaning root moves into equipped with land for growing field crops soil: the peat composed of rotten mosses: Vermiculitum (1:1:1), in nutritive cube, cultivate in the phjytotron of 28 DEG C/22 DEG C 16/8h illumination/dark conditions.

The PCR detection of 6.2 transfer-gen plants

1) extracting the blade STb gene of transformed plant, method is with reference to Universal Genomic DNA Extraction Kit Ver.3.0 (purchased from TaKaRa) description is carried out.

2) soybean leaves STb gene is diluted 30 times, take 1 μ l and make template, with unconverted Wild-type soy as negative control, Plasmid pCB35SR1R2-GFP-GmMYB9 is positive control, carries out PCR amplification checking, primer sequence with bar-F, bar-R for primer Arrange as follows:

Bar-F:5'-AAACCCACGTCATGCCAGCTC-3'

Bar-R:5'-CGACAAGCACGGTCAACTTC-3'

3) plant seed of PCR test positive, i.e. T are gathered in the crops₀For seed,

4) by T₀Cultivate in artificial climate room after planting for seed, after continuing screening as stated above, gather in the crops T₁For seed；

5) by T₁It is implanted in plant science institute of Jilin University Transgene-safty release base, to T for seed₂For plant and Its seed makes further research.

Fig. 9 is that GmMYB9 is in part T₀、T₁、T₂For the PCR qualification result in genetically engineered soybean.Result shows, GmMYB9 base Because being incorporated in soybean gene group.

6.3T₂Southern blot for transfer-gen plant detects

First to the T being planted in Transgene-safty release base₂PCR detection is carried out, the good positive of record for plant leaf Plant.Then the blade STb gene of positive plant is extracted, with reference to Soutern hybridization kit DIG High Prime DNA The method of Lableling and Detection Starter Kit I (purchased from Roche Holding Ag) is to T₂Carry out for plant Southern blot detects.Figure 10 is part T₂For the Southern blot testing result of plant, prove GmMYB9 further Gene has been incorporated in soybean gene group, and can stable heredity in Semen sojae atricolor.

The detection of 6.4 Transgenic soybean plants isoflavone contents

T₂After the seed harvest of transfer-gen plant, measure PCR and Southern blot inspection with high-efficient liquid phase technique (HPLC) Survey seed and the blade isoflavone content of plant of being all positive.Result is as shown in (Figure 11 a, Figure 11 b) table 5, table 6, with wild type Comparing, transfer-gen plant seed isoflavone content only improves 1.11 times, changes the least, and rotaring gene plant blade isoflavone contains Amount improves 1.56 times, and the amplitude of lifting is higher than the isoflavone in seed, illustrates that GmMYB9 gene mainly regulates and controls in blade The biosynthesis of isoflavone.

Table 5 wild type and T₂Seed isoflavone content for transfer-gen plant

Table 6 wild type and the T of transformed gene GmMYB9₂Fresh blade isoflavone content for transfer-gen plant

The expression detection of GmMYB9 in 6.5 transfer-gen plants

Extract GmMYB9 transgenic T₂For the blade RNA of positive plant and wild type, after reverse transcription becomes cDNA, with GmMYB9-Q-F, GmMYB9-Q-R are primer, utilize real-time fluorescence quantitative PCR detection GmMYB9 at transfer-gen plant and wild type In expression.As shown in figure 12, compared with wild type, GmMYB9 expression in transgenic line all has and significantly carries result Height, illustrates that GmMYB9 successfully proceeds in Semen sojae atricolor, and can stable heredity.

6.6 the expression analysis of each key gene on isoflavone route of synthesis in transfer-gen plant

Extract wild type respectively and turn GmMYB9 gene T₂For the total serum IgE of blade, reverse transcription becomes cDNA to make template, utilizes real Time fluorescence quantitative PCR detection isoflavone route of synthesis in key gene PAL1 (Phenylalanine ammonia- Lyase), needed for CHS8, IFS2, CHI (chalcone isomerase) and the expression of F3H, each enzyme gene, primer is as follows:

GmPAL1-F:5'-TCAGAGTCAGCGAGAGAAGGAG-3'

GmPAL1-R:5'-GGTGGTGACGCCGTAACTG-3'

GmCHS8-F:5'-ATCCGCCAGGCACAAAGG-3'

GmCHS8-R:5'-TGAAGTAGTAGTCAGGATAGGTGCT-3'

GmIFS2-F:5'-AAGCCTCGTCTTCCCTTCATAG-3'

GmIFS2-R:5'-CAAAGTAGAGAGAGAATAAGGGACC-3'

GmCHI-F:5'-TGTATCAGCGGCGGTCTTG-3'

GmCHI-R:5'-TCAATACCGCAGGCAATCG-3'

GmF3H-F:5'-TTCATTGTCTCCAGCCATCTCC-3'

GmF3H-R:5'-CGCTGTATTCCTCAGTCACCG-3'

Result as shown in figure 13, it may be seen that at the T turning GmMYB9 gene₂For in blade, compared with wild type, The expression of PAL1 slightly reduces, and the expression of IFS2 slightly raises, but does not the most have statistical significance；The expression of F3H is several It is not changed in；The expression of CHS8 and CHI expression in each transgenic line has all reached pole significant level, explanation GmMYB9 regulates and controls the biological conjunction of isoflavone by raising the expression of key gene CHS8 and CHI on isoflavone synthesis path Become.

Claims

1. Semen sojae atricolor myb transcription factor GmMYB9 gene application in improving soybean isoflavone biosynthesis.

2. Semen sojae atricolor myb transcription factor GmMYB9 gene application in isoflavone biosynthesis in improving soybean leaves.

3. Semen sojae atricolor myb transcription factor GmMYB9 gene as claimed in claim 1 answering in improving soybean isoflavone biosynthesis With, the sequence of described Semen sojae atricolor myb transcription factor GmMYB9 is as shown in SEQ ID No.2.

4. Semen sojae atricolor myb transcription factor GmMYB9 gene as claimed in claim 1 answering in improving soybean isoflavone biosynthesis With, the encoding gene of described Semen sojae atricolor myb transcription factor GmMYB9 is as shown in SEQ ID No.1.

5. Semen sojae atricolor myb transcription factor GmMYB9 gene as claimed in claim 2 isoflavone biosynthesis in improving soybean leaves In application, the sequence of described Semen sojae atricolor myb transcription factor GmMYB9 is as shown in SEQ ID No.2.

6. Semen sojae atricolor myb transcription factor GmMYB9 gene as claimed in claim 2 isoflavone biosynthesis in improving soybean leaves In application, the encoding gene of described Semen sojae atricolor myb transcription factor GmMYB9 is as shown in SEQ ID No.1.